Strain Name:
C57BL/6J-MtgxR1717Btlr/Mmmh
Stock Number:
039750-MU
Citation ID:
RRID:MMRRC_039750-MU
Other Names:
R1717 (G1), C57BL/6J-MtgxR1717Btlr
Major Collection:

Strain Information

Col1a1
Name: collagen, type I, alpha 1
Synonyms: Col1a-1, Mov-13, Cola1, Cola-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12842
HGNC: HGNC:2197
Homologene: 73874
Arhgef7
Name: Rho guanine nucleotide exchange factor (GEF7)
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54126
Homologene: 2895
Meis1
Name: Meis homeobox 1
Synonyms: C530044H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17268
HGNC: HGNC:7000
Homologene: 86803
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 27399
Homologene: 56602
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74737
Homologene: 32282
Chmp4b
Name: charged multivesicular body protein 4B
Synonyms: 2010012F05Rik, Snf7-2, chromatin modifying protein 4B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75608
Homologene: 57102
Polr1f
Name: RNA polymerase I subunit F
Synonyms: D16Wsu83e, 2810024J17Rik, Twistnb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 28071
VEGA: 12
Homologene: 45411
Ddx10
Name: DEAD box helicase 10
Synonyms: 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 77591
VEGA: 9
HGNC: HGNC:2735
Homologene: 20922
Abcc8
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Fzd8
Name: frizzled class receptor 8
Synonyms: Fz8, mFZ8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 14370
VEGA: 18
HGNC: HGNC:4046
Homologene: 40606
Csnk2a2
Name: casein kinase 2, alpha prime polypeptide
Synonyms: CK2, 1110035J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13000
HGNC: HGNC:2459
Homologene: 20444
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Nckap1
Name: NCK-associated protein 1
Synonyms: mh19, Hem-2, H19, Nap1, Hem2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 50884
HGNC: HGNC:7666
Homologene: 8384
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74203
Homologene: 10522
Wapl
Name: WAPL cohesin release factor
Synonyms: A530089A20Rik, Wapal
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218914
Homologene: 41002
Ttc37
Name: tetratricopeptide repeat domain 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Irak4
Name: interleukin-1 receptor-associated kinase 4
Synonyms: NY-REN-64, IRAK-4, 9330209D03Rik, 8430405M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 266632
Homologene: 41109
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd-1, Ssdh1, ALDH4, A930035F14Rik, Ahd1, P5CDH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212647
HGNC: HGNC:406
Homologene: 6081
Ankrd27
Name: ankyrin repeat domain 27 (VPS9 domain)
Synonyms: D330003H11Rik, Varp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 245886
Homologene: 12956
Eif5
Name: eukaryotic translation initiation factor 5
Synonyms: D12Ertd549e, 2810011H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217869
VEGA: 12
HGNC: HGNC:3299
Homologene: 49610
Galnt9
Name: polypeptide N-acetylgalactosaminyltransferase 9
Synonyms: GalNAc-T9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231605
HGNC: HGNC:4131
Homologene: 72793
Ror1
Name: receptor tyrosine kinase-like orphan receptor 1
Synonyms: Ntrkr1, 2810404D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26563
Homologene: 3675
Zfp105
Name: zinc finger protein 105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22646
Homologene: 2568
Slc12a4
Name: solute carrier family 12, member 4
Synonyms: KCC1, K-Cl Co-transporter-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20498
Homologene: 21056
Morc1
Name: microrchidia 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17450
VEGA: 16
HGNC: HGNC:7198
Homologene: 7843
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
Riok1
Name: RIO kinase 1
Synonyms: 5430416A05Rik, 3110046C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 71340
VEGA: 13
Homologene: 6950
Pgs1
Name: phosphatidylglycerophosphate synthase 1
Synonyms: 2610019F11Rik, 4933424M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74451
Homologene: 5467
Tbk1
Name: TANK-binding kinase 1
Synonyms: 1200008B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56480
VEGA: 10
Homologene: 22742
Akap11
Name: A kinase (PRKA) anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219181
HGNC: HGNC:369
Homologene: 8279
Dact2
Name: dishevelled-binding antagonist of beta-catenin 2
Synonyms: dapper2, 2900084M21Rik, Frd2, Dpr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240025
VEGA: 17
Homologene: 18237
Armh4
Name: armadillo-like helical domain containing 4
Synonyms: 3632451O06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67419
Homologene: 12127
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94109
Homologene: 69536
Anpep
Name: alanyl (membrane) aminopeptidase
Synonyms: Cd13, aminopeptidase N, Apn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16790
HGNC: HGNC:500
Homologene: 68163
Tsc2
Name: TSC complex subunit 2
Synonyms: tuberin, Nafld, tuberous sclerosis 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22084
VEGA: 17
Homologene: 462
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80892
Homologene: 23477
Aldh1a2
Name: aldehyde dehydrogenase family 1, subfamily A2
Synonyms: Raldh2, Aldh1a7, retinaldehyde dehydrogenase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19378
Homologene: 68368
Ksr2
Name: kinase suppressor of ras 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 333050
Homologene: 45469
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Siglec1
Name: sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms: CD169, Siglec-1, Sn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20612
Homologene: 124458
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Cdh8
Name: cadherin 8
Synonyms: cad8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12564
HGNC: HGNC:1767
Homologene: 55604
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Vwa3a
Name: von Willebrand factor A domain containing 3A
Synonyms: E030013G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233813
Homologene: 18607
Specc1
Name: sperm antigen with calponin homology and coiled-coil domains 1
Synonyms: 2810012G08Rik, B230396K10Rik, Cytsb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432572
Homologene: 45157
Fsip1
Name: fibrous sheath-interacting protein 1
Synonyms: 4933432K11Rik, 1700012M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71313
Homologene: 12390
Lrrd1
Name: leucine rich repeats and death domain containing 1
Synonyms: 4932412H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242838
Homologene: 18247
Arvcf
Name: armadillo repeat gene deleted in velocardiofacial syndrome
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 11877
HGNC: HGNC:728
Homologene: 31046
4732465J04Rik
Name: RIKEN cDNA 4732465J04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 414105
Evpl
Name: envoplakin
Synonyms: 210kDa protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14027
HGNC: HGNC:3503
Homologene: 1506
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 628870
Homologene: 46008
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94229
Homologene: 23340
Synpo2
Name: synaptopodin 2
Synonyms: myopodin, Myo, 1110069I04Rik, 9530006G20Rik, 2310068J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 118449
Homologene: 15400
Adam2
Name: a disintegrin and metallopeptidase domain 2
Synonyms: Ph30-beta, Ftnb, fertilin beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11495
VEGA: 14
HGNC: HGNC:198
Homologene: 1127
Gabrb1
Name: gamma-aminobutyric acid (GABA) A receptor, subunit beta 1
Synonyms: Gabrb-1, B230208N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14400
HGNC: HGNC:4081
Homologene: 20221
Vmn1r46
Name: vomeronasal 1 receptor 46
Synonyms: V1rb8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113856
Homologene: 134021
Abcg3
Name: ATP binding cassette subfamily G member 3
Synonyms: Mxr2, Abcp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27405
HGNC: HGNC:74
Homologene: 86845
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269615
Homologene: 85172
Cyp2c37
Name: cytochrome P450, family 2. subfamily c, polypeptide 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13096
Homologene: 137231
Fsd2
Name: fibronectin type III and SPRY domain containing 2
Synonyms: Spryd1, 9830160G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244091
Homologene: 18252
Fbxl2
Name: F-box and leucine-rich repeat protein 2
Synonyms: 2810423A21Rik, Fbl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72179
Homologene: 135814
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: B830018M07Rik, Bai1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
4930503B20Rik
Name: RIKEN cDNA 4930503B20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Homologene: 41344
Or8d1b
Name: olfactory receptor family 8 subfamily D member 1B
Synonyms: GA_x6K02T2PVTD-32671531-32672457, MOR171-22, Olfr933
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258433
VEGA: 9
HGNC: HGNC:8481
Homologene: 79676
Rasgrf1
Name: RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms: CDC25Mm, Grfbeta, CDC25, Grf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19417
HGNC: HGNC:9875
Homologene: 74972
Pcdhb12
Name: protocadherin beta 12
Synonyms: Pcdhb5F, PcdhbL, Pcdh3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93883
HGNC: HGNC:8690
Homologene: 87126
Tsnaxip1
Name: translin-associated factor X (Tsnax) interacting protein 1
Synonyms: TXI1, 1700016K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72236
Homologene: 10194
Or4e2
Name: olfactory receptor family 4 subfamily E member 2
Synonyms: GA_x6K02T2RJGY-534312-533386, MOR244-3, MOR83, Olfr1509
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 57271
HGNC: HGNC:8297
Homologene: 41378
Atp8b3
Name: ATPase, class I, type 8B, member 3
Synonyms: SAPLT, 1700042F02Rik, 1700056N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67331
VEGA: 10
Homologene: 19034
Irgm2
Name: immunity-related GTPase family M member 2
Synonyms: Gtpi, Iigp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 54396
Homologene: 78363
Cel
Name: carboxyl ester lipase
Synonyms: BAL, 1810036E18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12613
HGNC: HGNC:1848
Homologene: 37529
Casp16
Name: caspase 16, apoptosis-related cysteine peptidase
Synonyms: Gm5146, Casp16, Casp16-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381070
Homologene: 72522
P3h2
Name: prolyl 3-hydroxylase 2
Synonyms: Leprel1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 210530
Homologene: 10062
Pdc
Name: phosducin
Synonyms: Rpr-1, Pdc, Rpr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20028
HGNC: HGNC:8759
Homologene: 1950
9230019H11Rik
Name: RIKEN cDNA 9230019H11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215728
VEGA: 10
Mir99ahg
Name: Mir99a and Mirlet7c-1 host gene (non-protein coding)
Synonyms: 2810055G20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 77994
Lair1
Name: leukocyte-associated Ig-like receptor 1
Synonyms: 5133400O11Rik, mLair-1, Lair-1, D7Bwg0421e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 52855
Homologene: 48097
Or2t49
Name: olfactory receptor family 2 subfamily T member 49
Synonyms: GA_x6K02T2NKPP-912840-913784, MOR275-4, Olfr331
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100502887
Homologene: 133015
Cd163
Name: CD163 antigen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93671
HGNC: HGNC:1631
Homologene: 128811
Tktl2
Name: transketolase-like 2
Synonyms: 4933401I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74419
Homologene: 69456
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Mmd2
Name: monocyte to macrophage differentiation-associated 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75104
Homologene: 18425
Slbp
Name: stem-loop binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20492
Homologene: 31389
Or12e1
Name: olfactory receptor family 12 subfamily E member 1
Synonyms: GA_x6K02T2Q125-48676316-48677272, MOR264-6, Olfr1112
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258655
Homologene: 64901
Pcsk1
Name: proprotein convertase subtilisin/kexin type 1
Synonyms: PC3, prohormone convertase 1/3, Nec-1, Nec1, PC1, SPC3, Phpp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18548
HGNC: HGNC:8743
Homologene: 379
Or5as1
Name: olfactory receptor family 5 subfamily AS member 1
Synonyms: GA_x6K02T2Q125-48635468-48634530, MOR181-2, Olfr1111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258586
Homologene: 74238
Fmo6
Name: flavin containing monooxygenase 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226565
Homologene: 68130
Agrp
Name: agouti related neuropeptide
Synonyms: Agrt, agouti related protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11604
HGNC: HGNC:330
Homologene: 7184
Tmem190
Name: transmembrane protein 190
Synonyms: 4930572D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78052
Homologene: 44548
4933434E20Rik
Name: RIKEN cDNA 4933434E20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99650
Homologene: 41041
Grcc10
Name: gene rich cluster, C10 gene
Synonyms: 2310033H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14790
Homologene: 8402
Gm5334
Name: predicted pseudogene 5334
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384639
4930583I09Rik
Name: RIKEN cDNA 4930583I09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78057
VEGA: 17
Pcdha9
Name: protocadherin alpha 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 192161
Homologene: 130700
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 150,333,141 bp
  • T to C, chromosome 1 at 150,859,186 bp
  • T to A, chromosome 1 at 162,926,252 bp
  • A to G, chromosome 2 at 28,556,777 bp
  • A to G, chromosome 2 at 52,210,821 bp
  • A to G, chromosome 2 at 52,308,747 bp
  • A to T, chromosome 2 at 62,046,702 bp
  • A to G, chromosome 2 at 80,512,670 bp
  • T to C, chromosome 2 at 82,974,945 bp
  • A to T, chromosome 2 at 87,149,806 bp
  • A to T, chromosome 2 at 87,191,903 bp
  • AGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA to AGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA, chromosome 2 at 118,232,831 bp
  • G to A, chromosome 2 at 131,073,956 bp
  • T to C, chromosome 2 at 131,084,012 bp
  • A to G, chromosome 2 at 154,657,320 bp
  • T to C, chromosome 3 at 5,403,104 bp
  • T to A, chromosome 3 at 90,056,237 bp
  • C to A, chromosome 3 at 123,112,554 bp
  • T to C, chromosome 3 at 146,646,315 bp
  • T to A, chromosome 4 at 100,302,938 bp
  • G to A, chromosome 4 at 139,633,994 bp
  • A to T, chromosome 4 at 139,638,529 bp
  • C to T, chromosome 4 at 154,998,272 bp
  • GCTCT to GCTCTCT, chromosome 4 at 156,166,519 bp
  • T to C, chromosome 5 at 3,850,580 bp
  • G to A, chromosome 5 at 33,645,602 bp
  • A to T, chromosome 5 at 72,108,351 bp
  • G to A, chromosome 5 at 104,963,555 bp
  • T to G, chromosome 5 at 110,596,212 bp
  • T to A, chromosome 5 at 117,671,449 bp
  • T to C, chromosome 5 at 142,575,350 bp
  • T to A, chromosome 6 at 31,507,644 bp
  • T to C, chromosome 6 at 89,976,829 bp
  • A to G, chromosome 6 at 124,329,588 bp
  • A to T, chromosome 6 at 124,740,513 bp
  • A to G, chromosome 7 at 4,010,789 bp
  • T to C, chromosome 7 at 4,784,133 bp
  • A to G, chromosome 7 at 35,628,446 bp
  • T to C, chromosome 7 at 46,115,815 bp
  • A to C, chromosome 7 at 68,618,977 bp
  • C to T, chromosome 7 at 79,838,256 bp
  • T to C, chromosome 7 at 81,535,109 bp
  • A to T, chromosome 7 at 92,663,585 bp
  • A to G, chromosome 7 at 120,793,386 bp
  • C to A, chromosome 8 at 11,808,712 bp
  • C to A, chromosome 8 at 11,808,713 bp
  • A to T, chromosome 8 at 17,216,692 bp
  • G to T, chromosome 8 at 55,940,907 bp
  • G to A, chromosome 8 at 66,512,347 bp
  • T to C, chromosome 8 at 95,455,808 bp
  • A to T, chromosome 8 at 99,030,705 bp
  • G to T, chromosome 8 at 105,566,835 bp
  • T to A, chromosome 8 at 105,840,199 bp
  • A to T, chromosome 8 at 105,947,571 bp
  • C to T, chromosome 9 at 38,976,410 bp
  • A to G, chromosome 9 at 53,159,953 bp
  • A to T, chromosome 9 at 71,293,671 bp
  • G to T, chromosome 9 at 89,953,913 bp
  • G to A, chromosome 9 at 108,040,996 bp
  • A to T, chromosome 9 at 113,989,449 bp
  • T to C, chromosome 9 at 122,930,631 bp
  • A to T, chromosome 10 at 3,125,050 bp
  • G to A, chromosome 10 at 80,528,797 bp
  • GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT, chromosome 10 at 95,793,779 bp
  • G to A, chromosome 10 at 107,806,503 bp
  • G to A, chromosome 10 at 121,561,645 bp
  • T to C, chromosome 10 at 127,556,269 bp
  • T to C, chromosome 10 at 127,563,665 bp
  • C to A, chromosome 11 at 3,221,303 bp
  • T to A, chromosome 11 at 19,010,608 bp
  • T to A, chromosome 11 at 58,220,635 bp
  • T to A, chromosome 11 at 58,502,059 bp
  • A to G, chromosome 11 at 62,128,392 bp
  • A to G, chromosome 11 at 94,948,392 bp
  • C to T, chromosome 11 at 116,225,492 bp
  • A to G, chromosome 11 at 118,001,042 bp
  • T to G, chromosome 12 at 33,429,917 bp
  • T to A, chromosome 12 at 111,542,217 bp
  • T to A, chromosome 13 at 38,052,950 bp
  • G to C, chromosome 13 at 75,110,828 bp
  • C to T, chromosome 13 at 76,111,826 bp
  • T to C, chromosome 14 at 34,692,745 bp
  • T to C, chromosome 14 at 49,751,664 bp
  • T to C, chromosome 14 at 52,450,839 bp
  • A to G, chromosome 14 at 66,068,558 bp
  • C to A, chromosome 14 at 78,513,348 bp
  • G to A, chromosome 15 at 74,588,788 bp
  • A to T, chromosome 15 at 76,602,566 bp
  • A to T, chromosome 15 at 94,558,379 bp
  • A to G, chromosome 16 at 18,401,569 bp
  • G to A, chromosome 16 at 25,987,198 bp
  • A to G, chromosome 16 at 32,753,405 bp
  • A to G, chromosome 16 at 48,452,477 bp
  • A to G, chromosome 16 at 77,598,397 bp
  • A to T, chromosome 17 at 14,197,913 bp
  • A to G, chromosome 17 at 23,552,050 bp
  • C to T, chromosome 17 at 24,597,068 bp
  • T to C, chromosome 17 at 64,834,449 bp
  • T to C, chromosome 18 at 9,214,364 bp
  • T to C, chromosome 18 at 36,932,184 bp
  • T to A, chromosome 18 at 37,436,788 bp
  • C to A, chromosome 19 at 39,994,439 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1717 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039750-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.