MMRRC:039794-MU

Strain Name:

C57BL/6J-MtgxR1762Btlr/Mmmh

Stock Number:

039794-MU

Citation ID:

RRID:MMRRC_039794-MU

Other Names:

R1762 (G1), C57BL/6J-MtgxR1762Btlr

Major Collection:

Beutler Mutagenetix

Gene Information Expand All

Gene Details [Including genotyping protocols]

Gene Symbol: Ncor1 [MGI:1349717] (Mus musculus (mouse))

Name: nuclear receptor co-repressor 1

Synonyms: Rxrip13, N-CoR, 5730405M06Rik, A230020K14Rik

Chromosome: 11

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Sbf2 [MGI:1921831] (Mus musculus (mouse))

Name: SET binding factor 2

Synonyms: SBF2, Mtmr13, mMTMH1, B430219L04Rik, 4833411B01Rik

Chromosome: 7

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cd74 [MGI:96534] (Mus musculus (mouse))

Name: CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)

Synonyms: CLIP, Ii

Chromosome: 18

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Sept4 [MGI:1270156] (Mus musculus (mouse))

Name: septin 4

Synonyms: cell division control-related protein 2b, septin H5, ARTS, Bh5, Pnutl2

Chromosome: 11

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Nrg1 [MGI:96083] (Mus musculus (mouse))

Name: neuregulin 1

Synonyms: D230005F13Rik, ARIA, GGF, HRGalpha, heregulin, 6030402G23Rik, Hgl, GGFII, SMDF, HGL, HRG, NDF

Chromosome: 8

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Itk [MGI:96621] (Mus musculus (mouse))

Name: IL2 inducible T cell kinase

Synonyms: Tcsk, Emt, Tsk

Chromosome: 11

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Slit1 [MGI:1315203] (Mus musculus (mouse))

Name: slit guidance ligand 1

Synonyms: Slil1

Chromosome: 19

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

See All Alterations

Gene Symbol: Jarid2 [MGI:104813] (Mus musculus (mouse))

Name: jumonji, AT rich interactive domain 2

Synonyms: jumonji, Jmj

Chromosome: 13

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Dlc1 [MGI:1354949] (Mus musculus (mouse))

Name: deleted in liver cancer 1

Synonyms: STARD12, A730069N07Rik, Arhgap7, p122-RhoGAP

Chromosome: 8

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Kdm5b [MGI:1922855] (Mus musculus (mouse))

Name: lysine (K)-specific demethylase 5B

Synonyms: 2010009J12Rik, Plu1, Jarid1b, 2210016I17Rik, D1Ertd202e, Rb-Bp2, PLU-1

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Rictor [MGI:1926007] (Mus musculus (mouse))

Name: RPTOR independent companion of MTOR, complex 2

Synonyms: D530039E11Rik, 6030405M08Rik, 4921505C17Rik

Chromosome: 15

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gli2 [MGI:95728] (Mus musculus (mouse))

Name: GLI-Kruppel family member GLI2

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Prkdc [MGI:104779] (Mus musculus (mouse))

Name: protein kinase, DNA activated, catalytic polypeptide

Synonyms: DNA-PK, DNA-PKcs, dxnph, XRCC7, DOXNPH, slip, DNAPDcs

Chromosome: 16

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Igf2bp2 [MGI:1890358] (Mus musculus (mouse))

Name: insulin-like growth factor 2 mRNA binding protein 2

Synonyms: IMP-2, C330012H03Rik, IMP2

Chromosome: 16

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cdk18 [MGI:97518] (Mus musculus (mouse))

Name: cyclin-dependent kinase 18

Synonyms: Pctk3

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Comp [MGI:88469] (Mus musculus (mouse))

Name: cartilage oligomeric matrix protein

Synonyms: TSP5, thrombospondin-5

Chromosome: 8

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Nr5a2 [MGI:1346834] (Mus musculus (mouse))

Name: nuclear receptor subfamily 5, group A, member 2

Synonyms: D1Ertd308e, Ftf, UF2-H3B, LRH-1

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cxcr4 [MGI:109563] (Mus musculus (mouse))

Name: chemokine (C-X-C motif) receptor 4

Synonyms: Sdf1r, CD184, Cmkar4, PB-CKR, fusin, b2b220Clo

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Dbi [MGI:94865] (Mus musculus (mouse))

Name: diazepam binding inhibitor

Synonyms: EP, endozepine, Acbp, diazepam-binding inhibitor

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gdf3 [MGI:95686] (Mus musculus (mouse))

Name: growth differentiation factor 3

Synonyms: ecat9, Gdf-3, Vgr2, Vgr-2

Chromosome: 6

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Micu1 [MGI:2384909] (Mus musculus (mouse))

Name: mitochondrial calcium uptake 1

Synonyms: C730016L05Rik, Cbara1

Chromosome: 10

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gcn1 [MGI:2444248] (Mus musculus (mouse))

Name: GCN1 activator of EIF2AK4

Synonyms: GCN1L, Gcn1l1, G431004K08Rik

Chromosome: 5

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gpbp1 [MGI:1920524] (Mus musculus (mouse))

Name: GC-rich promoter binding protein 1

Synonyms: D230035M11Rik, 1700034P14Rik

Chromosome: 13

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Pcnt [MGI:102722] (Mus musculus (mouse))

Name: pericentrin (kendrin)

Synonyms: Pcnt2, m239Asp, m275Asp

Chromosome: 10

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Sbno2 [MGI:2448490] (Mus musculus (mouse))

Name: strawberry notch 2

Synonyms: Stno

Chromosome: 10

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ccdc93 [MGI:1918079] (Mus musculus (mouse))

Name: coiled-coil domain containing 93

Synonyms: 4633402D15Rik, 9230102M16Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Zc3h11a [MGI:1917829] (Mus musculus (mouse))

Name: zinc finger CCCH type containing 11A

Synonyms: 1110003F06Rik, G630041M05Rik, 5730454B08Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Aspm [MGI:1334448] (Mus musculus (mouse))

Name: abnormal spindle microtubule assembly

Synonyms: Calmbp1, Aspm, D330028K02Rik, Sha1, MCPH5

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Camsap2 [MGI:1922434] (Mus musculus (mouse))

Name: calmodulin regulated spectrin-associated protein family, member 2

Synonyms: 4930541M15Rik, 1600013L13Rik, Camsap1l1

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Brca1 [MGI:104537] (Mus musculus (mouse))

Name: breast cancer 1, early onset

Chromosome: 11

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Rasal2 [MGI:2443881] (Mus musculus (mouse))

Name: RAS protein activator like 2

Synonyms: A330066M24Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ddx18 [MGI:1914192] (Mus musculus (mouse))

Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 18

Synonyms: 2310005B10Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Slc30a5 [MGI:1916298] (Mus musculus (mouse))

Name: solute carrier family 30 (zinc transporter), member 5

Synonyms: Znt5, ZnT-5, Zntl1, 1810010K08Rik, ZTL1

Chromosome: 13

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ipo9 [MGI:1918944] (Mus musculus (mouse))

Name: importin 9

Synonyms: 0710008K06Rik, Imp9

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Mlh1 [MGI:101938] (Mus musculus (mouse))

Name: mutL homolog 1

Synonyms: 1110035C23Rik, colon cancer, nonpolyposis type 2

Chromosome: 9

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cd55 [MGI:104850] (Mus musculus (mouse))

Name: CD55 molecule, decay accelerating factor for complement

Synonyms: Cromer blood group, Daf-GPI, Daf1, GPI-DAF, complement-glycosylphosphatidylinositol

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Grm7 [MGI:1351344] (Mus musculus (mouse))

Name: glutamate receptor, metabotropic 7

Synonyms: Tg(SMN2)89Ahmb, 6330570A01Rik, SMN2, Gpr1g, mGlu7a receptor, E130018M02Rik, mGluR7

Chromosome: 6

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ptprc [MGI:97810] (Mus musculus (mouse))

Name: protein tyrosine phosphatase, receptor type, C

Synonyms: B220, Ly-5, T200, Lyt-4, CD45

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Bcan [MGI:1096385] (Mus musculus (mouse))

Name: brevican

Synonyms: Cspg7

Chromosome: 3

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Dennd1b [MGI:2447812] (Mus musculus (mouse))

Name: DENN/MADD domain containing 1B

Synonyms: 4930467M19Rik, 6820401H01Rik, F730008N07Rik, 4632404N19Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ndel1 [MGI:1932915] (Mus musculus (mouse))

Name: nudE neurodevelopment protein 1 like 1

Synonyms: 2600006O07Rik, mNudel

Chromosome: 11

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Pigr [MGI:103080] (Mus musculus (mouse))

Name: polymeric immunoglobulin receptor

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Pah [MGI:97473] (Mus musculus (mouse))

Name: phenylalanine hydroxylase

Chromosome: 10

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Syt2 [MGI:99666] (Mus musculus (mouse))

Name: synaptotagmin II

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Lrrtm1 [MGI:2389173] (Mus musculus (mouse))

Name: leucine rich repeat transmembrane neuronal 1

Synonyms: 4632401D06Rik

Chromosome: 6

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cdh19 [MGI:3588198] (Mus musculus (mouse))

Name: cadherin 19, type 2

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Lgr6 [MGI:2441805] (Mus musculus (mouse))

Name: leucine-rich repeat-containing G protein-coupled receptor 6

Synonyms: A530037C04Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Baz1a [MGI:1309478] (Mus musculus (mouse))

Name: bromodomain adjacent to zinc finger domain 1A

Synonyms: Gtl5, Acf1, Wcrf180

Chromosome: 12

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Casp8ap2 [MGI:1349399] (Mus musculus (mouse))

Name: caspase 8 associated protein 2

Synonyms: FLASH, D4Ertd659e

Chromosome: 4

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cars [MGI:1351477] (Mus musculus (mouse))

Name: cysteinyl-tRNA synthetase

Synonyms: CA3

Chromosome: 7

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cntrl [MGI:1889576] (Mus musculus (mouse))

Name: centriolin

Synonyms: b2b1468Clo, 6720467O09Rik, IB3/5, Ma2a8, Cep110, Cep1

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Chd1l [MGI:1915308] (Mus musculus (mouse))

Name: chromodomain helicase DNA binding protein 1-like

Synonyms: Snf2p, 4432404A22Rik

Chromosome: 3

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cyb5r1 [MGI:1919267] (Mus musculus (mouse))

Name: cytochrome b5 reductase 1

Synonyms: 1500005G05Rik, B5R.1, Nqo3a2

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Fam72a [MGI:1919669] (Mus musculus (mouse))

Name: family with sequence similarity 72, member A

Synonyms: P17, 2700049P18Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Eme2 [MGI:1919889] (Mus musculus (mouse))

Name: essential meiotic structure-specific endonuclease subunit 2

Synonyms: 2810013J18Rik

Chromosome: 17

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Inava [MGI:1921579] (Mus musculus (mouse))

Name: innate immunity activator

Synonyms: 5730559C18Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Noc3l [MGI:1932610] (Mus musculus (mouse))

Name: NOC3 like DNA replication regulator

Synonyms: Fad24

Chromosome: 19

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Nav1 [MGI:2183683] (Mus musculus (mouse))

Name: neuron navigator 1

Synonyms: C230080M11Rik, unc53H1, 9930003A20Rik, steerin-1, POMFIL3

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Dpp9 [MGI:2443967] (Mus musculus (mouse))

Name: dipeptidylpeptidase 9

Synonyms: 6430584G11Rik, DPRP2

Chromosome: 17

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gemin4 [MGI:2449313] (Mus musculus (mouse))

Name: gem nuclear organelle associated protein 4

Chromosome: 11

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Wnt5a [MGI:98958] (Mus musculus (mouse))

Name: wingless-type MMTV integration site family, member 5A

Synonyms: Wnt-5a, 8030457G12Rik

Chromosome: 14

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ppp1r12b [MGI:1916417] (Mus musculus (mouse))

Name: protein phosphatase 1, regulatory subunit 12B

Synonyms: 1810037O03Rik, 9530009M10Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ube2t [MGI:1914446] (Mus musculus (mouse))

Name: ubiquitin-conjugating enzyme E2T

Synonyms: 2700084L22Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cd82 [MGI:104651] (Mus musculus (mouse))

Name: CD82 antigen

Synonyms: Tspan27, Kai1, C33

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Steap3 [MGI:1915678] (Mus musculus (mouse))

Name: STEAP family member 3

Synonyms: pHyde, 1010001D01Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Dsg3 [MGI:99499] (Mus musculus (mouse))

Name: desmoglein 3

Chromosome: 18

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Tnni1 [MGI:105073] (Mus musculus (mouse))

Name: troponin I, skeletal, slow 1

Synonyms: ssTnI, 2700018B22Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Adgrf4 [MGI:1925499] (Mus musculus (mouse))

Name: adhesion G protein-coupled receptor F4

Synonyms: Gpr115, 4632435A09Rik

Chromosome: 17

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ttn [MGI:98864] (Mus musculus (mouse))

Name: titin

Synonyms: 1100001C23Rik, L56, connectin, mdm, shru, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Crb1 [MGI:2136343] (Mus musculus (mouse))

Name: crumbs family member 1, photoreceptor morphogenesis associated

Synonyms: A930008G09Rik, 7530426H14Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Elf3 [MGI:1101781] (Mus musculus (mouse))

Name: E74-like factor 3

Synonyms: ESX, ESE-1, jen

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Rnpep [MGI:2384902] (Mus musculus (mouse))

Name: arginyl aminopeptidase (aminopeptidase B)

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Tecta [MGI:109575] (Mus musculus (mouse))

Name: tectorin alpha

Synonyms: [a]-tectorin, Tctna

Chromosome: 9

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: G6pc2 [MGI:1277193] (Mus musculus (mouse))

Name: glucose-6-phosphatase, catalytic, 2

Synonyms: IGRP, G6pc-rs, islet specific glucose-6-phosphatase

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Mbd3l1 [MGI:1920753] (Mus musculus (mouse))

Name: methyl-CpG binding domain protein 3-like 1

Synonyms: Mbd3l, 1700095H13Rik, 1700070G05Rik

Chromosome: 9

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Tbx15 [MGI:1277234] (Mus musculus (mouse))

Name: T-box 15

Synonyms: Tbx8, Tbx14, de

Chromosome: 3

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Mapkapk2 [MGI:109298] (Mus musculus (mouse))

Name: MAP kinase-activated protein kinase 2

Synonyms: Rps6kc1, MAPKAP kinase 2, MK2

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Myh7b [MGI:3710243] (Mus musculus (mouse))

Name: myosin, heavy chain 7B, cardiac muscle, beta

Synonyms: Myh14

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Adgrv1 [MGI:1274784] (Mus musculus (mouse))

Name: adhesion G protein-coupled receptor V1

Synonyms: Gpr98, VLGR1, Mgr1, Mass1

Chromosome: 13

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Sctr [MGI:2441720] (Mus musculus (mouse))

Name: secretin receptor

Synonyms: 6530402O03Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Xylt1 [MGI:2451073] (Mus musculus (mouse))

Name: xylosyltransferase 1

Chromosome: 7

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Skint5 [MGI:3650151] (Mus musculus (mouse))

Name: selection and upkeep of intraepithelial T cells 5

Synonyms: OTTMUSG00000008560

Chromosome: 4

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cdh7 [MGI:2442792] (Mus musculus (mouse))

Name: cadherin 7, type 2

Synonyms: CDH7L1, 9330156F07Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cacna1s [MGI:88294] (Mus musculus (mouse))

Name: calcium channel, voltage-dependent, L type, alpha 1S subunit

Synonyms: fmd, muscle dysgenesis, mdg, DHPR alpha1s, Cchl1a3, sj, Cav1.1

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Zc3h12c [MGI:3026959] (Mus musculus (mouse))

Name: zinc finger CCCH type containing 12C

Synonyms: C230027N18Rik

Chromosome: 9

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ppfia4 [MGI:1915757] (Mus musculus (mouse))

Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4

Synonyms: Liprin-alpha4, LOC100042382, 1110008G13Rik, Gm3812

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Mybph [MGI:1858196] (Mus musculus (mouse))

Name: myosin binding protein H

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ctse [MGI:107361] (Mus musculus (mouse))

Name: cathepsin E

Synonyms: C920004C08Rik, CE, A430072O03Rik, CatE

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Skint6 [MGI:3649262] (Mus musculus (mouse))

Name: selection and upkeep of intraepithelial T cells 6

Synonyms: OTTMUSG00000008519

Chromosome: 4

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ache [MGI:87876] (Mus musculus (mouse))

Name: acetylcholinesterase

Chromosome: 5

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: AC165146.1 (Mus musculus (mouse))

Chromosome: 14

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Hivep1 [MGI:96100] (Mus musculus (mouse))

Name: human immunodeficiency virus type I enhancer binding protein 1

Synonyms: Cryabp1, alphaA-CRYBP1

Chromosome: 13

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Chil1 [MGI:1340899] (Mus musculus (mouse))

Name: chitinase-like 1

Synonyms: Chi3l1, Gp39, Brp39

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr1490 [MGI:3031324] (Mus musculus (mouse))

Name: olfactory receptor 1490

Synonyms: GA_x6K02T2RE5P-3987000-3987950, MOR266-6P

Chromosome: 19

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cdh4 [MGI:99218] (Mus musculus (mouse))

Name: cadherin 4

Synonyms: Rcad, R-cadherin, R-Cadh

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Mroh3 [MGI:1923672] (Mus musculus (mouse))

Name: maestro heat-like repeat family member 3

Synonyms: 2310006M14Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Zbtb4 [MGI:1922830] (Mus musculus (mouse))

Name: zinc finger and BTB domain containing 4

Synonyms: 9230111I22Rik, 2310026P19Rik

Chromosome: 11

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Plekha6 [MGI:2388662] (Mus musculus (mouse))

Name: pleckstrin homology domain containing, family A member 6

Synonyms: Pepp3

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Serpinb10 [MGI:2138648] (Mus musculus (mouse))

Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Kif14 [MGI:1098226] (Mus musculus (mouse))

Name: kinesin family member 14

Synonyms: D1Ertd367e, N-3 kinesin

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ccdc7b [MGI:1922703] (Mus musculus (mouse))

Name: coiled-coil domain containing 7B

Synonyms: 1700008F21Rik

Chromosome: 8

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gpr39 [MGI:1918361] (Mus musculus (mouse))

Name: G protein-coupled receptor 39

Synonyms: 4933415E13Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Rab7b [MGI:2442295] (Mus musculus (mouse))

Name: RAB7B, member RAS oncogene family

Synonyms: 5430435G22Rik, Rab7b

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Grid2 [MGI:95813] (Mus musculus (mouse))

Name: glutamate receptor, ionotropic, delta 2

Synonyms: B230104L07Rik, tpr, GluRdelta2

Chromosome: 6

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Dstyk [MGI:1925064] (Mus musculus (mouse))

Name: dual serine/threonine and tyrosine protein kinase

Synonyms: A930019K20Rik, C430014H23Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Myrfl [MGI:2685085] (Mus musculus (mouse))

Name: myelin regulatory factor-like

Synonyms: Gm239, LOC237558

Chromosome: 10

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Pcdhb9 [MGI:2136744] (Mus musculus (mouse))

Name: protocadherin beta 9

Synonyms: Pcdhb4C, PcdhbI

Chromosome: 18

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Igfn1 [MGI:3045352] (Mus musculus (mouse))

Name: immunoglobulin-like and fibronectin type III domain containing 1

Synonyms: 9830123M21Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Mefv [MGI:1859396] (Mus musculus (mouse))

Name: Mediterranean fever

Synonyms: pyrin, TRIM20, FMF, marenostrin

Chromosome: 16

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Thsd7b [MGI:2443925] (Mus musculus (mouse))

Name: thrombospondin, type I, domain containing 7B

Synonyms: 1700074E13Rik, D130067I03Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Has2 [MGI:107821] (Mus musculus (mouse))

Name: hyaluronan synthase 2

Chromosome: 15

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Kif21b [MGI:109234] (Mus musculus (mouse))

Name: kinesin family member 21B

Synonyms: N-5 kinesin, 2610511N21Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Tbc1d4 [MGI:2429660] (Mus musculus (mouse))

Name: TBC1 domain family, member 4

Synonyms: 5930406J04Rik, AS160

Chromosome: 14

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Dsel [MGI:2442948] (Mus musculus (mouse))

Name: dermatan sulfate epimerase-like

Synonyms: 9330132E09Rik, DS-epi2

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ddx59 [MGI:1915247] (Mus musculus (mouse))

Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 59

Synonyms: 4833411G06Rik, 1210002B07Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Kcnt2 [MGI:3036273] (Mus musculus (mouse))

Name: potassium channel, subfamily T, member 2

Synonyms: E330038N15Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Myorg [MGI:2140300] (Mus musculus (mouse))

Name: myogenesis regulating glycosidase (putative)

Synonyms: AI464131, NET37

Chromosome: 4

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Mx2 [MGI:97244] (Mus musculus (mouse))

Name: MX dynamin-like GTPase 2

Synonyms: Mx-2

Chromosome: 16

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cfh [MGI:88385] (Mus musculus (mouse))

Name: complement component factor h

Synonyms: Sas1, Sas-1, Mud-1

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ren1 [MGI:97898] (Mus musculus (mouse))

Name: renin 1 structural

Synonyms: Ren1c, Rn-1, Rnr, Ren-A, Ren1d, Ren-1, Ren

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Obsl1 [MGI:2138628] (Mus musculus (mouse))

Name: obscurin-like 1

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Serpinb8 [MGI:894657] (Mus musculus (mouse))

Name: serine (or cysteine) peptidase inhibitor, clade B, member 8

Synonyms: ovalbumin, CAP-2, NK10, CAP2, Spi8

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cfhr3 [MGI:3647418] (Mus musculus (mouse))

Name: complement factor H-related 3

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Capn9 [MGI:1920897] (Mus musculus (mouse))

Name: calpain 9

Synonyms: nCL-4, GC36

Chromosome: 8

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cntnap5a [MGI:3643623] (Mus musculus (mouse))

Name: contactin associated protein-like 5A

Synonyms: Caspr5-1

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: AA986860 [MGI:2138143] (Mus musculus (mouse))

Name: expressed sequence AA986860

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr665 [MGI:3030499] (Mus musculus (mouse))

Name: olfactory receptor 665

Synonyms: MOR34-7, GA_x6K02T2PBJ9-7509539-7510489

Chromosome: 7

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr926 [MGI:3030760] (Mus musculus (mouse))

Name: olfactory receptor 926

Synonyms: MOR171-8, GA_x6K02T2PVTD-32573036-32573962

Chromosome: 9

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr1240 [MGI:3031074] (Mus musculus (mouse))

Name: olfactory receptor 1240

Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Zbed6 [MGI:3828086] (Mus musculus (mouse))

Name: zinc finger, BED type containing 6

Synonyms: Gm8466, similar to Zinc finger BED domain containing protein 4, MGR

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ro60 [MGI:106652] (Mus musculus (mouse))

Name: Ro60, Y RNA binding protein

Synonyms: Ssa, Trove2, SS-A/Ro, Ssa2, 1810007I17Rik, A530054J02Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Lax1 [MGI:2443362] (Mus musculus (mouse))

Name: lymphocyte transmembrane adaptor 1

Synonyms: E430019B13Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ikbke [MGI:1929612] (Mus musculus (mouse))

Name: inhibitor of kappaB kinase epsilon

Synonyms: IKKepsilon, IKK-i

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Nlrx1 [MGI:2429611] (Mus musculus (mouse))

Name: NLR family member X1

Chromosome: 9

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Zp3r [MGI:104965] (Mus musculus (mouse))

Name: zona pellucida 3 receptor

Synonyms: SP56

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Pik3c2b [MGI:2685045] (Mus musculus (mouse))

Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms: C330011J12Rik, PI3K-C2beta

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cfhr2 [MGI:3611575] (Mus musculus (mouse))

Name: complement factor H-related 2

Synonyms: FHR-B

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ptpn7 [MGI:2156893] (Mus musculus (mouse))

Name: protein tyrosine phosphatase, non-receptor type 7

Synonyms: LC-PTP, BPTP-4, C920001D21Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Selenoi [MGI:107898] (Mus musculus (mouse))

Name: selenoprotein I

Synonyms: 4933402G07Rik, Ept1, C79563, D5Wsu178e

Chromosome: 5

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Abca7 [MGI:1351646] (Mus musculus (mouse))

Name: ATP-binding cassette, sub-family A (ABC1), member 7

Synonyms: Abc51

Chromosome: 10

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Lmod1 [MGI:2135671] (Mus musculus (mouse))

Name: leiomodin 1 (smooth muscle)

Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr1284 [MGI:3031118] (Mus musculus (mouse))

Name: olfactory receptor 1284

Synonyms: MOR245-13, GA_x6K02T2Q125-72430580-72431515

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: 4930444G20Rik [MGI:2149738] (Mus musculus (mouse))

Name: RIKEN cDNA 4930444G20 gene

Chromosome: 10

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Slc26a9 [MGI:2444594] (Mus musculus (mouse))

Name: solute carrier family 26, member 9

Synonyms: E030002L01Rik, anion transporter/exchanger-9

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr596 [MGI:3030430] (Mus musculus (mouse))

Name: olfactory receptor 596

Synonyms: Olfr596-ps1, GA_x6K02T2PBJ9-6019769-6019943, ENSMUSG00000073953, Gm15117

Chromosome: 7

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Rgs18 [MGI:1927498] (Mus musculus (mouse))

Name: regulator of G-protein signaling 18

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Naif1 [MGI:1918504] (Mus musculus (mouse))

Name: nuclear apoptosis inducing factor 1

Synonyms: 4933440H19Rik, 2310007O20Rik

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Stx19 [MGI:1915409] (Mus musculus (mouse))

Name: syntaxin 19

Synonyms: A030009B12Rik

Chromosome: 16

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Tnnt2 [MGI:104597] (Mus musculus (mouse))

Name: troponin T2, cardiac

Synonyms: Tnt, cTnT, cardiac TnT

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Irx5 [MGI:1859086] (Mus musculus (mouse))

Name: Iroquois homeobox 5

Chromosome: 8

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Chit1 [MGI:1919134] (Mus musculus (mouse))

Name: chitinase 1 (chitotriosidase)

Synonyms: 2300002L19Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr1107 [MGI:3030941] (Mus musculus (mouse))

Name: olfactory receptor 1107

Synonyms: MOR172-2, GA_x6K02T2Q125-48565383-48564445

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Optc [MGI:2151113] (Mus musculus (mouse))

Name: opticin

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Cd55b [MGI:104849] (Mus musculus (mouse))

Name: CD55 molecule, decay accelerating factor for complement B

Synonyms: Daf2, Daf-TM, complement-transmembrane, TM-DAF

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gm10110 [MGI:3641718] (Mus musculus (mouse))

Name: predicted gene 10110

Chromosome: 14

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Prelp [MGI:2151110] (Mus musculus (mouse))

Name: proline arginine-rich end leucine-rich repeat

Synonyms: 7330409J17Rik, SLRR2A

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: C4bp [MGI:88229] (Mus musculus (mouse))

Name: complement component 4 binding protein

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Pdzk1 [MGI:1928901] (Mus musculus (mouse))

Name: PDZ domain containing 1

Synonyms: mPDZK1, 4921513F16Rik, 2610507N21Rik, D3Ertd537e, 1700023D20Rik

Chromosome: 3

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Fcamr [MGI:1927803] (Mus musculus (mouse))

Name: Fc receptor, IgA, IgM, high affinity

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Etnk2 [MGI:2443760] (Mus musculus (mouse))

Name: ethanolamine kinase 2

Synonyms: Eki2, 4933417N20Rik

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Serpinb2 [MGI:97609] (Mus musculus (mouse))

Name: serine (or cysteine) peptidase inhibitor, clade B, member 2

Synonyms: PAI-2, ovalbumin, Planh2

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Fcmr [MGI:1916419] (Mus musculus (mouse))

Name: Fc fragment of IgM receptor

Synonyms: Faim3, 1810037B05Rik, FcmuR

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gpr84 [MGI:1934129] (Mus musculus (mouse))

Name: G protein-coupled receptor 84

Synonyms: EX33

Chromosome: 15

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr1148 [MGI:3030982] (Mus musculus (mouse))

Name: olfactory receptor 1148

Synonyms: GA_x6K02T2Q125-49334566-49335510, MOR264-7

Chromosome: 2

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr303 [MGI:3030137] (Mus musculus (mouse))

Name: olfactory receptor 303

Synonyms: GA_x6K02T2NHDJ-9712819-9713778, MOR104-2

Chromosome: 7

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Lad1 [MGI:109343] (Mus musculus (mouse))

Name: ladinin

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gm4793 [MGI:3646955] (Mus musculus (mouse))

Name: predicted gene 4793

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Rab29 [MGI:2385107] (Mus musculus (mouse))

Name: RAB29, member RAS oncogene family

Synonyms: Rab7l1

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Kiss1 [MGI:2663985] (Mus musculus (mouse))

Name: KiSS-1 metastasis-suppressor

Synonyms: kisspeptin, metastin

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ptprv [MGI:108027] (Mus musculus (mouse))

Name: protein tyrosine phosphatase, receptor type, V

Synonyms: OST, OST-PTP, Esp, mOST-PTP

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gpr25 [MGI:2686146] (Mus musculus (mouse))

Name: G protein-coupled receptor 25

Synonyms: LOC383563

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Glrx2 [MGI:1916617] (Mus musculus (mouse))

Name: glutaredoxin 2 (thioltransferase)

Synonyms: 1700010P22Rik, Grx2

Chromosome: 1

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Gm10563 [MGI:3642630] (Mus musculus (mouse))

Name: predicted gene 10563

Chromosome: 4

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Olfr582 [MGI:3030416] (Mus musculus (mouse))

Name: olfactory receptor 582

Synonyms: MOR30-3, GA_x6K02T2PBJ9-5752857-5753801

Chromosome: 7

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Gene Symbol: Ift20 [MGI:1915585] (Mus musculus (mouse))

Name: intraflagellar transport 20

Synonyms: 0610009H04Rik

Chromosome: 11

Alteration at locus: Chemically Induced

Monarch Initiative: Disease and Phenotype Associations

Genetic Alterations

ENU-induced transitions at the following base pair locations (GRCm38):

G to A, chromosome 1 at 75,486,756 bp
G to A, chromosome 1 at 107,515,635 bp
C to A, chromosome 1 at 107,523,834 bp
C to T, chromosome 1 at 107,523,890 bp
C to T, chromosome 1 at 107,523,894 bp
G to A, chromosome 1 at 107,523,975 bp
A to C, chromosome 1 at 107,524,543 bp
C to T, chromosome 1 at 107,538,473 bp
A to G, chromosome 1 at 107,597,527 bp
G to A, chromosome 1 at 107,598,954 bp
A to C, chromosome 1 at 107,607,004 bp
C to G, chromosome 1 at 110,065,735 bp
C to A, chromosome 1 at 110,893,384 bp
T to C, chromosome 1 at 111,859,457 bp
G to C, chromosome 1 at 111,859,994 bp
C to A, chromosome 1 at 116,455,004 bp
T to C, chromosome 1 at 116,455,101 bp
C to T, chromosome 1 at 116,455,143 bp
G to A, chromosome 1 at 116,455,224 bp
C to T, chromosome 1 at 118,868,087 bp
A to T, chromosome 1 at 119,002,029 bp
G to T, chromosome 1 at 119,002,044 bp
T to C, chromosome 1 at 120,031,656 bp
G to T, chromosome 1 at 120,063,246 bp
G to A, chromosome 1 at 120,063,257 bp
C to T, chromosome 1 at 120,120,108 bp
T to C, chromosome 1 at 120,227,750 bp
G to A, chromosome 1 at 120,234,378 bp
T to C, chromosome 1 at 120,243,757 bp
T to C, chromosome 1 at 120,270,115 bp
A to G, chromosome 1 at 121,456,061 bp
C to T, chromosome 1 at 121,456,126 bp
T to C, chromosome 1 at 121,461,939 bp
T to C, chromosome 1 at 121,559,334 bp
G to A, chromosome 1 at 125,872,549 bp
C to T, chromosome 1 at 128,589,277 bp
C to T, chromosome 1 at 129,628,891 bp
T to A, chromosome 1 at 129,667,937 bp
G to C, chromosome 1 at 129,678,183 bp
T to C, chromosome 1 at 129,915,756 bp
T to G, chromosome 1 at 130,103,066 bp
T to A, chromosome 1 at 130,103,076 bp
A to C, chromosome 1 at 130,116,631 bp
T to C, chromosome 1 at 130,116,717 bp
T to A, chromosome 1 at 130,388,655 bp
C to T, chromosome 1 at 130,449,423 bp
G to A, chromosome 1 at 130,458,078 bp
C to A, chromosome 1 at 130,459,633 bp
A to G, chromosome 1 at 130,596,651 bp
A to G, chromosome 1 at 130,596,814 bp
C to A, chromosome 1 at 130,619,414 bp
C to G, chromosome 1 at 130,642,988 bp
G to A, chromosome 1 at 130,737,688 bp
A to C, chromosome 1 at 130,804,627 bp
C to A, chromosome 1 at 130,804,690 bp
A to G, chromosome 1 at 130,811,580 bp
G to A, chromosome 1 at 130,812,629 bp
A to G, chromosome 1 at 130,812,692 bp
T to C, chromosome 1 at 130,812,738 bp
A to G, chromosome 1 at 130,812,809 bp
C to T, chromosome 1 at 130,812,816 bp
A to G, chromosome 1 at 130,814,597 bp
C to T, chromosome 1 at 130,844,522 bp
A to G, chromosome 1 at 130,875,974 bp
T to C, chromosome 1 at 130,878,269 bp
G to T, chromosome 1 at 131,056,406 bp
C to A, chromosome 1 at 131,265,937 bp
T to C, chromosome 1 at 131,269,823 bp
T to C, chromosome 1 at 131,530,668 bp
C to T, chromosome 1 at 131,538,895 bp
ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
T to C, chromosome 1 at 131,697,817 bp
G to T, chromosome 1 at 131,697,819 bp
T to C, chromosome 1 at 131,698,409 bp
C to T, chromosome 1 at 131,758,590 bp
C to T, chromosome 1 at 131,763,870 bp
T to C, chromosome 1 at 131,765,876 bp
C to A, chromosome 1 at 131,766,012 bp
A to G, chromosome 1 at 131,872,110 bp
T to C, chromosome 1 at 132,115,859 bp
G to A, chromosome 1 at 132,453,334 bp
C to T, chromosome 1 at 132,456,984 bp
C to T, chromosome 1 at 133,066,627 bp
C to T, chromosome 1 at 133,071,339 bp
C to T, chromosome 1 at 133,098,620 bp
A to G, chromosome 1 at 133,098,621 bp
G to T, chromosome 1 at 133,282,278 bp
C to G, chromosome 1 at 133,287,846 bp
AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
T to A, chromosome 1 at 133,354,206 bp
C to T, chromosome 1 at 133,354,237 bp
A to G, chromosome 1 at 133,354,287 bp
C to T, chromosome 1 at 133,354,787 bp
T to C, chromosome 1 at 133,358,537 bp
C to A, chromosome 1 at 133,358,982 bp
A to T, chromosome 1 at 133,359,079 bp
C to G, chromosome 1 at 133,360,007 bp
C to A, chromosome 1 at 133,365,587 bp
G to T, chromosome 1 at 133,365,765 bp
C to T, chromosome 1 at 133,365,816 bp
G to A, chromosome 1 at 133,365,817 bp
T to C, chromosome 1 at 133,373,123 bp
T to C, chromosome 1 at 133,373,127 bp
T to A, chromosome 1 at 133,376,915 bp
G to T, chromosome 1 at 133,377,046 bp
G to A, chromosome 1 at 133,622,154 bp
C to T, chromosome 1 at 133,624,621 bp
A to G, chromosome 1 at 133,638,523 bp
T to C, chromosome 1 at 133,679,978 bp
T to C, chromosome 1 at 133,680,569 bp
G to A, chromosome 1 at 133,683,634 bp
A to T, chromosome 1 at 133,903,796 bp
C to G, chromosome 1 at 133,905,170 bp
C to T, chromosome 1 at 133,915,131 bp
T to C, chromosome 1 at 134,149,361 bp
C to T, chromosome 1 at 134,151,204 bp
C to T, chromosome 1 at 134,188,529 bp
A to G, chromosome 1 at 134,193,732 bp
C to T, chromosome 1 at 134,197,480 bp
G to A, chromosome 1 at 134,299,321 bp
C to G, chromosome 1 at 134,303,789 bp
C to A, chromosome 1 at 134,304,275 bp
C to T, chromosome 1 at 134,407,667 bp
C to T, chromosome 1 at 134,408,389 bp
C to T, chromosome 1 at 134,585,243 bp
A to G, chromosome 1 at 134,604,431 bp
T to A, chromosome 1 at 134,604,467 bp
T to G, chromosome 1 at 134,605,705 bp
C to G, chromosome 1 at 134,605,709 bp
ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
G to A, chromosome 1 at 134,865,964 bp
C to T, chromosome 1 at 134,886,408 bp
AG to AGG, chromosome 1 at 134,971,364 bp
C to T, chromosome 1 at 134,972,167 bp
G to A, chromosome 1 at 134,972,201 bp
C to T, chromosome 1 at 134,987,088 bp
A to T, chromosome 1 at 134,988,009 bp
G to T, chromosome 1 at 134,990,635 bp
A to G, chromosome 1 at 135,000,469 bp
G to A, chromosome 1 at 135,003,275 bp
C to T, chromosome 1 at 135,003,451 bp
C to T, chromosome 1 at 135,003,476 bp
T to C, chromosome 1 at 135,111,440 bp
A to G, chromosome 1 at 135,134,475 bp
A to G, chromosome 1 at 135,256,335 bp
A to C, chromosome 1 at 135,257,299 bp
C to T, chromosome 1 at 135,263,096 bp
C to T, chromosome 1 at 135,364,073 bp
ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
A to G, chromosome 1 at 135,386,810 bp
C to T, chromosome 1 at 135,388,501 bp
A to C, chromosome 1 at 135,388,683 bp
A to G, chromosome 1 at 135,402,250 bp
A to G, chromosome 1 at 135,404,215 bp
A to G, chromosome 1 at 135,404,334 bp
G to C, chromosome 1 at 135,405,985 bp
T to C, chromosome 1 at 135,406,745 bp
A to G, chromosome 1 at 135,452,798 bp
T to C, chromosome 1 at 135,468,845 bp
T to C, chromosome 1 at 135,471,182 bp
C to A, chromosome 1 at 135,532,727 bp
A to T, chromosome 1 at 135,584,727 bp
G to A, chromosome 1 at 135,592,515 bp
A to T, chromosome 1 at 135,607,339 bp
A to G, chromosome 1 at 135,607,421 bp
C to T, chromosome 1 at 135,607,423 bp
C to A, chromosome 1 at 135,607,716 bp
T to G, chromosome 1 at 135,805,640 bp
C to T, chromosome 1 at 135,827,381 bp
C to T, chromosome 1 at 135,828,023 bp
C to T, chromosome 1 at 135,841,897 bp
A to G, chromosome 1 at 135,841,997 bp
C to T, chromosome 1 at 135,843,763 bp
C to T, chromosome 1 at 135,845,506 bp
TG to TGG, chromosome 1 at 135,846,761 bp
C to A, chromosome 1 at 135,847,786 bp
T to C, chromosome 1 at 135,852,024 bp
G to A, chromosome 1 at 135,954,556 bp
G to A, chromosome 1 at 135,959,928 bp
G to A, chromosome 1 at 135,968,199 bp
T to C, chromosome 1 at 135,970,411 bp
C to T, chromosome 1 at 135,972,127 bp
AGGG to AGG, chromosome 1 at 135,974,852 bp
C to T, chromosome 1 at 135,979,915 bp
G to A, chromosome 1 at 135,982,475 bp
T to C, chromosome 1 at 135,998,625 bp
T to C, chromosome 1 at 135,998,683 bp
T to C, chromosome 1 at 136,054,697 bp
C to T, chromosome 1 at 136,070,627 bp
C to G, chromosome 1 at 136,073,723 bp
T to C, chromosome 1 at 136,111,963 bp
T to C, chromosome 1 at 136,118,716 bp
C to T, chromosome 1 at 136,145,123 bp
T to C, chromosome 1 at 136,147,490 bp
C to T, chromosome 1 at 136,147,721 bp
A to C, chromosome 1 at 136,148,385 bp
T to C, chromosome 1 at 136,160,292 bp
A to G, chromosome 1 at 136,163,059 bp
T to A, chromosome 1 at 136,163,156 bp
G to C, chromosome 1 at 136,192,144 bp
G to A, chromosome 1 at 136,227,590 bp
G to A, chromosome 1 at 136,260,710 bp
C to T, chromosome 1 at 136,281,315 bp
C to T, chromosome 1 at 136,295,507 bp
T to C, chromosome 1 at 136,417,053 bp
T to C, chromosome 1 at 136,432,578 bp
A to G, chromosome 1 at 136,468,279 bp
A to G, chromosome 1 at 136,468,975 bp
G to A, chromosome 1 at 136,478,365 bp
A to G, chromosome 1 at 136,490,332 bp
CC to CCGAC, chromosome 1 at 136,490,395 bp
T to G, chromosome 1 at 136,496,556 bp
C to T, chromosome 1 at 136,503,431 bp
T to C, chromosome 1 at 136,515,961 bp
T to C, chromosome 1 at 136,525,783 bp
C to A, chromosome 1 at 136,952,125 bp
A to G, chromosome 1 at 138,080,273 bp
T to G, chromosome 1 at 138,099,676 bp
A to G, chromosome 1 at 138,107,823 bp
C to A, chromosome 1 at 138,107,824 bp
A to G, chromosome 1 at 138,107,837 bp
T to C, chromosome 1 at 138,112,254 bp
T to C, chromosome 1 at 138,966,234 bp
T to C, chromosome 1 at 139,039,996 bp
C to T, chromosome 1 at 139,059,141 bp
T to C, chromosome 1 at 139,234,779 bp
T to C, chromosome 1 at 139,237,531 bp
A to T, chromosome 1 at 139,237,622 bp
G to A, chromosome 1 at 139,241,138 bp
C to T, chromosome 1 at 139,242,995 bp
C to T, chromosome 1 at 139,243,417 bp
A to G, chromosome 1 at 139,473,574 bp
A to G, chromosome 1 at 139,597,661 bp
A to G, chromosome 1 at 139,813,442 bp
A to C, chromosome 1 at 139,813,459 bp
T to C, chromosome 1 at 140,136,788 bp
C to T, chromosome 1 at 140,147,697 bp
G to A, chromosome 1 at 140,354,547 bp
C to T, chromosome 1 at 143,739,740 bp
C to T, chromosome 1 at 143,760,014 bp
T to C, chromosome 1 at 143,760,034 bp
A to G, chromosome 1 at 143,765,929 bp
A to G, chromosome 1 at 144,773,509 bp
T to C, chromosome 1 at 157,299,144 bp
T to C, chromosome 2 at 32,454,890 bp
CAGAG to CAG, chromosome 2 at 35,122,806 bp
A to T, chromosome 2 at 69,220,842 bp
C to T, chromosome 2 at 76,813,339 bp
A to T, chromosome 2 at 87,071,921 bp
G to T, chromosome 2 at 87,833,665 bp
C to T, chromosome 2 at 89,439,583 bp
C to A, chromosome 2 at 93,437,429 bp
A to G, chromosome 2 at 111,379,573 bp
G to A, chromosome 2 at 155,630,858 bp
A to G, chromosome 2 at 179,797,480 bp
T to G, chromosome 3 at 87,993,625 bp
A to T, chromosome 3 at 96,851,573 bp
A to G, chromosome 3 at 97,588,299 bp
T to A, chromosome 3 at 99,351,944 bp
T to A, chromosome 4 at 32,649,165 bp
T to A, chromosome 4 at 41,498,553 bp
T to C, chromosome 4 at 113,236,481 bp
A to G, chromosome 4 at 113,742,252 bp
C to T, chromosome 4 at 155,635,880 bp
T to A, chromosome 5 at 30,263,127 bp
G to T, chromosome 5 at 115,587,968 bp
A to G, chromosome 5 at 137,290,575 bp
G to T, chromosome 6 at 64,533,654 bp
T to C, chromosome 6 at 77,244,697 bp
G to C, chromosome 6 at 111,358,295 bp
T to C, chromosome 6 at 122,606,407 bp
T to C, chromosome 7 at 86,395,145 bp
C to A, chromosome 7 at 103,042,042 bp
C to T, chromosome 7 at 103,310,221 bp
C to T, chromosome 7 at 104,881,240 bp
T to C, chromosome 7 at 110,312,758 bp
A to T, chromosome 7 at 117,637,761 bp
C to A, chromosome 7 at 143,592,474 bp
T to A, chromosome 8 at 31,822,323 bp
T to A, chromosome 8 at 36,937,585 bp
A to T, chromosome 8 at 70,379,742 bp
T to A, chromosome 8 at 92,359,644 bp
G to A, chromosome 8 at 124,605,711 bp
A to G, chromosome 8 at 129,110,842 bp
T to G, chromosome 9 at 18,485,139 bp
A to G, chromosome 9 at 38,877,785 bp
A to T, chromosome 9 at 42,375,309 bp
T to C, chromosome 9 at 44,263,640 bp
A to T, chromosome 9 at 52,115,781 bp
A to T, chromosome 9 at 111,229,929 bp
A to T, chromosome 10 at 22,067,512 bp
T to A, chromosome 10 at 59,863,260 bp
T to A, chromosome 10 at 76,355,137 bp
T to C, chromosome 10 at 79,999,765 bp
C to T, chromosome 10 at 80,066,606 bp
A to G, chromosome 10 at 87,567,468 bp
A to C, chromosome 10 at 116,798,593 bp
T to C, chromosome 11 at 46,336,482 bp
T to C, chromosome 11 at 62,384,784 bp
CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
A to T, chromosome 11 at 69,778,917 bp
G to C, chromosome 11 at 76,211,050 bp
G to A, chromosome 11 at 78,540,034 bp
A to T, chromosome 11 at 87,583,436 bp
A to C, chromosome 11 at 101,532,018 bp
G to A, chromosome 12 at 54,909,020 bp
C to T, chromosome 13 at 42,183,786 bp
T to C, chromosome 13 at 44,916,410 bp
T to A, chromosome 13 at 81,506,146 bp
T to C, chromosome 13 at 100,813,462 bp
A to T, chromosome 13 at 111,440,774 bp
T to C, chromosome 14 at 19,402,408 bp
T to C, chromosome 14 at 28,522,891 bp
A to G, chromosome 14 at 89,897,389 bp
T to C, chromosome 14 at 101,507,138 bp
T to C, chromosome 15 at 6,756,573 bp
T to C, chromosome 15 at 56,681,610 bp
T to A, chromosome 15 at 103,309,327 bp
A to T, chromosome 16 at 3,708,186 bp
T to A, chromosome 16 at 15,637,961 bp
A to T, chromosome 16 at 22,083,947 bp
A to T, chromosome 16 at 62,821,980 bp
G to A, chromosome 16 at 97,538,703 bp
T to C, chromosome 17 at 24,893,393 bp
C to T, chromosome 17 at 42,666,898 bp
A to G, chromosome 17 at 56,188,362 bp
A to G, chromosome 18 at 20,539,732 bp
A to G, chromosome 18 at 37,403,083 bp
T to C, chromosome 18 at 60,811,318 bp
G to A, chromosome 19 at 13,654,504 bp
A to G, chromosome 19 at 38,818,153 bp
A to T, chromosome 19 at 41,603,335 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

ES Cell Line

N/A

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

MeSH Terms

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R1762 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $)	Units	Notes
039794-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter¹; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

¹ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

³ An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Gene Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All