Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1717Btlr/Mmmh
Stock Number:
039750-MU
Citation ID:
RRID:MMRRC_039750-MU
Other Names:
R1717 (G1), C57BL/6J-MtgxR1717Btlr
Major Collection:

Strain Information

Col1a1
Name: collagen, type I, alpha 1
Synonyms: Col1a-1, Mov-13, Cola1, Cola-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12842
HGNC: HGNC:2197
Homologene: 73874
Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Meis1
Name: Meis homeobox 1
Synonyms: C530044H18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17268
HGNC: HGNC:7000
Homologene: 86803
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Chmp4b
Name: charged multivesicular body protein 4B
Synonyms: 2010012F05Rik, Snf7-2, chromatin modifying protein 4B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75608
Homologene: 57102
Polr1f
Name: RNA polymerase I subunit F
Synonyms: D16Wsu83e, 2810024J17Rik, Twistnb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 28071
VEGA: 12
Homologene: 45411
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 150,333,141 bp
  • T to C, chromosome 1 at 150,859,186 bp
  • T to A, chromosome 1 at 162,926,252 bp
  • A to G, chromosome 2 at 28,556,777 bp
  • A to G, chromosome 2 at 52,210,821 bp
  • A to G, chromosome 2 at 52,308,747 bp
  • A to T, chromosome 2 at 62,046,702 bp
  • A to G, chromosome 2 at 80,512,670 bp
  • T to C, chromosome 2 at 82,974,945 bp
  • A to T, chromosome 2 at 87,149,806 bp
  • A to T, chromosome 2 at 87,191,903 bp
  • AGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA to AGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA, chromosome 2 at 118,232,831 bp
  • G to A, chromosome 2 at 131,073,956 bp
  • T to C, chromosome 2 at 131,084,012 bp
  • A to G, chromosome 2 at 154,657,320 bp
  • T to C, chromosome 3 at 5,403,104 bp
  • T to A, chromosome 3 at 90,056,237 bp
  • C to A, chromosome 3 at 123,112,554 bp
  • T to C, chromosome 3 at 146,646,315 bp
  • T to A, chromosome 4 at 100,302,938 bp
  • G to A, chromosome 4 at 139,633,994 bp
  • A to T, chromosome 4 at 139,638,529 bp
  • C to T, chromosome 4 at 154,998,272 bp
  • GCTCT to GCTCTCT, chromosome 4 at 156,166,519 bp
  • T to C, chromosome 5 at 3,850,580 bp
  • G to A, chromosome 5 at 33,645,602 bp
  • A to T, chromosome 5 at 72,108,351 bp
  • G to A, chromosome 5 at 104,963,555 bp
  • T to G, chromosome 5 at 110,596,212 bp
  • T to A, chromosome 5 at 117,671,449 bp
  • T to C, chromosome 5 at 142,575,350 bp
  • T to A, chromosome 6 at 31,507,644 bp
  • T to C, chromosome 6 at 89,976,829 bp
  • A to G, chromosome 6 at 124,329,588 bp
  • A to T, chromosome 6 at 124,740,513 bp
  • A to G, chromosome 7 at 4,010,789 bp
  • T to C, chromosome 7 at 4,784,133 bp
  • A to G, chromosome 7 at 35,628,446 bp
  • T to C, chromosome 7 at 46,115,815 bp
  • A to C, chromosome 7 at 68,618,977 bp
  • C to T, chromosome 7 at 79,838,256 bp
  • T to C, chromosome 7 at 81,535,109 bp
  • A to T, chromosome 7 at 92,663,585 bp
  • A to G, chromosome 7 at 120,793,386 bp
  • C to A, chromosome 8 at 11,808,712 bp
  • C to A, chromosome 8 at 11,808,713 bp
  • A to T, chromosome 8 at 17,216,692 bp
  • G to T, chromosome 8 at 55,940,907 bp
  • G to A, chromosome 8 at 66,512,347 bp
  • T to C, chromosome 8 at 95,455,808 bp
  • A to T, chromosome 8 at 99,030,705 bp
  • G to T, chromosome 8 at 105,566,835 bp
  • T to A, chromosome 8 at 105,840,199 bp
  • A to T, chromosome 8 at 105,947,571 bp
  • C to T, chromosome 9 at 38,976,410 bp
  • A to G, chromosome 9 at 53,159,953 bp
  • A to T, chromosome 9 at 71,293,671 bp
  • G to T, chromosome 9 at 89,953,913 bp
  • G to A, chromosome 9 at 108,040,996 bp
  • A to T, chromosome 9 at 113,989,449 bp
  • T to C, chromosome 9 at 122,930,631 bp
  • A to T, chromosome 10 at 3,125,050 bp
  • G to A, chromosome 10 at 80,528,797 bp
  • GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT, chromosome 10 at 95,793,779 bp
  • G to A, chromosome 10 at 107,806,503 bp
  • G to A, chromosome 10 at 121,561,645 bp
  • T to C, chromosome 10 at 127,556,269 bp
  • T to C, chromosome 10 at 127,563,665 bp
  • C to A, chromosome 11 at 3,221,303 bp
  • T to A, chromosome 11 at 19,010,608 bp
  • T to A, chromosome 11 at 58,220,635 bp
  • T to A, chromosome 11 at 58,502,059 bp
  • A to G, chromosome 11 at 62,128,392 bp
  • A to G, chromosome 11 at 94,948,392 bp
  • C to T, chromosome 11 at 116,225,492 bp
  • A to G, chromosome 11 at 118,001,042 bp
  • T to G, chromosome 12 at 33,429,917 bp
  • T to A, chromosome 12 at 111,542,217 bp
  • T to A, chromosome 13 at 38,052,950 bp
  • G to C, chromosome 13 at 75,110,828 bp
  • C to T, chromosome 13 at 76,111,826 bp
  • T to C, chromosome 14 at 34,692,745 bp
  • T to C, chromosome 14 at 49,751,664 bp
  • T to C, chromosome 14 at 52,450,839 bp
  • A to G, chromosome 14 at 66,068,558 bp
  • C to A, chromosome 14 at 78,513,348 bp
  • G to A, chromosome 15 at 74,588,788 bp
  • A to T, chromosome 15 at 76,602,566 bp
  • A to T, chromosome 15 at 94,558,379 bp
  • A to G, chromosome 16 at 18,401,569 bp
  • G to A, chromosome 16 at 25,987,198 bp
  • A to G, chromosome 16 at 32,753,405 bp
  • A to G, chromosome 16 at 48,452,477 bp
  • A to G, chromosome 16 at 77,598,397 bp
  • A to T, chromosome 17 at 14,197,913 bp
  • A to G, chromosome 17 at 23,552,050 bp
  • C to T, chromosome 17 at 24,597,068 bp
  • T to C, chromosome 17 at 64,834,449 bp
  • T to C, chromosome 18 at 9,214,364 bp
  • T to C, chromosome 18 at 36,932,184 bp
  • T to A, chromosome 18 at 37,436,788 bp
  • C to A, chromosome 19 at 39,994,439 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1717 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039750-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.