Strain Name:
Stock Number:
Citation ID:
Other Names:
R1743 (G1), C57BL/6J-MtgxR1743Btlr
Major Collection:

Strain Information

Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms: alpha-2,8-sialyltransferase, ST8Sia I, GD3S, GD3 synthase, Siat8, Siat8a, 9330109E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20449
Homologene: 2282
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 109676
Name: chromobox 7
Synonyms: 1600014J01Rik, D15Ertd417e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 52609
Homologene: 65296
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226744
Homologene: 17139
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71770
Homologene: 137384
Name: WD repeat and FYVE domain containing 3
Synonyms: 2610509D04Rik, Ggtb3, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72145
Homologene: 22855
Name: leucine rich repeat and sterile alpha motif containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227738
Homologene: 44526
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: 220kDa, Rpo2-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20020
Homologene: 721
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192786
Homologene: 22968
Name: BCL2-like 13 (apoptosis facilitator)
Synonyms: BCL-RAMBO, Mil1, E430016C20Rik, Mil-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 94044
Homologene: 9111
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12211
Homologene: 7248
Name: zinc finger CCCH type containing 14
Synonyms: 1700016A15Rik, 1010001P15Rik, 2700069A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75553
VEGA: 12
Homologene: 32605
Name: nodal modulator 1
Synonyms: PM5, Nomo, D7Ertd156e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 211548
Homologene: 13810
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57752
Homologene: 5087
Name: fibronectin type III domain containing 3A
Synonyms: 1700094E19Rik, F730017H24Rik, D14Ertd453e, Fndc3, sys
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319448
Homologene: 8952
Name: Rho GTPase activating protein 32
Synonyms: p200RhoGAP, GC-GAP, PX-RICS, 3426406O18Rik, Grit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330914
Homologene: 8812
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: Bub1a, D2Xrf87
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12235
Homologene: 37910
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108000
Homologene: 22969
Name: opioid receptor, mu 1
Synonyms: MOR-1, muOR, mor, Oprm, MOP-R, MOP receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18390
Homologene: 37368
Name: AF4/FMR2 family, member 4
Synonyms: Alf4, Laf4l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 93736
Homologene: 8683
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27054
Homologene: 74571
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, 2810036I15Rik, Syt3-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Name: coiled-coil domain containing 15
Synonyms: A630039F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245902
Homologene: 28448
Name: TATA-box binding protein associated factor, RNA polymerase I, B
Synonyms: mTAFI68, 4930408G01Rik, A230108M10Rik, p63
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 21340
VEGA: 12
Homologene: 31331
Name: minichromosome maintenance complex component 3 associated protein
Synonyms: GANP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 54387
VEGA: 10
Homologene: 2902
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Name: thymoma viral proto-oncogene 2
Synonyms: PKBbeta, PKB, 2410016A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11652
Homologene: 48773
Name: peptidylprolyl isomerase (cyclophilin)-like 4
Synonyms: PPIase, 3732410E19Rik, 3830425H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67418
Homologene: 12126
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17967
Homologene: 40754
Name: Fas (TNFRSF6) binding factor 1
Synonyms: 1110033G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217335
Homologene: 16531
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13417
VEGA: 17
Homologene: 1049
Name: exostosin glycosyltransferase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14043
Homologene: 345
Name: nipsnap homolog 2
Synonyms: Nipsnap2, Gbas
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14467
Homologene: 1137
Name: epsin 2
Synonyms: Ibp2, 9530051D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13855
Homologene: 40710
Name: cullin 2
Synonyms: 1300003D18Rik, 4932411N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 71745
Homologene: 2662
Name: TSC22 domain family, member 2
Synonyms: 1810043J12Rik, 5530402M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72033
Homologene: 8860
Name: translocase of inner mitochondrial membrane 21
Synonyms: 2700002I20Rik, 1700034H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67105
VEGA: 18
Homologene: 32211
Name: RAN binding protein 10
Synonyms: 4432417N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74334
Homologene: 49639
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237860
Homologene: 14116
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319675
Homologene: 27936
Name: nucleus accumbens associated 2, BEN and BTB (POZ) domain containing
Synonyms: 0610020I02Rik, C030048H19Rik, Btbd14a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67991
Homologene: 75239
Name: growth hormone receptor
Synonyms: GHBP, GHR/BP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 14600
Homologene: 134
Name: nitric oxide synthase 3, endothelial cell
Synonyms: eNOS, ecNOS, Nos-3, 2310065A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18127
Homologene: 504
Name: klotho beta
Synonyms: betaKlotho
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 83379
Homologene: 12820
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Name: dynein axonemal intermediate chain 3
Synonyms: 4931433A13Rik, IC140, Ida7, Wdr63
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242253
Homologene: 44922
Name: hephaestin-like 1
Synonyms: LOC244698, Zp, zyklopen, thd, cw
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244698
Homologene: 9112
Name: lysyl oxidase-like 2
Synonyms: 1110004B06Rik, 9430067E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 94352
Homologene: 1742
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 195046
Homologene: 133820
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: WND, Wilson protein, Atp7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11979
Homologene: 20063
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239420
Homologene: 65982
Name: solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms: MCT2, 4921534N07Rik, D630004K10Rik, 9030411M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20503
Homologene: 20990
Name: solute carrier family 25, member 30
Synonyms: 4933433D23Rik, KMCP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67554
VEGA: 14
Homologene: 57046
Name: proline-serine-threonine phosphatase-interacting protein 1
Synonyms: def-2, CD2BP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19200
Homologene: 37867
Name: Ras and Rab interactor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217835
Homologene: 11748
Name: olfactory receptor family 10 subfamily N member 1
Synonyms: M30, MOR224-4, GA_x6K02T2PVTD-33310486-33311418, Olfr148
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258498
Homologene: 128136
Name: protocadherin beta 14
Synonyms: Pcdhb17, PcdhbN, 2210006M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93885
Homologene: 70876
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 78257
Homologene: 12692
Name: gamma-aminobutyric acid (GABA) B receptor, 2
Synonyms: Gababr2, LOC242425, Gpr51, GB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242425
Homologene: 55902
Name: testis-specific serine kinase 4
Synonyms: 1700020B19Rik, 4933424F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71099
VEGA: 14
Homologene: 57078
Name: hepatic nuclear factor 4, alpha
Synonyms: HNF-4, Nr2a1, Nuclear receptor 2A1, HNF4 alpha, Tcf14, MODY1, Tcf4, Hnf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15378
Homologene: 395
Name: glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Synonyms: GatA, 2700038P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76563
Homologene: 6699
Name: SH3 domain and tetratricopeptide repeats 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231147
Homologene: 10360
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, 4930544G21Rik, SKIP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77629
Homologene: 18172
Name: zinc finger protein 821
Synonyms: 4930566A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 75871
Homologene: 32345
Name: cyclin M1
Synonyms: Acdp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 83674
VEGA: 19
Homologene: 10673
Name: predicted gene 7275
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 639644
VEGA: 16
Name: cytochrome c oxidase assembly factor 8
Synonyms: 1700081D05Rik, Apop-1, 2810002N01Rik, Apopt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68020
Homologene: 12225
Name: protein kinase D1
Synonyms: Pkcm, PKD1, Prkcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
Homologene: 55680
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
Synonyms: Mail
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 80859
Homologene: 12734
Name: replication initiator 1
Synonyms: AP4, E430037F08Rik, Zfp464
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 58887
Homologene: 22810
Name: olfactory receptor family 10 subfamily AK member 16
Synonyms: GA_x6K02T2QD9B-18644371-18643424, MOR259-8, Olfr1330
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258331
Homologene: 121524
Name: predicted gene 6871
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 102642386
Name: GLI pathogenesis-related 1 like 2
Synonyms: 4921508O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67537
Homologene: 17579
Name: syndecan 2
Synonyms: fibroglycan, Synd2, Hspg1, 4833414L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 15529
Homologene: 2253
Name: potassium voltage-gated channel, Isk-related subfamily, gene 3
Synonyms: MiRP2, 2210017H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57442
Homologene: 3994
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546165
Name: coenzyme Q8A
Synonyms: 4632432J16Rik, Cabc1, Adck3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67426
Homologene: 11345
Name: ribonuclease T2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68195
VEGA: 17
Homologene: 31190
Name: olfactory receptor family 2 subfamily B member 2
Synonyms: GA_x6K02T2QHY8-11534186-11533245, MOR256-35, MOR256-60, Olfr1359
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 258067
Homologene: 11056
Name: 3-oxoacid CoA transferase 2A
Synonyms: Scot-t1, Oxct2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64059
Homologene: 137359
Name: transmembrane protein 165
Synonyms: pFT27, Tpardl, Tparl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21982
Homologene: 5411
Name: vomeronasal 2, receptor 42
Synonyms: V2r4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22310
Homologene: 113703
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 53,427,814 bp
  • G to A, chromosome 1 at 83,277,515 bp
  • C to T, chromosome 1 at 179,610,392 bp
  • T to C, chromosome 1 at 180,182,229 bp
  • T to C, chromosome 1 at 189,654,263 bp
  • T to C, chromosome 2 at 26,060,143 bp
  • A to G, chromosome 2 at 32,941,883 bp
  • T to C, chromosome 2 at 93,730,225 bp
  • T to C, chromosome 2 at 127,813,850 bp
  • T to C, chromosome 2 at 144,587,489 bp
  • C to A, chromosome 2 at 163,566,339 bp
  • TCAGTTAACACCTATGAACAGT to TCAGT, chromosome 3 at 58,417,539 bp
  • T to C, chromosome 3 at 126,928,675 bp
  • C to A, chromosome 3 at 146,097,262 bp
  • A to G, chromosome 4 at 46,677,603 bp
  • A to G, chromosome 4 at 118,893,526 bp
  • A to T, chromosome 4 at 123,323,516 bp
  • T to C, chromosome 4 at 144,333,005 bp
  • G to A, chromosome 5 at 24,377,312 bp
  • A to G, chromosome 5 at 35,714,057 bp
  • C to A, chromosome 5 at 65,375,861 bp
  • G to T, chromosome 5 at 76,207,826 bp
  • G to T, chromosome 5 at 101,844,065 bp
  • T to C, chromosome 5 at 129,757,085 bp
  • T to A, chromosome 6 at 48,597,750 bp
  • T to A, chromosome 6 at 120,848,543 bp
  • A to T, chromosome 6 at 142,829,016 bp
  • A to T, chromosome 7 at 8,184,265 bp
  • A to G, chromosome 7 at 27,637,208 bp
  • G to T, chromosome 7 at 41,546,452 bp
  • G to A, chromosome 7 at 46,070,037 bp
  • C to T, chromosome 7 at 100,184,424 bp
  • C to A, chromosome 7 at 130,626,598 bp
  • A to T, chromosome 8 at 22,006,387 bp
  • G to T, chromosome 8 at 105,779,978 bp
  • G to A, chromosome 8 at 109,724,164 bp
  • C to T, chromosome 9 at 15,090,068 bp
  • C to T, chromosome 9 at 15,340,883 bp
  • A to G, chromosome 9 at 32,259,431 bp
  • A to T, chromosome 9 at 37,277,477 bp
  • A to T, chromosome 9 at 39,613,620 bp
  • G to T, chromosome 9 at 49,557,145 bp
  • T to C, chromosome 9 at 56,125,930 bp
  • A to G, chromosome 10 at 6,830,105 bp
  • A to T, chromosome 10 at 7,807,381 bp
  • A to T, chromosome 10 at 43,881,515 bp
  • C to T, chromosome 10 at 76,484,674 bp
  • G to T, chromosome 10 at 112,092,565 bp
  • A to G, chromosome 10 at 125,294,581 bp
  • T to A, chromosome 11 at 53,368,695 bp
  • A to G, chromosome 11 at 54,676,284 bp
  • T to A, chromosome 11 at 61,546,411 bp
  • A to G, chromosome 11 at 69,739,503 bp
  • A to T, chromosome 11 at 71,124,206 bp
  • T to A, chromosome 11 at 77,437,756 bp
  • T to C, chromosome 11 at 83,335,617 bp
  • A to G, chromosome 11 at 116,154,067 bp
  • A to G, chromosome 12 at 24,547,178 bp
  • G to A, chromosome 12 at 50,394,685 bp
  • A to T, chromosome 12 at 72,456,117 bp
  • T to C, chromosome 12 at 98,779,189 bp
  • T to A, chromosome 12 at 102,390,096 bp
  • T to C, chromosome 12 at 111,722,823 bp
  • A to G, chromosome 13 at 21,703,450 bp
  • A to G, chromosome 13 at 93,097,317 bp
  • C to A, chromosome 14 at 55,651,031 bp
  • T to A, chromosome 14 at 69,692,402 bp
  • A to T, chromosome 14 at 72,652,081 bp
  • C to A, chromosome 14 at 75,775,083 bp
  • G to A, chromosome 15 at 3,320,241 bp
  • A to G, chromosome 15 at 33,028,078 bp
  • A to T, chromosome 15 at 39,679,650 bp
  • A to G, chromosome 15 at 48,622,089 bp
  • G to A, chromosome 15 at 79,921,447 bp
  • A to G, chromosome 16 at 48,073,757 bp
  • G to T, chromosome 16 at 55,816,394 bp
  • G to T, chromosome 17 at 6,988,801 bp
  • G to T, chromosome 17 at 30,769,651 bp
  • A to G, chromosome 17 at 74,579,756 bp
  • A to T, chromosome 18 at 3,426,851 bp
  • T to G, chromosome 18 at 37,448,178 bp
  • G to C, chromosome 18 at 84,949,262 bp
  • A to T, chromosome 19 at 43,471,913 bp
  • A to G, chromosome Y at 1,316,727 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1743 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039775-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.