Strain Name:
C57BL/6J-MtgxR1762Btlr/Mmmh
Stock Number:
039794-MU
Citation ID:
RRID:MMRRC_039794-MU
Other Names:
R1762 (G1), C57BL/6J-MtgxR1762Btlr
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: Rxrip13, A230020K14Rik, N-CoR, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Cd74
Name: CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
Synonyms: Ii, CLIP
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16149
VEGA: 18
HGNC: HGNC:1697
Homologene: 3209
Septin4
Name: septin 4
Synonyms: Gm11492, septin H5, Sept4, ARTS, Bh5, Pnutl2, cell division control-related protein 2b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Nrg1
Name: neuregulin 1
Synonyms: GGF, NDF, GGFII, HRG, 6030402G23Rik, SMDF, ARIA, HRGalpha, heregulin, HGL, Hgl, D230005F13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Itk
Name: IL2 inducible T cell kinase
Synonyms: Tcsk, Tsk, Emt
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Jarid2
Name: jumonji and AT-rich interaction domain containing 2
Synonyms: jumonji, Jmj
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Dlc1
Name: deleted in liver cancer 1
Synonyms: Arhgap7, STARD12, p122-RhoGAP, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Kdm5b
Name: lysine demethylase 5B
Synonyms: D1Ertd202e, 2210016I17Rik, 2010009J12Rik, Plu1, Jarid1b, PLU-1, Rb-Bp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: slip, DNAPDcs, DNA-PK, dxnph, DNA-PKcs, XRCC7, DOXNPH
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP2, IMP-2, C330012H03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Cdk18
Name: cyclin dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18557
HGNC: HGNC:8751
Homologene: 1949
Comp
Name: cartilage oligomeric matrix protein
Synonyms: TSP5, thrombospondin-5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12845
HGNC: HGNC:2227
Homologene: 74
Nr5a2
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: LRH-1, UF2-H3B, D1Ertd308e, Ftf
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26424
HGNC: HGNC:7984
Homologene: 20827
Cxcr4
Name: C-X-C motif chemokine receptor 4
Synonyms: CD184, b2b220Clo, Sdf1r, Cmkar4, PB-CKR, fusin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12767
HGNC: HGNC:2561
Homologene: 20739
Dbi
Name: diazepam binding inhibitor
Synonyms: endozepine, Acbp, EP, diazepam-binding inhibitor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13167
HGNC: HGNC:2690
Homologene: 39086
Gdf3
Name: growth differentiation factor 3
Synonyms: Vgr2, Vgr-2, ecat9, Gdf-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14562
HGNC: HGNC:4218
Homologene: 7336
Micu1
Name: mitochondrial calcium uptake 1
Synonyms: Cbara1, C730016L05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216001
HGNC: HGNC:1530
Homologene: 4431
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: Gcn1l1, GCN1L, G431004K08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Gpbp1
Name: GC-rich promoter binding protein 1
Synonyms: D230035M11Rik, 1700034P14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73274
Homologene: 11292
Pcnt
Name: pericentrin (kendrin)
Synonyms: m239Asp, m275Asp, Pcnt2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Ccdc93
Name: coiled-coil domain containing 93
Synonyms: 4633402D15Rik, 9230102M16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70829
Homologene: 10393
Zc3h11a
Name: zinc finger CCCH type containing 11A
Synonyms: 1110003F06Rik, 5730454B08Rik, G630041M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70579
Homologene: 8888
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Calmbp1, Sha1, D330028K02Rik, Aspm, MCPH5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 4930541M15Rik, 1600013L13Rik, Camsap1l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67886
Homologene: 18927
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Rasal2
Name: RAS protein activator like 2
Synonyms: A330066M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226525
HGNC: HGNC:9874
Homologene: 35217
Ddx18
Name: DEAD box helicase 18
Synonyms: 2310005B10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66942
HGNC: HGNC:2741
Homologene: 6697
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: ZTL1, Znt5, ZnT-5, Zntl1, 1810010K08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226432
Homologene: 5874
Mlh1
Name: mutL homolog 1
Synonyms: colon cancer, nonpolyposis type 2, 1110035C23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17350
HGNC: HGNC:7127
Homologene: 208
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: GPI-DAF, Daf-GPI, Cromer blood group, Daf1, complement-glycosylphosphatidylinositol
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: Gpr1g, mGlu7a receptor, E130018M02Rik, mGluR7, 6330570A01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Ptprc
Name: protein tyrosine phosphatase receptor type C
Synonyms: Lyt-4, Ly-5, T200, CD45, B220
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Bcan
Name: brevican
Synonyms: Cspg7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12032
Homologene: 7244
Dennd1b
Name: DENN domain containing 1B
Synonyms: F730008N07Rik, 4632404N19Rik, 6820401H01Rik, 4930467M19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329260
Homologene: 11739
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: mNudel, 2600006O07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83431
Homologene: 32567
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Pah
Name: phenylalanine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18478
HGNC: HGNC:8582
Homologene: 234
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20980
Homologene: 22516
Lrrtm1
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74342
Homologene: 41763
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329252
Homologene: 49680
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Acf1, Wcrf180
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Casp8ap2
Name: caspase 8 associated protein 2
Synonyms: D4Ertd659e, FLASH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26885
HGNC: HGNC:1510
Homologene: 8066
Cars1
Name: cysteinyl-tRNA synthetase 1
Synonyms: CA3, Cars
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Cntrl
Name: centriolin
Synonyms: Cep110, 6720467O09Rik, IB3/5, Ma2a8, Cep1, b2b1468Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Chd1l
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: Snf2p, 4432404A22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68058
HGNC: HGNC:1916
Homologene: 11590
Cyb5r1
Name: cytochrome b5 reductase 1
Synonyms: 1500005G05Rik, Nqo3a2, B5R.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72017
Homologene: 96059
Fam72a
Name: family with sequence similarity 72, member A
Synonyms: P17, 2700049P18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108900
Homologene: 82352
Eme2
Name: essential meiotic structure-specific endonuclease subunit 2
Synonyms: 2810013J18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193838
Homologene: 19180
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67313
Homologene: 10103
Noc3l
Name: NOC3 like DNA replication regulator
Synonyms: Fad24
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 57753
VEGA: 19
Homologene: 39642
Nav1
Name: neuron navigator 1
Synonyms: C230080M11Rik, POMFIL3, 9930003A20Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: DPRP2, 6430584G11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276919
Homologene: 69193
Wnt5a
Name: wingless-type MMTV integration site family, member 5A
Synonyms: Wnt-5a, 8030457G12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22418
Homologene: 20720
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67196
Homologene: 40929
Cd82
Name: CD82 antigen
Synonyms: Tspan27, C33, Kai1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12521
HGNC: HGNC:6210
Homologene: 20512
Steap3
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68428
Homologene: 10084
Dsg3
Name: desmoglein 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13512
VEGA: 18
HGNC: HGNC:3050
Homologene: 55513
Tnni1
Name: troponin I, skeletal, slow 1
Synonyms: 2700018B22Rik, ssTnI
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21952
Homologene: 2462
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: Gpr115, 4632435A09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78249
Homologene: 51953
Ttn
Name: titin
Synonyms: connectin, 1100001C23Rik, D330041I19Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, 2310057K23Rik, shru, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: 7530426H14Rik, A930008G09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Elf3
Name: E74-like factor 3
Synonyms: ESE-1, jen, ESX
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Rnpep
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215615
Homologene: 10628
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
G6pc2
Name: glucose-6-phosphatase, catalytic, 2
Synonyms: G6pc-rs, islet specific glucose-6-phosphatase, IGRP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14378
Homologene: 41423
Mbd3l1
Name: methyl-CpG binding domain protein 3-like 1
Synonyms: 1700095H13Rik, Mbd3l, 1700070G05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73503
VEGA: 9
Homologene: 12502
Tbx15
Name: T-box 15
Synonyms: Tbx14, Tbx8, de
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21384
Homologene: 7967
Mapkapk2
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17164
HGNC: HGNC:6887
Homologene: 56412
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668940
Homologene: 66117
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mgr1, Gpr98, Mass1, VLGR1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Sctr
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319229
Homologene: 68290
Xylt1
Name: xylosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233781
Homologene: 32534
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Cdh7
Name: cadherin 7, type 2
Synonyms: 9330156F07Rik, CDH7L1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: sj, Cav1.1, fmd, muscle dysgenesis, DHPR alpha1s, Cchl1a3, mdg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Zc3h12c
Name: zinc finger CCCH type containing 12C
Synonyms: C230027N18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244871
VEGA: 9
Homologene: 35462
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: Liprin-alpha4, LOC100042382, Gm3812, 1110008G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Mybph
Name: myosin binding protein H
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53311
HGNC: HGNC:7552
Homologene: 3661
Ctse
Name: cathepsin E
Synonyms: CatE, C920004C08Rik, A430072O03Rik, CE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13034
HGNC: HGNC:2530
Homologene: 37551
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Ache
Name: acetylcholinesterase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11423
HGNC: HGNC:108
Homologene: 543
AC165146.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Chi3l1
Name: chitinase 3 like 1
Synonyms: Gp39, Brp39, Chil1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12654
HGNC: HGNC:1932
Homologene: 55569
Or10w1
Name: olfactory receptor family 10 subfamily W member 1
Synonyms: MOR266-6P, Olfr1490, GA_x6K02T2RE5P-3987000-3987950
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258098
Homologene: 79418
Cdh4
Name: cadherin 4
Synonyms: R-cadherin, R-Cadh, Rcad
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12561
HGNC: HGNC:1763
Homologene: 48044
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76422
Zbtb4
Name: zinc finger and BTB domain containing 4
Synonyms: 9230111I22Rik, 2310026P19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75580
Homologene: 10846
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240753
Homologene: 135779
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Kif14
Name: kinesin family member 14
Synonyms: D1Ertd367e, N-3 kinesin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Ccdc7b
Name: coiled-coil domain containing 7B
Synonyms: 1700008F21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75453
Homologene: 49919
Gpr39
Name: G protein-coupled receptor 39
Synonyms: 4933415E13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71111
HGNC: HGNC:4496
Homologene: 20380
Rab7b
Name: RAB7B, member RAS oncogene family
Synonyms: 5430435G22Rik, Rab7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226421
Homologene: 64833
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: B230104L07Rik, GluRdelta2, tpr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: C430014H23Rik, A930019K20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Myrfl
Name: myelin regulatory factor-like
Synonyms: LOC237558, Gm239
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237558
VEGA: 10
Homologene: 88588
Pcdhb9
Name: protocadherin beta 9
Synonyms: PcdhbI, Pcdhb4C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93880
HGNC: HGNC:8689
Homologene: 87124
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Mefv
Name: Mediterranean fever
Synonyms: FMF, TRIM20, pyrin, marenostrin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 54483
VEGA: 16
HGNC: HGNC:6998
Homologene: 32441
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: D130067I03Rik, 1700074E13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210417
Homologene: 18180
Has2
Name: hyaluronan synthase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15117
HGNC: HGNC:4819
Homologene: 3892
Kif21b
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16565
Homologene: 56868
Tbc1d4
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210789
Homologene: 45451
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: DS-epi2, 9330132E09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319901
Homologene: 12964
Ddx59
Name: DEAD box helicase 59
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 59, 1210002B07Rik, 4833411G06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67997
Homologene: 12222
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Myorg
Name: myogenesis regulating glycosidase (putative)
Synonyms: NET37, AI464131
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329828
Homologene: 19853
Mx2
Name: MX dynamin-like GTPase 2
Synonyms: Mx-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17858
Cfh
Name: complement component factor h
Synonyms: Mud-1, Sas1, Sas-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Ren1
Name: renin 1 structural
Synonyms: Ren1d, Ren1c, Ren-A, Rn-1, Ren-1, Rnr, Ren
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98733
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: Spi8, ovalbumin, NK10, CAP-2, CAP2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Cfhr3
Name: complement factor H-related 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 624286
Homologene: 138664
Capn9
Name: calpain 9
Synonyms: nCL-4, GC36
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 636808
Homologene: 43974
AA986860
Name: expressed sequence AA986860
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212439
Homologene: 49741
Or52n3
Name: olfactory receptor family 52 subfamily N member 3
Synonyms: Olfr665, GA_x6K02T2PBJ9-7509539-7510489, MOR34-7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258810
Homologene: 110477
Or8d2b
Name: olfactory receptor family 8 subfamily D member 2D
Synonyms: GA_x6K02T2PVTD-32573036-32573962, Olfr926, MOR171-8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258811
VEGA: 9
HGNC: HGNC:8482
Homologene: 128215
Or4a68
Name: olfactory receptor family 4 subfamily A member 68
Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8, Olfr1240
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258804
Homologene: 121591
Zbed6
Name: zinc finger, BED type containing 6
Synonyms: Gm8466, MGR, similar to Zinc finger BED domain containing protein 4, Gm38394
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 667118
Homologene: 130066
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Trove2, A530054J02Rik, Ssa2, 1810007I17Rik, Ssa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20822
Homologene: 3383
Lax1
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240754
Homologene: 49504
Ikbke
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKKepsilon, IKK-i
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56489
Homologene: 23168
Nlrx1
Name: NLR family member X1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270151
VEGA: 9
Homologene: 11623
Zp3r
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22789
HGNC: HGNC:1325
Homologene: 7609
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: C330011J12Rik, PI3K-C2beta
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545366
Homologene: 134349
Ptpn7
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: C920001D21Rik, BPTP-4, LC-PTP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320139
HGNC: HGNC:9659
Homologene: 15411
Selenoi
Name: selenoprotein I
Synonyms: C79563, D5Wsu178e, 4933402G07Rik, Ept1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 28042
Homologene: 100935
Abca7
Name: ATP-binding cassette, sub-family A member 7
Synonyms: Abc51
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27403
HGNC: HGNC:37
Homologene: 22783
Lmod1
Name: leiomodin 1 (smooth muscle)
Synonyms: 1D, 64kD D1, SM-Lmod, 9530015K06Rik, D1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93689
HGNC: HGNC:6647
Homologene: 8118
Or4g17
Name: olfactory receptor family 4 subfamily G member 17
Synonyms: MOR245-13, Olfr1284, GA_x6K02T2Q125-72430580-72431515
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258379
Homologene: 74059
Semp2l2b
Name: SUMO/sentrin specific peptidase 2-like 2B
Synonyms: 4930444G20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114671
Homologene: 130042
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320718
Homologene: 14179
Or52e19
Name: olfactory receptor family 52 subfamily E member 19
Synonyms: Gm15117, ENSMUSG00000073953, Olfr596-ps1, Olfr596, GA_x6K02T2PBJ9-6019769-6019943
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041187
Homologene: 121535
Rgs18
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64214
Homologene: 11281
Naif1
Name: nuclear apoptosis inducing factor 1
Synonyms: 4933440H19Rik, 2310007O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71254
Homologene: 45669
Stx19
Name: syntaxin 19
Synonyms: A030009B12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68159
Homologene: 55777
Tnnt2
Name: troponin T2, cardiac
Synonyms: cTnT, cardiac TnT, Tnt
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21956
Homologene: 68050
Irx5
Name: Iroquois homeobox 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54352
Homologene: 38105
Chit1
Name: chitinase 1
Synonyms: 2300002L19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71884
HGNC: HGNC:1936
Homologene: 68318
Or5aq1b
Name: olfactory receptor family 5 subfamily AQ member 1B
Synonyms: Olfr1107, GA_x6K02T2Q125-48565383-48564445, MOR172-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258841
Homologene: 131138
Optc
Name: opticin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Cd55b
Name: CD55 molecule, decay accelerating factor for complement B
Synonyms: TM-DAF, complement-transmembrane, Daf-TM, Daf2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13137
HGNC: HGNC:2665
Homologene: 479
Gm10110
Name: predicted gene 10110
Type: Gene
Species: Mouse
Chromosome: 14
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12269
HGNC: HGNC:1325
Pdzk1
Name: PDZ domain containing 1
Synonyms: Nherf3, mPDZK1, 4921513F16Rik, 1700023D20Rik, 2610507N21Rik, D3Ertd537e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 59020
Homologene: 1964
Fcamr
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64435
Homologene: 12929
Etnk2
Name: ethanolamine kinase 2
Synonyms: 4933417N20Rik, Eki2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214253
Homologene: 10072
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: ovalbumin, PAI-2, Planh2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Fcmr
Name: Fc fragment of IgM receptor
Synonyms: Faim3, 1810037B05Rik, FcmuR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69169
Homologene: 48347
Gpr84
Name: G protein-coupled receptor 84
Synonyms: EX33
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 80910
VEGA: 15
HGNC: HGNC:4535
Homologene: 41370
Or12e13
Name: olfactory receptor family 12 subfamily E member 13
Synonyms: MOR264-7, Olfr1148, GA_x6K02T2Q125-49334566-49335510
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258220
Homologene: 79465
Or6aa1
Name: olfactory receptor family 6 subfamily AA member 1
Synonyms: GA_x6K02T2NHDJ-9712819-9713778, MOR104-2, Olfr303
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258612
Homologene: 105157
Lad1
Name: ladinin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16763
HGNC: HGNC:6472
Homologene: 4059
Gm4793
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215714
Rab29
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226422
HGNC: HGNC:9789
Homologene: 20842
Kiss1
Name: KiSS-1 metastasis-suppressor
Synonyms: kisspeptin, metastin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 280287
HGNC: HGNC:6341
Homologene: 1701
Ptprv
Name: protein tyrosine phosphatase receptor type V
Synonyms: OST-PTP, OST, mOST-PTP, Esp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Gpr25
Name: G protein-coupled receptor 25
Synonyms: LOC383563
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383563
HGNC: HGNC:4480
Homologene: 3872
Glrx2
Name: glutaredoxin 2
Synonyms: 1700010P22Rik, thioltransferase, Grx2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69367
Homologene: 41098
Gm10563
Name: predicted gene 10563
Type: Gene
Species: Mouse
Chromosome: 4
Or52r1b
Name: olfactory receptor family 52 subfamily R member 1B
Synonyms: Olfr582, GA_x6K02T2PBJ9-5752857-5753801, MOR30-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259055
Homologene: 73943
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,486,756 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to T, chromosome 1 at 120,063,246 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • C to T, chromosome 1 at 120,120,108 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • G to A, chromosome 1 at 125,872,549 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • T to A, chromosome 1 at 130,103,076 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • T to A, chromosome 1 at 130,388,655 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • G to A, chromosome 1 at 130,737,688 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • C to A, chromosome 1 at 131,766,012 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • C to A, chromosome 1 at 133,358,982 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to T, chromosome 1 at 133,377,046 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to A, chromosome 1 at 134,604,467 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to T, chromosome 1 at 136,070,627 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • T to C, chromosome 1 at 136,160,292 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • G to A, chromosome 1 at 136,260,710 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • T to C, chromosome 1 at 139,237,531 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,597,661 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • T to C, chromosome 1 at 140,136,788 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,739,740 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • T to C, chromosome 1 at 157,299,144 bp
  • T to C, chromosome 2 at 32,454,890 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • A to T, chromosome 2 at 69,220,842 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • A to T, chromosome 2 at 87,071,921 bp
  • G to T, chromosome 2 at 87,833,665 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • C to A, chromosome 2 at 93,437,429 bp
  • A to G, chromosome 2 at 111,379,573 bp
  • G to A, chromosome 2 at 155,630,858 bp
  • A to G, chromosome 2 at 179,797,480 bp
  • T to G, chromosome 3 at 87,993,625 bp
  • A to T, chromosome 3 at 96,851,573 bp
  • A to G, chromosome 3 at 97,588,299 bp
  • T to A, chromosome 3 at 99,351,944 bp
  • T to A, chromosome 4 at 32,649,165 bp
  • T to A, chromosome 4 at 41,498,553 bp
  • T to C, chromosome 4 at 113,236,481 bp
  • A to G, chromosome 4 at 113,742,252 bp
  • C to T, chromosome 4 at 155,635,880 bp
  • T to A, chromosome 5 at 30,263,127 bp
  • G to T, chromosome 5 at 115,587,968 bp
  • A to G, chromosome 5 at 137,290,575 bp
  • G to T, chromosome 6 at 64,533,654 bp
  • T to C, chromosome 6 at 77,244,697 bp
  • G to C, chromosome 6 at 111,358,295 bp
  • T to C, chromosome 6 at 122,606,407 bp
  • T to C, chromosome 7 at 86,395,145 bp
  • C to A, chromosome 7 at 103,042,042 bp
  • C to T, chromosome 7 at 103,310,221 bp
  • C to T, chromosome 7 at 104,881,240 bp
  • T to C, chromosome 7 at 110,312,758 bp
  • A to T, chromosome 7 at 117,637,761 bp
  • C to A, chromosome 7 at 143,592,474 bp
  • T to A, chromosome 8 at 31,822,323 bp
  • T to A, chromosome 8 at 36,937,585 bp
  • A to T, chromosome 8 at 70,379,742 bp
  • T to A, chromosome 8 at 92,359,644 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • A to G, chromosome 8 at 129,110,842 bp
  • T to G, chromosome 9 at 18,485,139 bp
  • A to G, chromosome 9 at 38,877,785 bp
  • A to T, chromosome 9 at 42,375,309 bp
  • T to C, chromosome 9 at 44,263,640 bp
  • A to T, chromosome 9 at 52,115,781 bp
  • A to T, chromosome 9 at 111,229,929 bp
  • A to T, chromosome 10 at 22,067,512 bp
  • T to A, chromosome 10 at 59,863,260 bp
  • T to A, chromosome 10 at 76,355,137 bp
  • T to C, chromosome 10 at 79,999,765 bp
  • C to T, chromosome 10 at 80,066,606 bp
  • A to G, chromosome 10 at 87,567,468 bp
  • A to C, chromosome 10 at 116,798,593 bp
  • T to C, chromosome 11 at 46,336,482 bp
  • T to C, chromosome 11 at 62,384,784 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • A to T, chromosome 11 at 69,778,917 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to C, chromosome 11 at 101,532,018 bp
  • G to A, chromosome 12 at 54,909,020 bp
  • C to T, chromosome 13 at 42,183,786 bp
  • T to C, chromosome 13 at 44,916,410 bp
  • T to A, chromosome 13 at 81,506,146 bp
  • T to C, chromosome 13 at 100,813,462 bp
  • A to T, chromosome 13 at 111,440,774 bp
  • T to C, chromosome 14 at 19,402,408 bp
  • T to C, chromosome 14 at 28,522,891 bp
  • A to G, chromosome 14 at 89,897,389 bp
  • T to C, chromosome 14 at 101,507,138 bp
  • T to C, chromosome 15 at 6,756,573 bp
  • T to C, chromosome 15 at 56,681,610 bp
  • T to A, chromosome 15 at 103,309,327 bp
  • A to T, chromosome 16 at 3,708,186 bp
  • T to A, chromosome 16 at 15,637,961 bp
  • A to T, chromosome 16 at 22,083,947 bp
  • A to T, chromosome 16 at 62,821,980 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • T to C, chromosome 17 at 24,893,393 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to G, chromosome 17 at 56,188,362 bp
  • A to G, chromosome 18 at 20,539,732 bp
  • A to G, chromosome 18 at 37,403,083 bp
  • T to C, chromosome 18 at 60,811,318 bp
  • G to A, chromosome 19 at 13,654,504 bp
  • A to G, chromosome 19 at 38,818,153 bp
  • A to T, chromosome 19 at 41,603,335 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1762 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039794-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.