Strain Name:
C57BL/6J-MtgxR1762Btlr/Mmmh
Stock Number:
039794-MU
Citation ID:
RRID:MMRRC_039794-MU
Other Names:
R1762 (G1), C57BL/6J-MtgxR1762Btlr
Major Collection:

Gene Information

Gene Symbol: Ncor1 [MGI:1349717] (Mus musculus (mouse))
Name: nuclear receptor co-repressor 1
Synonyms: Rxrip13, N-CoR, 5730405M06Rik, A230020K14Rik
Chromosome: 11
Alteration at locus: Chemically Induced
Gene Symbol: Sbf2 [MGI:1921831] (Mus musculus (mouse))
Name: SET binding factor 2
Synonyms: SBF2, Mtmr13, mMTMH1, B430219L04Rik, 4833411B01Rik
Chromosome: 7
Alteration at locus: Chemically Induced
Gene Symbol: Cd74 [MGI:96534] (Mus musculus (mouse))
Name: CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
Synonyms: CLIP, Ii
Chromosome: 18
Alteration at locus: Chemically Induced
Gene Symbol: Sept4 [MGI:1270156] (Mus musculus (mouse))
Name: septin 4
Synonyms: cell division control-related protein 2b, septin H5, ARTS, Bh5, Pnutl2
Chromosome: 11
Alteration at locus: Chemically Induced
Gene Symbol: Nrg1 [MGI:96083] (Mus musculus (mouse))
Name: neuregulin 1
Synonyms: D230005F13Rik, ARIA, GGF, HRGalpha, heregulin, 6030402G23Rik, Hgl, GGFII, SMDF, HGL, HRG, NDF
Chromosome: 8
Alteration at locus: Chemically Induced
Gene Symbol: Itk [MGI:96621] (Mus musculus (mouse))
Name: IL2 inducible T cell kinase
Synonyms: Tcsk, Emt, Tsk
Chromosome: 11
Alteration at locus: Chemically Induced
Gene Symbol: Slit1 [MGI:1315203] (Mus musculus (mouse))
Name: slit guidance ligand 1
Synonyms: Slil1
Chromosome: 19
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,486,756 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to T, chromosome 1 at 120,063,246 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • C to T, chromosome 1 at 120,120,108 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • G to A, chromosome 1 at 125,872,549 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • T to A, chromosome 1 at 130,103,076 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • T to A, chromosome 1 at 130,388,655 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • G to A, chromosome 1 at 130,737,688 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • C to A, chromosome 1 at 131,766,012 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • C to A, chromosome 1 at 133,358,982 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to T, chromosome 1 at 133,377,046 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to A, chromosome 1 at 134,604,467 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to T, chromosome 1 at 136,070,627 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • T to C, chromosome 1 at 136,160,292 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • G to A, chromosome 1 at 136,260,710 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • T to C, chromosome 1 at 139,237,531 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,597,661 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • T to C, chromosome 1 at 140,136,788 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,739,740 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • T to C, chromosome 1 at 157,299,144 bp
  • T to C, chromosome 2 at 32,454,890 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • A to T, chromosome 2 at 69,220,842 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • A to T, chromosome 2 at 87,071,921 bp
  • G to T, chromosome 2 at 87,833,665 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • C to A, chromosome 2 at 93,437,429 bp
  • A to G, chromosome 2 at 111,379,573 bp
  • G to A, chromosome 2 at 155,630,858 bp
  • A to G, chromosome 2 at 179,797,480 bp
  • T to G, chromosome 3 at 87,993,625 bp
  • A to T, chromosome 3 at 96,851,573 bp
  • A to G, chromosome 3 at 97,588,299 bp
  • T to A, chromosome 3 at 99,351,944 bp
  • T to A, chromosome 4 at 32,649,165 bp
  • T to A, chromosome 4 at 41,498,553 bp
  • T to C, chromosome 4 at 113,236,481 bp
  • A to G, chromosome 4 at 113,742,252 bp
  • C to T, chromosome 4 at 155,635,880 bp
  • T to A, chromosome 5 at 30,263,127 bp
  • G to T, chromosome 5 at 115,587,968 bp
  • A to G, chromosome 5 at 137,290,575 bp
  • G to T, chromosome 6 at 64,533,654 bp
  • T to C, chromosome 6 at 77,244,697 bp
  • G to C, chromosome 6 at 111,358,295 bp
  • T to C, chromosome 6 at 122,606,407 bp
  • T to C, chromosome 7 at 86,395,145 bp
  • C to A, chromosome 7 at 103,042,042 bp
  • C to T, chromosome 7 at 103,310,221 bp
  • C to T, chromosome 7 at 104,881,240 bp
  • T to C, chromosome 7 at 110,312,758 bp
  • A to T, chromosome 7 at 117,637,761 bp
  • C to A, chromosome 7 at 143,592,474 bp
  • T to A, chromosome 8 at 31,822,323 bp
  • T to A, chromosome 8 at 36,937,585 bp
  • A to T, chromosome 8 at 70,379,742 bp
  • T to A, chromosome 8 at 92,359,644 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • A to G, chromosome 8 at 129,110,842 bp
  • T to G, chromosome 9 at 18,485,139 bp
  • A to G, chromosome 9 at 38,877,785 bp
  • A to T, chromosome 9 at 42,375,309 bp
  • T to C, chromosome 9 at 44,263,640 bp
  • A to T, chromosome 9 at 52,115,781 bp
  • A to T, chromosome 9 at 111,229,929 bp
  • A to T, chromosome 10 at 22,067,512 bp
  • T to A, chromosome 10 at 59,863,260 bp
  • T to A, chromosome 10 at 76,355,137 bp
  • T to C, chromosome 10 at 79,999,765 bp
  • C to T, chromosome 10 at 80,066,606 bp
  • A to G, chromosome 10 at 87,567,468 bp
  • A to C, chromosome 10 at 116,798,593 bp
  • T to C, chromosome 11 at 46,336,482 bp
  • T to C, chromosome 11 at 62,384,784 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • A to T, chromosome 11 at 69,778,917 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to C, chromosome 11 at 101,532,018 bp
  • G to A, chromosome 12 at 54,909,020 bp
  • C to T, chromosome 13 at 42,183,786 bp
  • T to C, chromosome 13 at 44,916,410 bp
  • T to A, chromosome 13 at 81,506,146 bp
  • T to C, chromosome 13 at 100,813,462 bp
  • A to T, chromosome 13 at 111,440,774 bp
  • T to C, chromosome 14 at 19,402,408 bp
  • T to C, chromosome 14 at 28,522,891 bp
  • A to G, chromosome 14 at 89,897,389 bp
  • T to C, chromosome 14 at 101,507,138 bp
  • T to C, chromosome 15 at 6,756,573 bp
  • T to C, chromosome 15 at 56,681,610 bp
  • T to A, chromosome 15 at 103,309,327 bp
  • A to T, chromosome 16 at 3,708,186 bp
  • T to A, chromosome 16 at 15,637,961 bp
  • A to T, chromosome 16 at 22,083,947 bp
  • A to T, chromosome 16 at 62,821,980 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • T to C, chromosome 17 at 24,893,393 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to G, chromosome 17 at 56,188,362 bp
  • A to G, chromosome 18 at 20,539,732 bp
  • A to G, chromosome 18 at 37,403,083 bp
  • T to C, chromosome 18 at 60,811,318 bp
  • G to A, chromosome 19 at 13,654,504 bp
  • A to G, chromosome 19 at 38,818,153 bp
  • A to T, chromosome 19 at 41,603,335 bp
Genotype Determination
ES Cell Line
N/A
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
MeSH Terms
    Strain Development
    C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
    Suggested Control Mice
    Wild-type littermates or C57BL/6J mice
    Donor
    Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
    Primary Reference
    MUTAGENETIX record for R1762 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
    Coat Color
    Black
    MMRRC Breeding System
    Random intra-strain mating
    Breeding Scheme(s)
    When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
    Overall Breeding Performance
    Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
    Average litter size
    Undetermined
    Recommended wean age
    3 weeks

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
    039794-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

    Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

    1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.