Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1715Btlr/Mmmh
Stock Number:
039748-MU
Citation ID:
RRID:MMRRC_039748-MU
Other Names:
R1715 (G1), C57BL/6J-MtgxR1715Btlr
Major Collection:

Strain Information

Glt8d1
Name: glycosyltransferase 8 domain containing 1
Synonyms: 5430414N14Rik, 2410004H05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76485
VEGA: 14
Homologene: 32720
Psmd7
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Synonyms: Mov-34, Mov34
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17463
HGNC: HGNC:9565
Homologene: 2104
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107182
Homologene: 31978
Emc8
Name: ER membrane protein complex subunit 8
Synonyms: Noc4, Fam158b, Cox4nb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18117
HGNC: HGNC:7864
Homologene: 4424
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 2 at 24,405,332 bp
  • A to G, chromosome 2 at 28,614,740 bp
  • G to A, chromosome 2 at 37,085,176 bp
  • A to G, chromosome 2 at 41,185,981 bp
  • G to A, chromosome 2 at 130,026,814 bp
  • A to G, chromosome 3 at 61,365,190 bp
  • T to C, chromosome 3 at 72,889,010 bp
  • T to A, chromosome 4 at 16,155,192 bp
  • C to T, chromosome 4 at 88,820,236 bp
  • T to C, chromosome 4 at 102,915,059 bp
  • A to G, chromosome 4 at 139,301,881 bp
  • A to G, chromosome 5 at 43,718,661 bp
  • T to C, chromosome 5 at 109,428,244 bp
  • A to G, chromosome 5 at 121,344,818 bp
  • A to G, chromosome 6 at 41,032,936 bp
  • T to A, chromosome 6 at 85,629,052 bp
  • T to C, chromosome 6 at 115,968,681 bp
  • T to C, chromosome 7 at 6,429,326 bp
  • A to G, chromosome 7 at 29,844,938 bp
  • C to T, chromosome 7 at 44,192,246 bp
  • G to A, chromosome 7 at 58,786,505 bp
  • T to C, chromosome 7 at 67,736,303 bp
  • T to C, chromosome 7 at 83,648,728 bp
  • G to C, chromosome 7 at 106,741,548 bp
  • T to C, chromosome 8 at 72,483,977 bp
  • T to C, chromosome 8 at 85,011,223 bp
  • T to C, chromosome 8 at 105,016,766 bp
  • A to G, chromosome 8 at 107,581,185 bp
  • T to C, chromosome 8 at 110,222,798 bp
  • T to C, chromosome 8 at 119,542,730 bp
  • G to T, chromosome 8 at 120,023,649 bp
  • T to C, chromosome 8 at 120,658,555 bp
  • A to T, chromosome 8 at 120,754,388 bp
  • A to T, chromosome 9 at 18,875,794 bp
  • A to G, chromosome 9 at 59,832,300 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • A to T, chromosome 9 at 108,208,715 bp
  • A to G, chromosome 10 at 84,844,280 bp
  • C to T, chromosome 10 at 86,656,912 bp
  • G to A, chromosome 11 at 40,752,114 bp
  • A to G, chromosome 11 at 59,543,351 bp
  • A to G, chromosome 11 at 74,929,430 bp
  • T to C, chromosome 11 at 75,524,044 bp
  • T to C, chromosome 11 at 103,199,824 bp
  • G to A, chromosome 11 at 110,091,580 bp
  • T to A, chromosome 11 at 120,615,851 bp
  • A to T, chromosome 12 at 65,227,314 bp
  • A to G, chromosome 12 at 72,477,299 bp
  • A to G, chromosome 12 at 112,036,439 bp
  • A to T, chromosome 13 at 23,856,741 bp
  • T to C, chromosome 14 at 31,011,521 bp
  • G to T, chromosome 14 at 50,854,567 bp
  • T to A, chromosome 14 at 52,140,691 bp
  • T to G, chromosome 14 at 55,504,532 bp
  • T to A, chromosome 15 at 8,226,900 bp
  • T to C, chromosome 15 at 72,006,981 bp
  • G to T, chromosome 15 at 89,126,709 bp
  • T to C, chromosome 16 at 22,252,746 bp
  • C to T, chromosome 16 at 49,005,719 bp
  • C to T, chromosome 18 at 38,333,140 bp
  • T to C, chromosome 18 at 60,560,844 bp
  • T to A, chromosome 19 at 36,969,121 bp
  • T to C, chromosome 19 at 39,404,795 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1715 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039748-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.