Strain Name:
C57BL/6J-MtgxR1668Btlr/Mmmh
Stock Number:
039704-MU
Citation ID:
RRID:MMRRC_039704-MU
Other Names:
R1668 (G1), C57BL/6J-MtgxR1668Btlr
Major Collection:

Strain Information

Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Gsta4
Name: glutathione S-transferase, alpha 4
Synonyms: mGsta4, GST 5.7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14860
VEGA: 9
HGNC: HGNC:4626
Homologene: 135605
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: Epb4.1l4a, NBL4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, Dopey2, 2610510B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: b2b1625.2Clo, Gp330, Megalin, D230004K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Comp
Name: cartilage oligomeric matrix protein
Synonyms: thrombospondin-5, TSP5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12845
HGNC: HGNC:2227
Homologene: 74
Rrm1
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20133
Homologene: 806
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: AD013, A330063D19Rik, 1810014J18Rik, 9030205D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 109151
Homologene: 11844
Ppfibp2
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: Cclp1, liprin beta 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19024
HGNC: HGNC:9250
Homologene: 7486
Mms19
Name: MMS19 cytosolic iron-sulfur assembly component
Synonyms: Mms19l, Mms19, C86341, 2610042O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72199
Homologene: 41480
Map2k2
Name: mitogen-activated protein kinase kinase 2
Synonyms: MEK2, Prkmk2, MAP kinase/Erk kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 26396
HGNC: HGNC:6842
Homologene: 48591
Ube4b
Name: ubiquitination factor E4B
Synonyms: D4Bwg0973e, UFD2a, Ufd2p, UFD2, 4930551I19Rik, 4933406G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 63958
Homologene: 107623
Nbr1
Name: NBR1, autophagy cargo receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17966
HGNC: HGNC:6746
Homologene: 7438
Gabpa
Name: GA repeat binding protein, alpha
Synonyms: GABPalpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 14390
HGNC: HGNC:4071
Homologene: 1543
Xdh
Name: xanthine dehydrogenase
Synonyms: XO, Xox-1, xanthine oxidase, Xox1, Xor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22436
VEGA: 17
Homologene: 324
Mc4r
Name: melanocortin 4 receptor
Synonyms: Fatboy, Pkcp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17202
VEGA: 18
HGNC: HGNC:6932
Homologene: 4320
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: factor associated with N-SMase activation, Fan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Ccdc15
Name: coiled-coil domain containing 15
Synonyms: A630039F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245902
VEGA: 9
Homologene: 28448
Rbck1
Name: RanBP-type and C3HC4-type zinc finger containing 1
Synonyms: HOIL-1, Ubce7ip3, HOIL-1L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 24105
Homologene: 32448
Adra2c
Name: adrenergic receptor, alpha 2c
Synonyms: subtype alpha2-C4, alpha2C, Adra-2c, alpha2-C4, [a]2C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11553
HGNC: HGNC:283
Homologene: 20170
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Gab2
Name: growth factor receptor bound protein 2-associated protein 2
Synonyms: D130058I17Rik, p97
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14389
Homologene: 69067
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242553
Homologene: 18244
Sptb
Name: spectrin beta, erythrocytic
Synonyms: D330027P03Rik, brain erythroid spectrin (235E), Spnb1, LOC383567, spectrin R, Spnb-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20741
Homologene: 295
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235627
Homologene: 86422
Glb1
Name: galactosidase, beta 1
Synonyms: Bge, Bgl-e, C130097A14Rik, Bgs, Bgl, Bgt, Bgl-t, Bgl-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12091
VEGA: 9
HGNC: HGNC:4298
Homologene: 47922
Rpn2
Name: ribophorin II
Synonyms: Rpn-2, 1300012C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20014
Homologene: 2214
Rab23
Name: RAB23, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19335
Homologene: 7503
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 2900057D21Rik, 7330406P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 72993
Homologene: 32143
Morc2a
Name: microrchidia 2A
Synonyms: Zcwcc1, 8430403M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74522
Homologene: 8966
Trappc6b
Name: trafficking protein particle complex 6B
Synonyms: 5830498C14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 78232
VEGA: 12
Homologene: 42466
Mtmr4
Name: myotubularin related protein 4
Synonyms: FYVE-DSP2, FYVE zinc finger phosphatase, ZFYVE11, ESTM44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 170749
HGNC: HGNC:7452
Homologene: 3440
Rnft2
Name: ring finger protein, transmembrane 2
Synonyms: B830028P19Rik, Tmem118
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269695
Homologene: 41892
Susd4
Name: sushi domain containing 4
Synonyms: E430021N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 96935
Homologene: 23062
Mgat5b
Name: mannoside acetylglucosaminyltransferase 5, isoenzyme B
Synonyms: GnT-IX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268510
Homologene: 27821
Lct
Name: lactase
Synonyms: LPH, Lphl, LOC226413
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226413
HGNC: HGNC:6530
Homologene: 124204
Ngfr
Name: nerve growth factor receptor (TNFR superfamily, member 16)
Synonyms: p75NGFR, Tnfrsf16, p75 neurotrophin receptor, LNGFR, p75NTR, p75
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18053
HGNC: HGNC:7809
Homologene: 1877
Zyx
Name: zyxin
Synonyms: R75157
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22793
Homologene: 31164
Wdr72
Name: WD repeat domain 72
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546144
Homologene: 52326
Ercc5
Name: excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms: Xpg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22592
HGNC: HGNC:3437
Homologene: 133551
Nlrc4
Name: NLR family, CARD domain containing 4
Synonyms: Ipaf, 9530011P19Rik, Card12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268973
VEGA: 17
Homologene: 10924
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Fermt3
Name: fermitin family member 3
Synonyms: C79673, Kindlin-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 108101
VEGA: 19
Homologene: 12877
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 53867
Homologene: 9253
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: D130026O08Rik, Arhgap14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 259302
Homologene: 56686
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 207618
Homologene: 52304
4921528O07Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Cap2
Name: cyclase associated actin cytoskeleton regulatory protein 2
Synonyms: 2810452G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67252
Homologene: 101397
Or10d5
Name: olfactory receptor family 10 subfamily D member 5
Synonyms: Olfr975, MOR224-2, GA_x6K02T2PVTD-33651220-33650288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258825
VEGA: 9
Homologene: 27275
Vmn1r22
Name: vomeronasal 1 receptor 22
Synonyms: V1rc23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171196
Homologene: 110825
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 435626
Homologene: 52359
Or1j18
Name: olfactory receptor family 1 subfamily J member 18
Synonyms: GA_x6K02T2NLDC-33428755-33429693, MOR136-9, Olfr347
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258945
Homologene: 51790
Nup210
Name: nucleoporin 210
Synonyms: Pom210, gp190, gp210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54563
Homologene: 41286
Mroh5
Name: maestro heat-like repeat family member 5
Synonyms: LOC268816, Gm628
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268816
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Parp2
Name: poly (ADP-ribose) polymerase family, member 2
Synonyms: C78626, Aspartl2, Adprtl2, Adprt2, PARP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11546
VEGA: 14
HGNC: HGNC:272
Homologene: 4004
Cyp2c50
Name: cytochrome P450, family 2, subfamily c, polypeptide 50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107141
Homologene: 137231
Krt24
Name: keratin 24
Synonyms: 2310075C18Rik, 2310058N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 75706
Homologene: 10379
Rwdd3
Name: RWD domain containing 3
Synonyms: 2510027J23Rik, 3110037C01Rik, RSUME
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66568
Homologene: 22899
Fbxl2
Name: F-box and leucine-rich repeat protein 2
Synonyms: Fbl3, 2810423A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72179
Homologene: 135814
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Smarca2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms: brm, Snf2l2, 2610209L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67155
Homologene: 2308
Hsdl2
Name: hydroxysteroid dehydrogenase like 2
Synonyms: 2610207I16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72479
Pcgf6
Name: polycomb group ring finger 6
Synonyms: Mel18 and Bmi1-like RING finger protein, 4933407A11Rik, Rnf134, MBLR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71041
VEGA: 19
Homologene: 12378
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: 1110006M06Rik, ORP5, Obph1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 79196
Homologene: 98024
Spata31f1a
Name: spermatogenesis associated 31 subfamily F member 1A
Synonyms: Gm12429, Fam205a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433698
Homologene: 79022
Frs3
Name: fibroblast growth factor receptor substrate 3
Synonyms: Frs2beta, SNT2, 4930417B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 107971
Homologene: 4845
Vmn2r14
Name: vomeronasal 2, receptor 14
Synonyms: EG231591
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231591
Homologene: 129606
Or5ak25
Name: olfactory receptor family 5 subfamily AK member 25
Synonyms: Olfr995, MOR203-3, GA_x6K02T2Q125-46915844-46914897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258426
Homologene: 105170
Dnaaf2
Name: dynein, axonemal assembly factor 2
Synonyms: kintoun, 1110034A24Rik, 2810020C19Rik, Ktu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 109065
Homologene: 10026
Prkd1
Name: protein kinase D1
Synonyms: Prkcm, Pkcm, PKD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Itgb5
Name: integrin beta 5
Synonyms: [b]-5, beta-5, beta5, [b]5, ESTM23, [b]5A, [b]5B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16419
HGNC: HGNC:6160
Homologene: 20511
Prkcz
Name: protein kinase C, zeta
Synonyms: Pkcz, zetaPKC, aPKCzeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18762
HGNC: HGNC:9412
Homologene: 55681
Vmn1r43
Name: vomeronasal 1 receptor 43
Synonyms: V1ra5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113847
Homologene: 130651
Zfp526
Name: zinc finger protein 526
Synonyms: D030024H03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210172
Homologene: 18447
Or5b113
Name: olfactory receptor family 5 subfamily B member 113
Synonyms: Olfr1467, GA_x6K02T2RE5P-3695694-3696620, MOR202-15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258686
HGNC: HGNC:8324
Homologene: 133888
Fxn
Name: frataxin
Synonyms: Frda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14297
HGNC: HGNC:3951
Homologene: 47908
Vmn1r49
Name: vomeronasal 1, receptor 49
Synonyms: VRi2, V1r5, V1rb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 24112
Homologene: 113975
Arhgap45
Name: Rho GTPase activating protein 45
Synonyms: 6330406L22Rik, Hmha1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70719
Homologene: 69120
Dus3l
Name: dihydrouridine synthase 3 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224907
VEGA: 17
Homologene: 6533
Serpinb3d
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 394252
Homologene: 130559
Vmn1r202
Name: vomeronasal 1 receptor 202
Synonyms: V1ri7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171258
Homologene: 110880
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: Ndp52, Ndp52l1, 2410154J16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76815
Zfp977
Name: zinc finger protein 977
Synonyms: Gm7221
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 637776
Ppl
Name: periplakin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Mfsd4b5
Name: major facilitator superfamily domain containing 4B5
Synonyms: BC021785
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215928
Homologene: 129849
Plekha2
Name: pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
Synonyms: TAPP2, 6430512N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 83436
Homologene: 41822
Rpia
Name: ribose 5-phosphate isomerase A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19895
Homologene: 6943
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Tmem151b
Name: transmembrane protein 151B
Synonyms: LOC210573
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210573
VEGA: 17
Homologene: 19365
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,734,854 bp
  • T to A, chromosome 1 at 44,167,033 bp
  • G to A, chromosome 1 at 74,147,678 bp
  • A to G, chromosome 1 at 107,080,751 bp
  • T to C, chromosome 1 at 128,287,722 bp
  • T to C, chromosome 1 at 163,024,592 bp
  • A to G, chromosome 1 at 182,858,563 bp
  • T to A, chromosome 2 at 36,735,192 bp
  • T to C, chromosome 2 at 60,428,646 bp
  • T to C, chromosome 2 at 69,501,472 bp
  • T to A, chromosome 2 at 85,438,876 bp
  • T to A, chromosome 2 at 152,316,899 bp
  • T to C, chromosome 2 at 157,159,734 bp
  • C to T, chromosome 2 at 157,294,155 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • C to T, chromosome 3 at 121,171,191 bp
  • A to G, chromosome 4 at 6,398,880 bp
  • G to T, chromosome 4 at 42,848,424 bp
  • C to T, chromosome 4 at 59,612,697 bp
  • T to C, chromosome 4 at 98,778,896 bp
  • A to T, chromosome 4 at 149,361,294 bp
  • G to T, chromosome 4 at 155,289,751 bp
  • A to C, chromosome 5 at 6,771,323 bp
  • T to C, chromosome 5 at 35,280,297 bp
  • T to A, chromosome 5 at 109,219,047 bp
  • T to G, chromosome 5 at 110,297,369 bp
  • A to G, chromosome 5 at 118,202,929 bp
  • A to T, chromosome 5 at 124,765,562 bp
  • T to A, chromosome 6 at 42,356,032 bp
  • A to G, chromosome 6 at 57,900,719 bp
  • T to C, chromosome 6 at 70,791,871 bp
  • T to C, chromosome 6 at 89,869,701 bp
  • T to A, chromosome 6 at 90,072,782 bp
  • T to C, chromosome 6 at 91,028,805 bp
  • C to A, chromosome 6 at 112,773,713 bp
  • T to C, chromosome 7 at 25,225,542 bp
  • T to C, chromosome 7 at 42,580,646 bp
  • T to C, chromosome 7 at 97,299,415 bp
  • T to G, chromosome 7 at 102,456,568 bp
  • T to C, chromosome 7 at 107,729,892 bp
  • T to C, chromosome 7 at 143,709,039 bp
  • T to C, chromosome 8 at 25,072,054 bp
  • A to T, chromosome 8 at 70,378,957 bp
  • A to T, chromosome 8 at 91,041,186 bp
  • A to G, chromosome 9 at 20,771,096 bp
  • G to A, chromosome 9 at 37,342,422 bp
  • C to A, chromosome 9 at 39,950,169 bp
  • A to G, chromosome 9 at 74,210,162 bp
  • A to G, chromosome 9 at 78,204,288 bp
  • T to C, chromosome 9 at 110,638,893 bp
  • T to A, chromosome 9 at 113,986,396 bp
  • C to T, chromosome 9 at 113,989,146 bp
  • T to C, chromosome 9 at 114,404,900 bp
  • T to C, chromosome 10 at 39,973,691 bp
  • A to G, chromosome 10 at 80,028,750 bp
  • T to A, chromosome 10 at 81,119,389 bp
  • G to A, chromosome 11 at 3,675,885 bp
  • T to C, chromosome 11 at 87,602,399 bp
  • C to T, chromosome 11 at 95,587,545 bp
  • T to C, chromosome 11 at 96,102,737 bp
  • A to G, chromosome 11 at 99,284,618 bp
  • A to G, chromosome 11 at 101,569,766 bp
  • T to A, chromosome 11 at 116,983,648 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • G to A, chromosome 12 at 50,394,926 bp
  • A to T, chromosome 12 at 59,048,121 bp
  • A to G, chromosome 12 at 69,196,691 bp
  • A to G, chromosome 12 at 76,621,169 bp
  • A to T, chromosome 13 at 22,501,370 bp
  • C to A, chromosome 13 at 46,615,323 bp
  • A to C, chromosome 14 at 26,923,854 bp
  • G to A, chromosome 14 at 50,820,856 bp
  • T to C, chromosome 15 at 73,787,905 bp
  • C to T, chromosome 16 at 5,106,046 bp
  • A to G, chromosome 16 at 33,885,127 bp
  • T to C, chromosome 16 at 84,846,181 bp
  • T to A, chromosome 16 at 93,765,516 bp
  • T to A, chromosome 17 at 32,158,589 bp
  • T to C, chromosome 17 at 45,545,905 bp
  • C to A, chromosome 17 at 47,703,222 bp
  • T to G, chromosome 17 at 56,766,912 bp
  • A to C, chromosome 17 at 73,893,589 bp
  • G to A, chromosome 17 at 74,445,906 bp
  • A to G, chromosome 18 at 33,921,909 bp
  • A to G, chromosome 18 at 66,859,409 bp
  • A to G, chromosome 19 at 7,018,692 bp
  • A to C, chromosome 19 at 13,364,870 bp
  • A to G, chromosome 19 at 24,262,013 bp
  • A to G, chromosome 19 at 26,647,034 bp
  • A to T, chromosome 19 at 40,091,055 bp
  • A to T, chromosome 19 at 41,952,556 bp
  • G to A, chromosome 19 at 47,040,105 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1668 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039704-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.