Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1668Btlr/Mmmh
Stock Number:
039704-MU
Citation ID:
RRID:MMRRC_039704-MU
Other Names:
R1668 (G1), C57BL/6J-MtgxR1668Btlr
Major Collection:

Strain Information

Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Gsta4
Name: glutathione S-transferase, alpha 4
Synonyms: GST 5.7, mGsta4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14860
VEGA: 9
Homologene: 135605
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Comp
Name: cartilage oligomeric matrix protein
Synonyms: thrombospondin-5, TSP5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12845
HGNC: HGNC:2227
Homologene: 74
Rrm1
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20133
Homologene: 806
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,734,854 bp
  • T to A, chromosome 1 at 44,167,033 bp
  • G to A, chromosome 1 at 74,147,678 bp
  • A to G, chromosome 1 at 107,080,751 bp
  • T to C, chromosome 1 at 128,287,722 bp
  • T to C, chromosome 1 at 163,024,592 bp
  • A to G, chromosome 1 at 182,858,563 bp
  • T to A, chromosome 2 at 36,735,192 bp
  • T to C, chromosome 2 at 60,428,646 bp
  • T to C, chromosome 2 at 69,501,472 bp
  • T to A, chromosome 2 at 85,438,876 bp
  • T to A, chromosome 2 at 152,316,899 bp
  • T to C, chromosome 2 at 157,159,734 bp
  • C to T, chromosome 2 at 157,294,155 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • C to T, chromosome 3 at 121,171,191 bp
  • A to G, chromosome 4 at 6,398,880 bp
  • G to T, chromosome 4 at 42,848,424 bp
  • C to T, chromosome 4 at 59,612,697 bp
  • T to C, chromosome 4 at 98,778,896 bp
  • A to T, chromosome 4 at 149,361,294 bp
  • G to T, chromosome 4 at 155,289,751 bp
  • A to C, chromosome 5 at 6,771,323 bp
  • T to C, chromosome 5 at 35,280,297 bp
  • T to A, chromosome 5 at 109,219,047 bp
  • T to G, chromosome 5 at 110,297,369 bp
  • A to G, chromosome 5 at 118,202,929 bp
  • A to T, chromosome 5 at 124,765,562 bp
  • T to A, chromosome 6 at 42,356,032 bp
  • A to G, chromosome 6 at 57,900,719 bp
  • T to C, chromosome 6 at 70,791,871 bp
  • T to C, chromosome 6 at 89,869,701 bp
  • T to A, chromosome 6 at 90,072,782 bp
  • T to C, chromosome 6 at 91,028,805 bp
  • C to A, chromosome 6 at 112,773,713 bp
  • T to C, chromosome 7 at 25,225,542 bp
  • T to C, chromosome 7 at 42,580,646 bp
  • T to C, chromosome 7 at 97,299,415 bp
  • T to G, chromosome 7 at 102,456,568 bp
  • T to C, chromosome 7 at 107,729,892 bp
  • T to C, chromosome 7 at 143,709,039 bp
  • T to C, chromosome 8 at 25,072,054 bp
  • A to T, chromosome 8 at 70,378,957 bp
  • A to T, chromosome 8 at 91,041,186 bp
  • A to G, chromosome 9 at 20,771,096 bp
  • G to A, chromosome 9 at 37,342,422 bp
  • C to A, chromosome 9 at 39,950,169 bp
  • A to G, chromosome 9 at 74,210,162 bp
  • A to G, chromosome 9 at 78,204,288 bp
  • T to C, chromosome 9 at 110,638,893 bp
  • T to A, chromosome 9 at 113,986,396 bp
  • C to T, chromosome 9 at 113,989,146 bp
  • T to C, chromosome 9 at 114,404,900 bp
  • T to C, chromosome 10 at 39,973,691 bp
  • A to G, chromosome 10 at 80,028,750 bp
  • T to A, chromosome 10 at 81,119,389 bp
  • G to A, chromosome 11 at 3,675,885 bp
  • T to C, chromosome 11 at 87,602,399 bp
  • C to T, chromosome 11 at 95,587,545 bp
  • T to C, chromosome 11 at 96,102,737 bp
  • A to G, chromosome 11 at 99,284,618 bp
  • A to G, chromosome 11 at 101,569,766 bp
  • T to A, chromosome 11 at 116,983,648 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • G to A, chromosome 12 at 50,394,926 bp
  • A to T, chromosome 12 at 59,048,121 bp
  • A to G, chromosome 12 at 69,196,691 bp
  • A to G, chromosome 12 at 76,621,169 bp
  • A to T, chromosome 13 at 22,501,370 bp
  • C to A, chromosome 13 at 46,615,323 bp
  • A to C, chromosome 14 at 26,923,854 bp
  • G to A, chromosome 14 at 50,820,856 bp
  • T to C, chromosome 15 at 73,787,905 bp
  • C to T, chromosome 16 at 5,106,046 bp
  • A to G, chromosome 16 at 33,885,127 bp
  • T to C, chromosome 16 at 84,846,181 bp
  • T to A, chromosome 16 at 93,765,516 bp
  • T to A, chromosome 17 at 32,158,589 bp
  • T to C, chromosome 17 at 45,545,905 bp
  • C to A, chromosome 17 at 47,703,222 bp
  • T to G, chromosome 17 at 56,766,912 bp
  • A to C, chromosome 17 at 73,893,589 bp
  • G to A, chromosome 17 at 74,445,906 bp
  • A to G, chromosome 18 at 33,921,909 bp
  • A to G, chromosome 18 at 66,859,409 bp
  • A to G, chromosome 19 at 7,018,692 bp
  • A to C, chromosome 19 at 13,364,870 bp
  • A to G, chromosome 19 at 24,262,013 bp
  • A to G, chromosome 19 at 26,647,034 bp
  • A to T, chromosome 19 at 40,091,055 bp
  • A to T, chromosome 19 at 41,952,556 bp
  • G to A, chromosome 19 at 47,040,105 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1668 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039704-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.