Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1729Btlr/Mmmh
Stock Number:
039761-MU
Citation ID:
RRID:MMRRC_039761-MU
Other Names:
R1729 (G1), C57BL/6J-MtgxR1729Btlr
Major Collection:

Strain Information

Cdk17
Name: cyclin dependent kinase 17
Synonyms: 6430598J10Rik, Pctk2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237459
VEGA: 10
HGNC: HGNC:8750
Homologene: 55666
Septin4
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Chat
Name: choline O-acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Gabarap
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56486
HGNC: HGNC:4067
Homologene: 134119
Jarid2
Name: jumonji and AT-rich interaction domain containing 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Trim59
Name: tripartite motif-containing 59
Synonyms: 2700022F13Rik, TSBF1, Mrf1, 2310035M22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66949
Homologene: 32644
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 58,421,261 bp
  • T to A, chromosome 1 at 63,751,300 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • CAT to CATTAT, chromosome 1 at 115,900,919 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to T, chromosome 1 at 120,063,246 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • C to T, chromosome 1 at 120,120,108 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • T to G, chromosome 1 at 127,942,486 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • C to T, chromosome 1 at 130,804,529 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • C to A, chromosome 1 at 131,766,012 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • A to G, chromosome 1 at 133,363,923 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • G to C, chromosome 1 at 135,283,977 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,450,094 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to T, chromosome 1 at 136,070,627 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • G to A, chromosome 1 at 136,260,710 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • A to G, chromosome 1 at 136,285,897 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • T to C, chromosome 1 at 140,136,788 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • A to T, chromosome 1 at 155,911,981 bp
  • A to G, chromosome 1 at 167,001,630 bp
  • A to G, chromosome 1 at 170,320,410 bp
  • T to A, chromosome 1 at 193,181,893 bp
  • A to G, chromosome 2 at 30,368,968 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • T to G, chromosome 2 at 103,273,906 bp
  • T to C, chromosome 2 at 154,546,875 bp
  • G to T, chromosome 2 at 165,687,663 bp
  • T to C, chromosome 2 at 167,424,145 bp
  • T to A, chromosome 2 at 180,585,449 bp
  • T to C, chromosome 3 at 32,744,840 bp
  • A to T, chromosome 3 at 51,257,572 bp
  • T to C, chromosome 3 at 69,036,853 bp
  • T to C, chromosome 3 at 87,922,232 bp
  • T to A, chromosome 3 at 88,903,098 bp
  • G to A, chromosome 3 at 89,769,365 bp
  • G to A, chromosome 3 at 95,901,248 bp
  • A to G, chromosome 3 at 129,894,940 bp
  • G to A, chromosome 3 at 132,914,397 bp
  • G to A, chromosome 3 at 142,810,701 bp
  • T to C, chromosome 3 at 151,762,819 bp
  • G to A, chromosome 4 at 98,431,780 bp
  • A to G, chromosome 4 at 106,360,421 bp
  • A to C, chromosome 4 at 108,718,501 bp
  • A to G, chromosome 4 at 139,644,161 bp
  • T to A, chromosome 4 at 152,118,304 bp
  • T to A, chromosome 5 at 23,809,843 bp
  • T to G, chromosome 5 at 53,829,372 bp
  • A to G, chromosome 5 at 72,957,614 bp
  • T to C, chromosome 5 at 73,408,218 bp
  • A to G, chromosome 5 at 120,769,027 bp
  • C to A, chromosome 5 at 137,415,018 bp
  • T to C, chromosome 5 at 143,714,626 bp
  • T to A, chromosome 6 at 42,299,514 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 55,968,541 bp
  • C to T, chromosome 6 at 86,413,915 bp
  • A to T, chromosome 6 at 92,190,019 bp
  • A to G, chromosome 7 at 47,464,879 bp
  • C to T, chromosome 7 at 67,149,956 bp
  • T to C, chromosome 7 at 85,857,878 bp
  • T to C, chromosome 7 at 121,125,439 bp
  • T to C, chromosome 7 at 139,998,055 bp
  • T to A, chromosome 8 at 31,201,390 bp
  • T to C, chromosome 8 at 43,625,583 bp
  • A to G, chromosome 8 at 60,526,712 bp
  • T to C, chromosome 8 at 63,348,977 bp
  • A to G, chromosome 8 at 83,423,030 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • A to C, chromosome 9 at 15,996,315 bp
  • A to T, chromosome 9 at 20,170,913 bp
  • C to T, chromosome 9 at 31,414,636 bp
  • G to A, chromosome 9 at 42,391,922 bp
  • A to G, chromosome 9 at 44,104,587 bp
  • G to T, chromosome 9 at 56,898,537 bp
  • A to G, chromosome 9 at 73,665,672 bp
  • G to A, chromosome 9 at 95,897,581 bp
  • A to T, chromosome 9 at 107,564,631 bp
  • T to C, chromosome 9 at 110,098,751 bp
  • T to C, chromosome 10 at 14,439,782 bp
  • C to T, chromosome 10 at 61,475,727 bp
  • T to A, chromosome 10 at 83,508,082 bp
  • T to A, chromosome 10 at 93,224,933 bp
  • CGGG to CGGGGGG, chromosome 11 at 5,201,791 bp
  • G to A, chromosome 11 at 53,866,351 bp
  • A to T, chromosome 11 at 59,185,312 bp
  • G to A, chromosome 11 at 66,085,020 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to C, chromosome 11 at 98,249,970 bp
  • A to T, chromosome 11 at 99,492,964 bp
  • A to G, chromosome 11 at 102,915,541 bp
  • A to G, chromosome 12 at 31,544,494 bp
  • A to G, chromosome 12 at 44,573,850 bp
  • T to C, chromosome 12 at 112,176,785 bp
  • T to A, chromosome 12 at 117,916,931 bp
  • T to C, chromosome 13 at 4,274,340 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • G to A, chromosome 14 at 20,665,819 bp
  • A to T, chromosome 14 at 27,479,633 bp
  • A to T, chromosome 14 at 32,446,795 bp
  • A to T, chromosome 14 at 33,096,005 bp
  • A to G, chromosome 14 at 63,035,924 bp
  • T to C, chromosome 14 at 105,298,135 bp
  • G to A, chromosome 15 at 37,439,600 bp
  • A to G, chromosome 15 at 44,197,153 bp
  • C to A, chromosome 15 at 76,177,692 bp
  • A to G, chromosome 15 at 98,865,132 bp
  • T to A, chromosome 16 at 20,539,338 bp
  • A to G, chromosome 16 at 28,828,421 bp
  • T to C, chromosome 16 at 44,496,419 bp
  • T to C, chromosome 16 at 64,769,022 bp
  • T to A, chromosome 16 at 85,877,915 bp
  • A to G, chromosome 17 at 24,512,379 bp
  • G to T, chromosome 17 at 26,923,315 bp
  • G to T, chromosome 17 at 31,620,949 bp
  • G to T, chromosome 17 at 65,984,076 bp
  • A to T, chromosome 17 at 78,937,629 bp
  • T to A, chromosome 18 at 10,515,190 bp
  • T to A, chromosome 18 at 12,068,312 bp
  • T to C, chromosome 18 at 57,240,792 bp
  • T to C, chromosome 19 at 12,846,930 bp
  • A to C, chromosome 19 at 56,809,220 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1729 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039761-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.