Strain Name:
C57BL/6J-MtgxR1729Btlr/Mmmh
Stock Number:
039761-MU
Citation ID:
RRID:MMRRC_039761-MU
Other Names:
R1729 (G1), C57BL/6J-MtgxR1729Btlr
Major Collection:

Gene Information

Cdk17
Name: cyclin-dependent kinase 17
Synonyms: 6430598J10Rik, Pctk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237459
VEGA: 10
HGNC: HGNC:8750
Homologene: 55666
Septin4
Name: septin 4
Synonyms: Bh5, Pnutl2, cell division control-related protein 2b, ARTS, Sept4, septin H5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Chat
Name: choline acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: C130076O07Rik, Bravo, C030017F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Gabarap
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56486
HGNC: HGNC:4067
Homologene: 134119
Jarid2
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Trim59
Name: tripartite motif-containing 59
Synonyms: Mrf1, 2700022F13Rik, TSBF1, 2310035M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66949
Homologene: 32644
Gon4l
Name: gon-4-like (C.elegans)
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76022
Homologene: 13002
Kdm5b
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, Plu1, Rb-Bp2, Jarid1b, 2210016I17Rik, D1Ertd202e, 2010009J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Ap2m1
Name: adaptor-related protein complex 2, mu 1 subunit
Synonyms: clathrin-associated AP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 11773
HGNC: HGNC:564
Homologene: 3000
Cdk18
Name: cyclin-dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18557
HGNC: HGNC:8751
Homologene: 1949
Nr5a2
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: Ftf, LRH-1, UF2-H3B, D1Ertd308e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26424
HGNC: HGNC:7984
Homologene: 20827
Cxcr4
Name: chemokine (C-X-C motif) receptor 4
Synonyms: PB-CKR, Sdf1r, Cmkar4, CD184, b2b220Clo, fusin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12767
HGNC: HGNC:2561
Homologene: 20739
Dbi
Name: diazepam binding inhibitor
Synonyms: diazepam-binding inhibitor, Acbp, EP, endozepine
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13167
HGNC: HGNC:2690
Homologene: 39086
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12695
Homologene: 72199
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: GAC-1, 2900001A12Rik, ANCO-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106585
Homologene: 9059
Slain2
Name: SLAIN motif family, member 2
Synonyms: 8030444K12Rik, 5033405K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75991
Homologene: 18952
Pkn2
Name: protein kinase N2
Synonyms: Prkcl2, PRK2, 6030436C20Rik, Stk7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Ccdc93
Name: coiled-coil domain containing 93
Synonyms: 9230102M16Rik, 4633402D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70829
Homologene: 10393
Zc3h11a
Name: zinc finger CCCH type containing 11A
Synonyms: G630041M05Rik, 1110003F06Rik, 5730454B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70579
Homologene: 8888
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Calmbp1, Sha1, Aspm, D330028K02Rik, MCPH5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 4930541M15Rik, Camsap1l1, 1600013L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67886
Homologene: 18927
Tasor
Name: transcription activation suppressor
Synonyms: D14Abb1e, Fam208a, 4933409E02Rik, MommeD6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Slc9a8
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms: 6430709P13Rik, NHE8, 1200006P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77031
Homologene: 75041
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2810030C21Rik, 2700066K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329908
Homologene: 35420
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74081
Homologene: 8879
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd1, Ahd-1, P5CDH, Ssdh1, ALDH4, A930035F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212647
HGNC: HGNC:406
Homologene: 6081
Nfrkb
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235134
HGNC: HGNC:7802
Homologene: 4492
Ddx18
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms: 2310005B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66942
HGNC: HGNC:2741
Homologene: 6697
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Trhr
Name: thyrotropin releasing hormone receptor
Synonyms: TRH-R1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 22045
VEGA: 15
Homologene: 20707
Npnt
Name: nephronectin
Synonyms: 1110009H02Rik, POEM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 114249
Homologene: 14138
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: complement-glycosylphosphatidylinositol, Daf1, GPI-DAF, Cromer blood group, Daf-GPI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Kif26a
Name: kinesin family member 26A
Synonyms: N-11 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 668303
Homologene: 18970
Ptprc
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: CD45, B220, T200, Ly-5, Lyt-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Dennd1b
Name: DENN/MADD domain containing 1B
Synonyms: 6820401H01Rik, 4930467M19Rik, 4632404N19Rik, F730008N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329260
Homologene: 11739
Traf7
Name: TNF receptor-associated factor 7
Synonyms: RFWD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224619
Homologene: 12998
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Kremen1
Name: kringle containing transmembrane protein 1
Synonyms: Krm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 84035
Homologene: 12935
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Boc
Name: biregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 117606
Homologene: 32819
Car14
Name: carbonic anhydrase 14
Synonyms: CA XIV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23831
HGNC: HGNC:1372
Homologene: 69105
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329252
Homologene: 49680
Clk1
Name: CDC-like kinase 1
Synonyms: STY, Clk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12747
HGNC: HGNC:2068
Homologene: 101535
Tia1
Name: cytotoxic granule-associated RNA binding protein 1
Synonyms: 2310050N03Rik, mTIA-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21841
Homologene: 20692
Cdk12
Name: cyclin-dependent kinase 12
Synonyms: D11Ertd752e, 1810022J16Rik, Crk7, Crkrs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69131
Homologene: 128632
Tbc1d19
Name: TBC1 domain family, member 19
Synonyms: 2810453K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67249
Homologene: 10130
Elf2
Name: E74-like factor 2
Synonyms: 2610036A20Rik, A230104O07Rik, NERF-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69257
HGNC: HGNC:3317
Homologene: 5006
Cyb5r1
Name: cytochrome b5 reductase 1
Synonyms: 1500005G05Rik, B5R.1, Nqo3a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72017
Homologene: 96059
Fam72a
Name: family with sequence similarity 72, member A
Synonyms: P17, 2700049P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108900
Homologene: 82352
Tubgcp2
Name: tubulin, gamma complex associated protein 2
Synonyms: 1700022B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74237
Homologene: 55980
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67313
Homologene: 10103
Ndfip2
Name: Nedd4 family interacting protein 2
Synonyms: N4wbp5a, 9130207N19Rik, 0710001O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 76273
Homologene: 12636
Usp42
Name: ubiquitin specific peptidase 42
Synonyms: D5Ertd591e, 2410140K03Rik, A630018G05Rik, 3110031A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76800
Homologene: 35425
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, unc53H1, C230080M11Rik, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Kif18b
Name: kinesin family member 18B
Synonyms: N-8 kinesin, 3000004C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70218
Homologene: 15214
Tnfrsf25
Name: tumor necrosis factor receptor superfamily, member 25
Synonyms: DR3, TR3, DDR3, WSL-LR, APO-3, LARD, TRAMP, Tnfrsf12, Wsl, WSL-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 85030
Homologene: 13202
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Kifc5b
Name: kinesin family member C5B
Synonyms: kinesin family c-terminal 5B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16580
VEGA: 17
HGNC: HGNC:6389
Homologene: 83229
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Mb21d2
Name: Mab-21 domain containing 2
Synonyms: 1600021P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239796
VEGA: 16
Homologene: 18614
Steap3
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68428
Homologene: 10084
Fastkd2
Name: FAST kinase domains 2
Synonyms: 2810421I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75619
Homologene: 8957
Tnni1
Name: troponin I, skeletal, slow 1
Synonyms: ssTnI, 2700018B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21952
Homologene: 2462
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: Clc-1, NMF355, SMCC1, nmf355, Clc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Ttn
Name: titin
Synonyms: mdm, 2310036G12Rik, D830007G01Rik, shru, L56, 2310074I15Rik, 2310057K23Rik, connectin, D330041I19Rik, 1100001C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Elf3
Name: E74-like factor 3
Synonyms: ESE-1, ESX, jen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: Dnahc11, b2b1727Clo, b2b1289Clo, b2b1203Clo, b2b1279Clo, avc4, b2b598Clo, lrd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Rnpep
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215615
Homologene: 10628
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, 9430076A06Rik, D430038H04Rik, LOC382129
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Mrgbp
Name: MRG/MORF4L binding protein
Synonyms: 1600027N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 73247
Homologene: 10104
Tecta
Name: tectorin alpha
Synonyms: Tctna, [a]-tectorin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 21683
Homologene: 3955
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 545030
Homologene: 83473
Mapkapk2
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17164
HGNC: HGNC:6887
Homologene: 56412
Aadat
Name: aminoadipate aminotransferase
Synonyms: Kyat2, mKat-2, Kat2, KATII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 23923
Homologene: 56540
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208898
Homologene: 45443
Sctr
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319229
Homologene: 68290
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70417
Homologene: 23771
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22635
Homologene: 124417
Cdh7
Name: cadherin 7, type 2
Synonyms: 9330156F07Rik, CDH7L1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cav1.1, fmd, mdg, muscle dysgenesis, sj, DHPR alpha1s, Cchl1a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: 1110008G13Rik, Liprin-alpha4, Gm3812, LOC100042382
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Spock3
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: 2900045C01Rik, testican 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72902
Homologene: 9662
Eya2
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14049
HGNC: HGNC:3520
Homologene: 40711
Synpo2l
Name: synaptopodin 2-like
Synonyms: 1110054M18Rik, Chap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68760
Homologene: 23499
Mybph
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53311
HGNC: HGNC:7552
Homologene: 3661
Slc22a5
Name: solute carrier family 22 (organic cation transporter), member 5
Synonyms: Lstpl, Octn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20520
Homologene: 68295
Otoa
Name: otoancorin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 246190
Homologene: 71803
Adam34l
Name: a disintegrin and metallopeptidase domain 34 like
Synonyms: Gm5346
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 384813
Homologene: 78104
Ctse
Name: cathepsin E
Synonyms: A430072O03Rik, CatE, CE, C920004C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
HGNC: HGNC:2530
Homologene: 37551
Rint1
Name: RAD50 interactor 1
Synonyms: 2810450M21Rik, 1500019C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72772
Homologene: 11070
Oas3
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: Oasl10, 2'-5' oligoadenylate synthetase-like 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 246727
HGNC: HGNC:8088
Homologene: 4510
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: AN2, 4732461B14Rik, NG2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Chil1
Name: chitinase-like 1
Synonyms: Gp39, Brp39, Chi3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12654
HGNC: HGNC:1932
Homologene: 55569
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 620928
Homologene: 115466
Ndufb5
Name: NADH:ubiquinone oxidoreductase subunit B5
Synonyms: 0610007D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66046
HGNC: HGNC:7700
Homologene: 31093
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76422
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: Mll2, Mll4, C430014K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Necab3
Name: N-terminal EF-hand calcium binding protein 3
Synonyms: 2900010M17Rik, Nip1, XB51, Apba2bp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56846
Homologene: 10992
Dhx30
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 30
Synonyms: C130058C04Rik, helG, 2810477H02Rik, Ddx30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72831
Homologene: 15779
Nos1ap
Name: nitric oxide synthase 1 (neuronal) adaptor protein
Synonyms: 6330408P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70729
Homologene: 135990
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: AK220484, mKIAA4095
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381157
Homologene: 73393
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Kif14
Name: kinesin family member 14
Synonyms: D1Ertd367e, N-3 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Tmem241
Name: transmembrane protein 241
Synonyms: 6030446N20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 338363
Homologene: 87267
Traf3ip3
Name: TRAF3 interacting protein 3
Synonyms: 6030423D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215243
Homologene: 11885
Olfr870
Name: olfactory receptor 870
Synonyms: GA_x6K02T2PVTD-13912679-13911744, MOR141-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 57251
Homologene: 138319
Cwh43
Name: cell wall biogenesis 43 C-terminal homolog
Synonyms: C130090K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231293
Homologene: 5474
Rab7b
Name: RAB7B, member RAS oncogene family
Synonyms: Rab7b, 5430435G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226421
Homologene: 64833
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: C430014H23Rik, A930019K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Slc26a4
Name: solute carrier family 26, member 4
Synonyms: pendrin, Pds
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 23985
VEGA: 12
HGNC: HGNC:8818
Homologene: 20132
Rbsn
Name: rabenosyn, RAB effector
Synonyms: Rabenosyn-5, Zfyve20, 5330426D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78287
Homologene: 41477
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Kif21b
Name: kinesin family member 21B
Synonyms: 2610511N21Rik, N-5 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: DS-epi2, 9330132E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319901
Homologene: 12964
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: Ccdc129, D530004J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232016
Homologene: 52344
Ddx59
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Synonyms: 4833411G06Rik, 1210002B07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67997
Homologene: 12222
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Fut10
Name: fucosyltransferase 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 171167
Homologene: 32790
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, DREG, Gpr126, 1190004A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215798
Homologene: 10724
Guk1
Name: guanylate kinase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14923
HGNC: HGNC:4693
Homologene: 665
Cfh
Name: complement component factor h
Synonyms: Sas-1, Sas1, Mud-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Aldh1l2
Name: aldehyde dehydrogenase 1 family, member L2
Synonyms: D330038I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216188
Homologene: 51942
Ren1
Name: renin 1 structural
Synonyms: Rnr, Ren1c, Ren-1, Ren, Ren-A, Ren1d, Rn-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: Spi8, ovalbumin, NK10, CAP2, CAP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Capn9
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 636808
Homologene: 43974
Krt23
Name: keratin 23
Synonyms: Krt1-23, K23, CK23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 94179
HGNC: HGNC:6438
Homologene: 9172
Ccdc186
Name: coiled-coil domain containing 186
Synonyms: A630007B06Rik, Otg1, 1810028B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 213993
Homologene: 9963
Cbs
Name: cystathionine beta-synthase
Synonyms: HIP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12411
Homologene: 37258
Olfr1240
Name: olfactory receptor 1240
Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
Adamts17
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
Synonyms: AU023434
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233332
Homologene: 16373
Zbed6
Name: zinc finger, BED type containing 6
Synonyms: similar to Zinc finger BED domain containing protein 4, Gm8466, MGR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 667118
Homologene: 130066
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: A530054J02Rik, 1810007I17Rik, Ssa2, Ssa, Trove2, SS-A/Ro
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Lax1
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240754
Homologene: 49504
Ikbke
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
Pla2g12a
Name: phospholipase A2, group XIIA
Synonyms: Pla2g12, GXII, Rossy, 2310004B05Rik, mGXII-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66350
Homologene: 11328
Ehf
Name: ets homologous factor
Synonyms: 9030625L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13661
HGNC: HGNC:3246
Homologene: 7301
Mfrp
Name: membrane frizzled-related protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 259172
Homologene: 12866
Adamts5
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms: 9530092O11Rik, ADAM-TS5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Mrgpra2b
Name: MAS-related GPR, member A2B
Synonyms: MrgA2, Mrgpra2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 235712
Homologene: 79615
Zp3r
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22789
Homologene: 7609
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: C330011J12Rik, PI3K-C2beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Ptpn7
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: C920001D21Rik, LC-PTP, BPTP-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320139
HGNC: HGNC:9659
Homologene: 15411
Lmod1
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 9530015K06Rik, SM-Lmod, D1, 1D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93689
HGNC: HGNC:6647
Homologene: 8118
Ndufaf7
Name: NADH:ubiquinone oxidoreductase complex assembly factor 7
Synonyms: 2410091C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 73694
VEGA: 17
Homologene: 12508
4930447A16Rik
Name: RIKEN cDNA 4930447A16 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74892
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Rgs18
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64214
Homologene: 11281
Clgn
Name: calmegin
Synonyms: 4930459O04Rik, Cln, A2/6, calnexin-t
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12745
HGNC: HGNC:2060
Homologene: 68392
4930453N24Rik
Name: RIKEN cDNA 4930453N24 gene
Synonyms: din
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67609
Homologene: 27867
Miga2
Name: mitoguardin 2
Synonyms: Fam73b, 5730472N09Rik, R74766
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 108958
Homologene: 13125
Defb30
Name: defensin beta 30
Synonyms: 4930449O14Rik, 2410125J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 73670
Homologene: 86862
Ifi44l
Name: interferon-induced protein 44 like
Synonyms: H-28, H28, NS1178
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 15061
Homologene: 48468
Tnnt2
Name: troponin T2, cardiac
Synonyms: cardiac TnT, Tnt, cTnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Chit1
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71884
HGNC: HGNC:1936
Homologene: 68318
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Rab3gap1
Name: RAB3 GTPase activating protein subunit 1
Synonyms: p130, 4732493F09Rik, 1700003B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226407
Homologene: 45617
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
Fcamr
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64435
Homologene: 12929
Etnk2
Name: ethanolamine kinase 2
Synonyms: 4933417N20Rik, Eki2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214253
Homologene: 10072
Olfr453
Name: olfactory receptor 453
Synonyms: MOR257-8P, GA_x6K02T2P3E9-4815856-4814903
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
HGNC: HGNC:8246
Homologene: 128151
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, ovalbumin, Planh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Akr1c12
Name: aldo-keto reductase family 1, member C12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 622402
Homologene: 121208
Fcmr
Name: Fc fragment of IgM receptor
Synonyms: FcmuR, Faim3, 1810037B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69169
Homologene: 48347
Fam78b
Name: family with sequence similarity 78, member B
Synonyms: C030020L09Rik, C030014K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226610
Homologene: 18451
Mrpl24
Name: mitochondrial ribosomal protein L24
Synonyms: 6720473G22Rik, 2810470K06Rik, 2010005E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67707
Homologene: 12241
Tusc2
Name: tumor suppressor 2, mitochondrial calcium regulator
Synonyms: Pdap2, 1190001E22Rik, Fus1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 80385
Homologene: 5264
Lad1
Name: ladinin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16763
HGNC: HGNC:6472
Homologene: 4059
Gm4793
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215714
Rab29
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226422
HGNC: HGNC:9789
Homologene: 20842
Ptprv
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: mOST-PTP, OST, OST-PTP, Esp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Gpr25
Name: G protein-coupled receptor 25
Synonyms: LOC383563
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 383563
HGNC: HGNC:4480
Homologene: 3872
4632404H12Rik
Name: RIKEN cDNA 4632404H12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74034
D830039M14Rik
Name: RIKEN cDNA D830039M14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 108167814
VEGA: 10
Gm5244
Name: predicted pseudogene 5244
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 383436
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 58,421,261 bp
  • T to A, chromosome 1 at 63,751,300 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • CAT to CATTAT, chromosome 1 at 115,900,919 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to T, chromosome 1 at 120,063,246 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • C to T, chromosome 1 at 120,120,108 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • T to G, chromosome 1 at 127,942,486 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • C to T, chromosome 1 at 130,804,529 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • C to A, chromosome 1 at 131,766,012 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • A to G, chromosome 1 at 133,363,923 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • G to C, chromosome 1 at 135,283,977 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,450,094 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to T, chromosome 1 at 136,070,627 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • G to A, chromosome 1 at 136,260,710 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • A to G, chromosome 1 at 136,285,897 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • T to C, chromosome 1 at 140,136,788 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • A to T, chromosome 1 at 155,911,981 bp
  • A to G, chromosome 1 at 167,001,630 bp
  • A to G, chromosome 1 at 170,320,410 bp
  • T to A, chromosome 1 at 193,181,893 bp
  • A to G, chromosome 2 at 30,368,968 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • T to G, chromosome 2 at 103,273,906 bp
  • T to C, chromosome 2 at 154,546,875 bp
  • G to T, chromosome 2 at 165,687,663 bp
  • T to C, chromosome 2 at 167,424,145 bp
  • T to A, chromosome 2 at 180,585,449 bp
  • T to C, chromosome 3 at 32,744,840 bp
  • A to T, chromosome 3 at 51,257,572 bp
  • T to C, chromosome 3 at 69,036,853 bp
  • T to C, chromosome 3 at 87,922,232 bp
  • T to A, chromosome 3 at 88,903,098 bp
  • G to A, chromosome 3 at 89,769,365 bp
  • G to A, chromosome 3 at 95,901,248 bp
  • A to G, chromosome 3 at 129,894,940 bp
  • G to A, chromosome 3 at 132,914,397 bp
  • G to A, chromosome 3 at 142,810,701 bp
  • T to C, chromosome 3 at 151,762,819 bp
  • G to A, chromosome 4 at 98,431,780 bp
  • A to G, chromosome 4 at 106,360,421 bp
  • A to C, chromosome 4 at 108,718,501 bp
  • A to G, chromosome 4 at 139,644,161 bp
  • T to A, chromosome 4 at 152,118,304 bp
  • T to A, chromosome 5 at 23,809,843 bp
  • T to G, chromosome 5 at 53,829,372 bp
  • A to G, chromosome 5 at 72,957,614 bp
  • T to C, chromosome 5 at 73,408,218 bp
  • A to G, chromosome 5 at 120,769,027 bp
  • C to A, chromosome 5 at 137,415,018 bp
  • T to C, chromosome 5 at 143,714,626 bp
  • T to A, chromosome 6 at 42,299,514 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 55,968,541 bp
  • C to T, chromosome 6 at 86,413,915 bp
  • A to T, chromosome 6 at 92,190,019 bp
  • A to G, chromosome 7 at 47,464,879 bp
  • C to T, chromosome 7 at 67,149,956 bp
  • T to C, chromosome 7 at 85,857,878 bp
  • T to C, chromosome 7 at 121,125,439 bp
  • T to C, chromosome 7 at 139,998,055 bp
  • T to A, chromosome 8 at 31,201,390 bp
  • T to C, chromosome 8 at 43,625,583 bp
  • A to G, chromosome 8 at 60,526,712 bp
  • T to C, chromosome 8 at 63,348,977 bp
  • A to G, chromosome 8 at 83,423,030 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • A to C, chromosome 9 at 15,996,315 bp
  • A to T, chromosome 9 at 20,170,913 bp
  • C to T, chromosome 9 at 31,414,636 bp
  • G to A, chromosome 9 at 42,391,922 bp
  • A to G, chromosome 9 at 44,104,587 bp
  • G to T, chromosome 9 at 56,898,537 bp
  • A to G, chromosome 9 at 73,665,672 bp
  • G to A, chromosome 9 at 95,897,581 bp
  • A to T, chromosome 9 at 107,564,631 bp
  • T to C, chromosome 9 at 110,098,751 bp
  • T to C, chromosome 10 at 14,439,782 bp
  • C to T, chromosome 10 at 61,475,727 bp
  • T to A, chromosome 10 at 83,508,082 bp
  • T to A, chromosome 10 at 93,224,933 bp
  • CGGG to CGGGGGG, chromosome 11 at 5,201,791 bp
  • G to A, chromosome 11 at 53,866,351 bp
  • A to T, chromosome 11 at 59,185,312 bp
  • G to A, chromosome 11 at 66,085,020 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to C, chromosome 11 at 98,249,970 bp
  • A to T, chromosome 11 at 99,492,964 bp
  • A to G, chromosome 11 at 102,915,541 bp
  • A to G, chromosome 12 at 31,544,494 bp
  • A to G, chromosome 12 at 44,573,850 bp
  • T to C, chromosome 12 at 112,176,785 bp
  • T to A, chromosome 12 at 117,916,931 bp
  • T to C, chromosome 13 at 4,274,340 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • G to A, chromosome 14 at 20,665,819 bp
  • A to T, chromosome 14 at 27,479,633 bp
  • A to T, chromosome 14 at 32,446,795 bp
  • A to T, chromosome 14 at 33,096,005 bp
  • A to G, chromosome 14 at 63,035,924 bp
  • T to C, chromosome 14 at 105,298,135 bp
  • G to A, chromosome 15 at 37,439,600 bp
  • A to G, chromosome 15 at 44,197,153 bp
  • C to A, chromosome 15 at 76,177,692 bp
  • A to G, chromosome 15 at 98,865,132 bp
  • T to A, chromosome 16 at 20,539,338 bp
  • A to G, chromosome 16 at 28,828,421 bp
  • T to C, chromosome 16 at 44,496,419 bp
  • T to C, chromosome 16 at 64,769,022 bp
  • T to A, chromosome 16 at 85,877,915 bp
  • A to G, chromosome 17 at 24,512,379 bp
  • G to T, chromosome 17 at 26,923,315 bp
  • G to T, chromosome 17 at 31,620,949 bp
  • G to T, chromosome 17 at 65,984,076 bp
  • A to T, chromosome 17 at 78,937,629 bp
  • T to A, chromosome 18 at 10,515,190 bp
  • T to A, chromosome 18 at 12,068,312 bp
  • T to C, chromosome 18 at 57,240,792 bp
  • T to C, chromosome 19 at 12,846,930 bp
  • A to C, chromosome 19 at 56,809,220 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1729 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039761-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.