Strain Name:
C57BL/6J-MtgxR1715Btlr/Mmmh
Stock Number:
039748-MU
Citation ID:
RRID:MMRRC_039748-MU
Other Names:
R1715 (G1), C57BL/6J-MtgxR1715Btlr
Major Collection:

Gene Information

Glt8d1
Name: glycosyltransferase 8 domain containing 1
Synonyms: 5430414N14Rik, 2410004H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 76485
VEGA: 14
Homologene: 32720
Psmd7
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Synonyms: Mov-34, Mov34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17463
HGNC: HGNC:9565
Homologene: 2104
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56453
Homologene: 2808
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107182
Homologene: 31978
Emc8
Name: ER membrane protein complex subunit 8
Synonyms: Noc4, Fam158b, Cox4nb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18117
HGNC: HGNC:7864
Homologene: 4424
Smg6
Name: Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103677
Homologene: 23024
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Cip2a
Name: cell proliferation regulating inhibitor of protein phosphatase 2A
Synonyms: Cip2a, C330027C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224171
Homologene: 10842
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231214
Homologene: 18159
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Smim17
Name: small integral membrane protein 17
Synonyms: Gm16532
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100042450
Homologene: 104897
Nlrp3
Name: NLR family, pyrin domain containing 3
Synonyms: NALP3, Pypaf1, Cias1, Mmig1, cryopyrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216799
Homologene: 3600
Crispld2
Name: cysteine-rich secretory protein LCCL domain containing 2
Synonyms: 1810049K24Rik, coffeecrisp, Lgl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 78892
Homologene: 41792
Dag1
Name: dystroglycan 1
Synonyms: dystrophin associated glycoprotein 1, DG, D9Wsu13e, alpha-dystroglycan, beta-dystroglycan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13138
HGNC: HGNC:2666
Homologene: 3234
Ccng1
Name: cyclin G1
Synonyms: cyclin G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12450
HGNC: HGNC:1592
Homologene: 2995
Zfp940
Name: zinc finger protein 940
Synonyms: BC027344
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233057
Homologene: 138421
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269700
Homologene: 28297
Irf8
Name: interferon regulatory factor 8
Synonyms: IRF-8, ICSBP, Myls, Icsbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 15900
HGNC: HGNC:5358
Homologene: 1629
Il16
Name: interleukin 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16170
HGNC: HGNC:5980
Homologene: 18157
Tgm3
Name: transglutaminase 3, E polypeptide
Synonyms: TG E, we
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 21818
Homologene: 20690
Gfi1b
Name: growth factor independent 1B
Synonyms: Gfi-1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14582
HGNC: HGNC:4238
Homologene: 31223
Atp10a
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11982
Homologene: 56461
Rbm22
Name: RNA binding motif protein 22
Synonyms: 8430430L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 66810
Homologene: 69245
Pcyt2
Name: phosphate cytidylyltransferase 2, ethanolamine
Synonyms: 1110033E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68671
HGNC: HGNC:8756
Homologene: 2143
Slc35e1
Name: solute carrier family 35, member E1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270066
Homologene: 49075
Sis
Name: sucrase isomaltase (alpha-glucosidase)
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69983
Homologene: 37424
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 73692
Homologene: 11315
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Carmil3
Name: capping protein regulator and myosin 1 linker 3
Synonyms: Lrrc16b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 268747
VEGA: 14
Homologene: 74564
Slc66a1
Name: solute carrier family 66 member 1
Synonyms: Pqlc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212555
Homologene: 56784
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233335
Homologene: 9081
Rpgrip1
Name: retinitis pigmentosa GTPase regulator interacting protein 1
Synonyms: A930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 77945
Homologene: 10679
Slc17a3
Name: solute carrier family 17 (sodium phosphate), member 3
Synonyms: Npt4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105355
Homologene: 21319
Abca8a
Name: ATP-binding cassette, sub-family A (ABC1), member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, CARDIAK, RIP2, RICK, CARD3, D4Bwg0615e, 2210420D18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 192656
Homologene: 37856
Ifna11
Name: interferon alpha 11
Synonyms: IFN-[a]11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15964
HGNC: HGNC:5425
Homologene: 68536
Tra2b
Name: transformer 2 beta
Synonyms: TRA2beta, Silg41, 5730405G21Rik, Sfrs10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 20462
Homologene: 20965
Scarf1
Name: scavenger receptor class F, member 1
Synonyms: SREC, SREC-I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380713
Homologene: 2741
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69700
Homologene: 43567
Rfx4
Name: regulatory factor X, 4 (influences HLA class II expression)
Synonyms: 4933412G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71137
HGNC: HGNC:9985
Homologene: 31119
Psd4
Name: pleckstrin and Sec7 domain containing 4
Synonyms: SEC7 homolog, EFA6B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 215632
Homologene: 8261
Ces2h
Name: carboxylesterase 2H
Synonyms: Gm5744
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 436059
HGNC: HGNC:1864
Homologene: 128645
Olfr697
Name: olfactory receptor 697
Synonyms: GA_x6K02T2PBJ9-9119301-9118348, MOR283-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258592
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 78257
Homologene: 12692
Hdac10
Name: histone deacetylase 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 170787
Homologene: 23749
Olfr830
Name: olfactory receptor 830
Synonyms: GA_x6K02T2PVTD-12618399-12619337, MOR152-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258559
Homologene: 79360
Sgip1
Name: SH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms: 3110007P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 73094
Homologene: 13001
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384221
Homologene: 104825
2210010C04Rik
Name: RIKEN cDNA 2210010C04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67373
Homologene: 134055
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74691
Homologene: 14311
Cyp2c38
Name: cytochrome P450, family 2, subfamily c, polypeptide 38
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13097
HGNC: HGNC:2622
Homologene: 117948
Wdr20rt
Name: WD repeat domain 20, retrogene
Synonyms: 4921538B03Rik, 4930427E19Rik, Wdr20b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 70948
VEGA: 12
Olfr361
Name: olfactory receptor 361
Synonyms: GA_x6K02T2NLDC-33777519-33776551, MOR159-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258365
Homologene: 27142
Gm5174
Name: predicted gene 5174
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 382395
VEGA: 10
Homologene: 141143
Best2
Name: bestrophin 2
Synonyms: Vmd2l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212989
Homologene: 41187
Cmtr2
Name: cap methyltransferase 2
Synonyms: C730036L12Rik, Ftsjd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234728
Homologene: 10144
Klk1b24
Name: kallikrein 1-related peptidase b24
Synonyms: mGk-24, Klk24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16617
HGNC: HGNC:6364
Homologene: 68141
Gnpda1
Name: glucosamine-6-phosphate deaminase 1
Synonyms: glucose-6-phosphate isomerase, oscillin, Gnp1, Gnpi
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 26384
HGNC: HGNC:4417
Homologene: 38054
Rap2b
Name: RAP2B, member of RAS oncogene family
Synonyms: 4021402C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74012
HGNC: HGNC:9862
Homologene: 55701
Efcab15
Name: EF-hand calcium binding domain 15
Synonyms: 1700023F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69441
Homologene: 132455
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 2 at 24,405,332 bp
  • A to G, chromosome 2 at 28,614,740 bp
  • G to A, chromosome 2 at 37,085,176 bp
  • A to G, chromosome 2 at 41,185,981 bp
  • G to A, chromosome 2 at 130,026,814 bp
  • A to G, chromosome 3 at 61,365,190 bp
  • T to C, chromosome 3 at 72,889,010 bp
  • T to A, chromosome 4 at 16,155,192 bp
  • C to T, chromosome 4 at 88,820,236 bp
  • T to C, chromosome 4 at 102,915,059 bp
  • A to G, chromosome 4 at 139,301,881 bp
  • A to G, chromosome 5 at 43,718,661 bp
  • T to C, chromosome 5 at 109,428,244 bp
  • A to G, chromosome 5 at 121,344,818 bp
  • A to G, chromosome 6 at 41,032,936 bp
  • T to A, chromosome 6 at 85,629,052 bp
  • T to C, chromosome 6 at 115,968,681 bp
  • T to C, chromosome 7 at 6,429,326 bp
  • A to G, chromosome 7 at 29,844,938 bp
  • C to T, chromosome 7 at 44,192,246 bp
  • G to A, chromosome 7 at 58,786,505 bp
  • T to C, chromosome 7 at 67,736,303 bp
  • T to C, chromosome 7 at 83,648,728 bp
  • G to C, chromosome 7 at 106,741,548 bp
  • T to C, chromosome 8 at 72,483,977 bp
  • T to C, chromosome 8 at 85,011,223 bp
  • T to C, chromosome 8 at 105,016,766 bp
  • A to G, chromosome 8 at 107,581,185 bp
  • T to C, chromosome 8 at 110,222,798 bp
  • T to C, chromosome 8 at 119,542,730 bp
  • G to T, chromosome 8 at 120,023,649 bp
  • T to C, chromosome 8 at 120,658,555 bp
  • A to T, chromosome 8 at 120,754,388 bp
  • A to T, chromosome 9 at 18,875,794 bp
  • A to G, chromosome 9 at 59,832,300 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • A to T, chromosome 9 at 108,208,715 bp
  • A to G, chromosome 10 at 84,844,280 bp
  • C to T, chromosome 10 at 86,656,912 bp
  • G to A, chromosome 11 at 40,752,114 bp
  • A to G, chromosome 11 at 59,543,351 bp
  • A to G, chromosome 11 at 74,929,430 bp
  • T to C, chromosome 11 at 75,524,044 bp
  • T to C, chromosome 11 at 103,199,824 bp
  • G to A, chromosome 11 at 110,091,580 bp
  • T to A, chromosome 11 at 120,615,851 bp
  • A to T, chromosome 12 at 65,227,314 bp
  • A to G, chromosome 12 at 72,477,299 bp
  • A to G, chromosome 12 at 112,036,439 bp
  • A to T, chromosome 13 at 23,856,741 bp
  • T to C, chromosome 14 at 31,011,521 bp
  • G to T, chromosome 14 at 50,854,567 bp
  • T to A, chromosome 14 at 52,140,691 bp
  • T to G, chromosome 14 at 55,504,532 bp
  • T to A, chromosome 15 at 8,226,900 bp
  • T to C, chromosome 15 at 72,006,981 bp
  • G to T, chromosome 15 at 89,126,709 bp
  • T to C, chromosome 16 at 22,252,746 bp
  • C to T, chromosome 16 at 49,005,719 bp
  • C to T, chromosome 18 at 38,333,140 bp
  • T to C, chromosome 18 at 60,560,844 bp
  • T to A, chromosome 19 at 36,969,121 bp
  • T to C, chromosome 19 at 39,404,795 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1715 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039748-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.