Strain Name:
C57BL/6J-MtgxR1783Btlr/Mmmh
Stock Number:
039814-MU
Citation ID:
RRID:MMRRC_039814-MU
Other Names:
R1783 (G1), C57BL/6J-MtgxR1783Btlr
Major Collection:

Gene Information

Utrn
Name: utrophin
Synonyms: G-utrophin, DRP, Dmdl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Ppp2r2d
Name: protein phosphatase 2, regulatory subunit B, delta
Synonyms: D7Ertd753e, 1300017E19Rik, MDS026
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 52432
Homologene: 81915
Septin4
Name: septin 4
Synonyms: Sept4, Pnutl2, Bh5, ARTS, septin H5, cell division control-related protein 2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
En1
Name: engrailed 1
Synonyms: Mo-en.1, engrailed-1, En-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13798
HGNC: HGNC:3342
Homologene: 50663
Gabarap
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56486
HGNC: HGNC:4067
Homologene: 134119
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: GIRK4, Kir3.4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
Jarid2
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Mkrn1
Name: makorin, ring finger protein, 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54484
HGNC: HGNC:7112
Homologene: 32175
Kdm5b
Name: lysine (K)-specific demethylase 5B
Synonyms: 2210016I17Rik, Rb-Bp2, 2010009J12Rik, D1Ertd202e, Jarid1b, Plu1, PLU-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Gatad2a
Name: GATA zinc finger domain containing 2A
Synonyms: 1110066C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234366
Homologene: 9766
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15184
Homologene: 3995
Cdk18
Name: cyclin-dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18557
HGNC: HGNC:8751
Homologene: 1949
Efnb2
Name: ephrin B2
Synonyms: ELF-2, Htk-L, LERK-5, Eplg5, NLERK-1, Epl5, Lerk5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13642
HGNC: HGNC:3227
Homologene: 3019
Nr5a2
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: D1Ertd308e, UF2-H3B, LRH-1, Ftf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26424
HGNC: HGNC:7984
Homologene: 20827
Cxcr4
Name: chemokine (C-X-C motif) receptor 4
Synonyms: fusin, Sdf1r, PB-CKR, b2b220Clo, Cmkar4, CD184
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12767
HGNC: HGNC:2561
Homologene: 20739
Dbi
Name: diazepam binding inhibitor
Synonyms: endozepine, Acbp, diazepam-binding inhibitor, EP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13167
HGNC: HGNC:2690
Homologene: 39086
Sfswap
Name: splicing factor SWAP
Synonyms: 1190005N23Rik, Sfrs8, 6330437E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231769
Homologene: 134548
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: C130058G22Rik, CSB, CS group B correcting gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Anln
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Ccdc93
Name: coiled-coil domain containing 93
Synonyms: 4633402D15Rik, 9230102M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70829
Homologene: 10393
Zc3h11a
Name: zinc finger CCCH type containing 11A
Synonyms: G630041M05Rik, 5730454B08Rik, 1110003F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70579
Homologene: 8888
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Calmbp1, D330028K02Rik, Aspm, MCPH5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Xpo6
Name: exportin 6
Synonyms: 2610005L19Rik, C230091E20Rik, Ranbp20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74204
Homologene: 12544
Dmtf1
Name: cyclin D binding myb-like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 23857
Homologene: 8017
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67886
Homologene: 18927
Cep350
Name: centrosomal protein 350
Synonyms: 4933409L06Rik, 6430546F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74081
Homologene: 8879
Git2
Name: GIT ArfGAP 2
Synonyms: Cool associated tyrosine phosphorylated-2, ARF GTPase activating protein 2, 5830420E16Rik, B230104M05Rik, 1500036H07Rik, 9630056M03Rik, Cat-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Phldb1
Name: pleckstrin homology like domain, family B, member 1
Synonyms: D330037A14Rik, LL5A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102693
Homologene: 15903
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Ddx18
Name: DEAD box helicase 18
Synonyms: 2310005B10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66942
HGNC: HGNC:2741
Homologene: 6697
Wars
Name: tryptophanyl-tRNA synthetase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 22375
Homologene: 3084
Ipo9
Name: importin 9
Synonyms: Imp9, 0710008K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf1, GPI-DAF, Cromer blood group, complement-glycosylphosphatidylinositol, Daf-GPI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Adgrb2
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230775
HGNC: HGNC:944
Homologene: 1288
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGlu7a receptor, SMN2, Gpr1g, E130018M02Rik, Tg(SMN2)89Ahmb, 6330570A01Rik, mGluR7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Ptprc
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: CD45, Lyt-4, Ly-5, T200, B220
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Dennd1b
Name: DENN/MADD domain containing 1B
Synonyms: 4632404N19Rik, 6820401H01Rik, F730008N07Rik, 4930467M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329260
Homologene: 11739
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Bbs9
Name: Bardet-Biedl syndrome 9 (human)
Synonyms: E130103I17Rik, EST 3159894
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319845
Homologene: 44480
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Nrip1
Name: nuclear receptor interacting protein 1
Synonyms: 6030458L20Rik, 8430438I05Rik, RIP140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 268903
HGNC: HGNC:8001
Homologene: 2606
Ptgfrn
Name: prostaglandin F2 receptor negative regulator
Synonyms: CD9P-1, 4833445A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19221
HGNC: HGNC:9601
Homologene: 7908
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233904
Homologene: 52251
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Tnc
Name: tenascin C
Synonyms: TN, Hxb, cytotactin, C130033P17Rik, tenascin-C, hexabrachion, TN-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329252
Homologene: 49680
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Cars
Name: cysteinyl-tRNA synthetase
Synonyms: CA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Cyb5r1
Name: cytochrome b5 reductase 1
Synonyms: Nqo3a2, B5R.1, 1500005G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72017
Homologene: 96059
Fam72a
Name: family with sequence similarity 72, member A
Synonyms: P17, 2700049P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108900
Homologene: 82352
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67313
Homologene: 10103
Pard6g
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, steerin-1, 9930003A20Rik, unc53H1, C230080M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Slc4a4
Name: solute carrier family 4 (anion exchanger), member 4
Synonyms: NBC, NBC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54403
Homologene: 55776
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Sertad4
Name: SERTA domain containing 4
Synonyms: C130018M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214791
Homologene: 10483
Steap3
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68428
Homologene: 10084
Tnni1
Name: troponin I, skeletal, slow 1
Synonyms: 2700018B22Rik, ssTnI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21952
Homologene: 2462
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78249
Homologene: 51953
Ttn
Name: titin
Synonyms: shru, L56, mdm, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, 1100001C23Rik, connectin, D330041I19Rik, D830007G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Elf3
Name: E74-like factor 3
Synonyms: ESX, ESE-1, jen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 58178
Homologene: 10967
Rnpep
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215615
Homologene: 10628
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: Polydom, 4833413O10Rik, 1110021D17Rik, D430029O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64817
Homologene: 23386
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Acc2, Accb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329178
Homologene: 122243
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Mapkapk2
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17164
HGNC: HGNC:6887
Homologene: 56412
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Sctr
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319229
Homologene: 68290
Dock10
Name: dedicator of cytokinesis 10
Synonyms: 9330153B10Rik, Jr4, A630054M16Rik, Jr5, ZIZ3, Zizimin3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210293
Homologene: 45952
Eogt
Name: EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101351
Homologene: 65276
D130043K22Rik
Name: RIKEN cDNA D130043K22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 210108
Homologene: 8878
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 207618
Homologene: 52304
Fam131b
Name: family with sequence similarity 131, member B
Synonyms: 6330503C03Rik, 6530406I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 76156
Homologene: 8797
Cdh7
Name: cadherin 7, type 2
Synonyms: 9330156F07Rik, CDH7L1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cav1.1, mdg, fmd, Cchl1a3, DHPR alpha1s, sj, muscle dysgenesis
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1alpha, C030033M19Rik, RIM1a, RIM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116837
Homologene: 128399
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: OTTMUSG00000005786, LOC380698
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Tbc1d17
Name: TBC1 domain family, member 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233204
Homologene: 11656
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: LOC100042382, Liprin-alpha4, Gm3812, 1110008G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: beta3B, Naptb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74183
Homologene: 135954
Mybph
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53311
HGNC: HGNC:7552
Homologene: 3661
Ctse
Name: cathepsin E
Synonyms: CE, C920004C08Rik, A430072O03Rik, CatE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
HGNC: HGNC:2530
Homologene: 37551
Slc36a1
Name: solute carrier family 36 (proton/amino acid symporter), member 1
Synonyms: Pat1, 5830411H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 215335
Homologene: 121860
Capn8
Name: calpain 8
Synonyms: nCL-2', nCL-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170725
HGNC: HGNC:1485
Homologene: 15643
Chil1
Name: chitinase-like 1
Synonyms: Brp39, Gp39, Chi3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12654
HGNC: HGNC:1932
Homologene: 55569
Zfp623
Name: zinc finger protein 623
Synonyms: 2610029D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78834
VEGA: 15
Homologene: 15994
Polr2i
Name: polymerase (RNA) II (DNA directed) polypeptide I
Synonyms: 2810002B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69920
HGNC: HGNC:9196
Homologene: 4541
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76422
Rsph4a
Name: radial spoke head 4 homolog A (Chlamydomonas)
Synonyms: Rshl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 212892
Homologene: 71779
Fmo9
Name: flavin containing monooxygenase 9
Synonyms: 4831428F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240894
Homologene: 134192
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243961
Homologene: 22949
Mybpc1
Name: myosin binding protein C, slow-type
Synonyms: Slow-type C-protein, 8030451F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 109272
HGNC: HGNC:7549
Homologene: 1846
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666528
Homologene: 12991
Syce1l
Name: synaptonemal complex central element protein 1 like
Synonyms: mmrp2, 4930481F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 668110
Homologene: 86343
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Kif14
Name: kinesin family member 14
Synonyms: D1Ertd367e, N-3 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Olfr951
Name: olfactory receptor 951
Synonyms: MOR171-49, MOR171-33P, GA_x6K02T2PVTD-33090395-33091330
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258046
VEGA: 9
Homologene: 71961
Rab7b
Name: RAB7B, member RAS oncogene family
Synonyms: 5430435G22Rik, Rab7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226421
Homologene: 64833
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Kcna5
Name: potassium voltage-gated channel, shaker-related subfamily, member 5
Synonyms: Kv1.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16493
HGNC: HGNC:6224
Homologene: 1683
Tmem143
Name: transmembrane protein 143
Synonyms: 2310076O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70209
Homologene: 10105
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Axdnd1
Name: axonemal dynein light chain domain containing 1
Synonyms: LOC381304, 9430070O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77352
Homologene: 52328
Parp6
Name: poly (ADP-ribose) polymerase family, member 6
Synonyms: C030013N01Rik, 1700119G14Rik, 2310028P13Rik, 3110038K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67287
VEGA: 9
Homologene: 10627
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: D130067I03Rik, 1700074E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Kif21b
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Krt2
Name: keratin 2
Synonyms: Krt2-17, Krt2-2, Krt2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16681
HGNC: HGNC:6439
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: DS-epi2, 9330132E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319901
Homologene: 12964
Miip
Name: migration and invasion inhibitory protein
Synonyms: D4Wsu114e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 28010
Homologene: 15879
Ddx59
Name: DEAD box helicase 59
Synonyms: 1210002B07Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 59, 4833411G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67997
Homologene: 12222
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Mcam
Name: melanoma cell adhesion molecule
Synonyms: Muc18, s-endo, 1-gicerin, CD146, s-gicerin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 84004
HGNC: HGNC:6934
Homologene: 4742
Cfh
Name: complement component factor h
Synonyms: Mud-1, Sas-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Ren1
Name: renin 1 structural
Synonyms: Rn-1, Ren, Ren1c, Ren-A, Ren-1, Rnr, Ren1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242702
Homologene: 19432
Etnppl
Name: ethanolamine phosphate phospholyase
Synonyms: Agxt2l1, 1300019H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71760
Homologene: 69440
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: NK10, CAP2, Spi8, ovalbumin, CAP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22312
Homologene: 129750
Capn9
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Fafl2, Dffry
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 636808
Homologene: 43974
Xirp1
Name: xin actin-binding repeat containing 1
Synonyms: mXin alpha, Xin, Cmya1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22437
VEGA: 9
Homologene: 7998
Olfr1240
Name: olfactory receptor 1240
Synonyms: MOR231-8, GA_x6K02T2Q125-50883183-50882239
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
Zbed6
Name: zinc finger, BED type containing 6
Synonyms: MGR, similar to Zinc finger BED domain containing protein 4, Gm8466
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 667118
Homologene: 130066
Itgb5
Name: integrin beta 5
Synonyms: [b]5B, [b]5, [b]5A, beta5, ESTM23, [b]-5, beta-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16419
HGNC: HGNC:6160
Homologene: 20511
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: Ssa2, Trove2, A530054J02Rik, 1810007I17Rik, Ssa, SS-A/Ro
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Lax1
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240754
Homologene: 49504
Akr1b7
Name: aldo-keto reductase family 1, member B7
Synonyms: Avdp, MVDP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11997
Homologene: 122176
Ikbke
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
Pramel31
Name: PRAME like 31
Synonyms: Gm13119
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433779
Homologene: 83161
Zp3r
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22789
Homologene: 7609
4921539E11Rik
Name: RIKEN cDNA 4921539E11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70941
Homologene: 52843
Zfp28
Name: zinc finger protein 28
Synonyms: mkr-5, Zfp-28, 2810438M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22690
Homologene: 69047
Fam90a1a
Name: family with sequence similarity 90, member A1A
Synonyms: C86695
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 97476
Homologene: 135718
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Ptpn7
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: BPTP-4, LC-PTP, C920001D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320139
HGNC: HGNC:9659
Homologene: 15411
Lmod1
Name: leiomodin 1 (smooth muscle)
Synonyms: 1D, SM-Lmod, 64kD D1, 9530015K06Rik, D1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93689
HGNC: HGNC:6647
Homologene: 8118
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
4930590J08Rik
Name: RIKEN cDNA 4930590J08 gene
Synonyms: LOC381798
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381798
Homologene: 49985
Fbxo40
Name: F-box protein 40
Synonyms: 9830003A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 207215
Homologene: 9459
Lin7b
Name: lin-7 homolog B (C. elegans)
Synonyms: Veli2, LIN-7B, MALS-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22342
Homologene: 22648
Nfkbib
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
Synonyms: IkB, IKappaBbeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18036
HGNC: HGNC:7798
Homologene: 37631
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: E030002L01Rik, anion transporter/exchanger-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Rgs18
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64214
Homologene: 11281
Olfr924
Name: olfactory receptor 924
Synonyms: MOR171-27P, MOR171-27P, MOR171-47, GA_x6K02T2PVTD-32543982-32544908, Olfr1520-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 404322
VEGA: 9
HGNC: HGNC:8482
Homologene: 128215
Telo2
Name: telomere maintenance 2
Synonyms: 1200003M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71718
Homologene: 41107
Olfr1307
Name: olfactory receptor 1307
Synonyms: GA_x6K02T2Q125-72988111-72987173, MOR245-19P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257956
Homologene: 128383
Tnnt2
Name: troponin T2, cardiac
Synonyms: cTnT, Tnt, cardiac TnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Irx5
Name: Iroquois homeobox 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54352
Homologene: 38105
Chit1
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71884
HGNC: HGNC:1936
Homologene: 68318
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
Fcamr
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64435
Homologene: 12929
Etnk2
Name: ethanolamine kinase 2
Synonyms: Eki2, 4933417N20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214253
Homologene: 10072
Abhd17a
Name: abhydrolase domain containing 17A
Synonyms: 1700013O15Rik, Fam108a, D10Bwg1364e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216169
Homologene: 50272
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: Planh2, ovalbumin, PAI-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Tmprss11a
Name: transmembrane protease, serine 11a
Synonyms: LOC194597
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 194597
Homologene: 62723
Rps19bp1
Name: ribosomal protein S19 binding protein 1
Synonyms: 2510038A11Rik, S19BP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66538
VEGA: 15
Homologene: 18407
Fcmr
Name: Fc fragment of IgM receptor
Synonyms: Faim3, FcmuR, 1810037B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69169
Homologene: 48347
Vmn1r224
Name: vomeronasal 1 receptor 224
Synonyms: Gm7673
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665525
Homologene: 85978
Lad1
Name: ladinin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16763
HGNC: HGNC:6472
Homologene: 4059
Gm4793
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215714
Rab29
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226422
HGNC: HGNC:9789
Homologene: 20842
Ptprv
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: mOST-PTP, OST, OST-PTP, Esp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Gpr25
Name: G protein-coupled receptor 25
Synonyms: LOC383563
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 383563
HGNC: HGNC:4480
Homologene: 3872
Glrx2
Name: glutaredoxin 2 (thioltransferase)
Synonyms: Grx2, 1700010P22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69367
Homologene: 41098
Gm10961
Name: predicted gene 10961
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 102639972
VEGA: 3
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Gpsm3
Name: G-protein signalling modulator 3 (AGS3-like, C. elegans)
Synonyms: AGS4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106512
Homologene: 11136
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 22,346,529 bp
  • G to A, chromosome 1 at 66,683,273 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • T to G, chromosome 1 at 80,574,180 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • C to T, chromosome 1 at 120,120,108 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • A to G, chromosome 1 at 120,603,621 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • C to T, chromosome 1 at 130,804,529 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • C to A, chromosome 1 at 131,766,012 bp
  • C to T, chromosome 1 at 131,766,038 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • A to T, chromosome 1 at 133,359,983 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • A to G, chromosome 1 at 133,363,923 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to T, chromosome 1 at 133,377,046 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • A to G, chromosome 1 at 134,149,394 bp
  • G to T, chromosome 1 at 134,149,395 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • G to C, chromosome 1 at 135,283,977 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,450,094 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to T, chromosome 1 at 136,070,627 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • G to A, chromosome 1 at 136,260,710 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,739,740 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • A to C, chromosome 1 at 155,928,865 bp
  • G to A, chromosome 1 at 156,382,364 bp
  • A to T, chromosome 1 at 166,673,648 bp
  • T to C, chromosome 1 at 182,598,822 bp
  • T to C, chromosome 1 at 192,847,032 bp
  • T to C, chromosome 2 at 14,327,844 bp
  • A to G, chromosome 2 at 76,788,901 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • T to C, chromosome 2 at 111,945,288 bp
  • A to G, chromosome 2 at 155,625,672 bp
  • T to C, chromosome 3 at 101,056,442 bp
  • T to C, chromosome 3 at 107,632,994 bp
  • A to G, chromosome 3 at 130,620,749 bp
  • T to A, chromosome 4 at 58,073,333 bp
  • A to G, chromosome 4 at 64,018,096 bp
  • T to A, chromosome 4 at 103,231,089 bp
  • C to T, chromosome 4 at 130,009,305 bp
  • T to C, chromosome 4 at 135,776,331 bp
  • G to T, chromosome 4 at 144,361,725 bp
  • G to A, chromosome 4 at 147,865,774 bp
  • C to T, chromosome 4 at 156,218,531 bp
  • T to C, chromosome 5 at 6,771,938 bp
  • T to C, chromosome 5 at 9,137,111 bp
  • T to A, chromosome 5 at 86,420,032 bp
  • T to A, chromosome 5 at 89,132,414 bp
  • T to A, chromosome 5 at 110,297,430 bp
  • TGGGG to TGGG, chromosome 5 at 114,209,767 bp
  • T to C, chromosome 5 at 114,739,124 bp
  • T to A, chromosome 5 at 129,513,240 bp
  • T to G, chromosome 6 at 34,417,269 bp
  • T to A, chromosome 6 at 39,400,456 bp
  • A to G, chromosome 6 at 40,664,860 bp
  • T to G, chromosome 6 at 42,318,580 bp
  • T to C, chromosome 6 at 91,919,278 bp
  • T to C, chromosome 6 at 97,113,864 bp
  • G to C, chromosome 6 at 111,358,295 bp
  • A to T, chromosome 6 at 126,533,860 bp
  • A to T, chromosome 7 at 6,394,792 bp
  • A to G, chromosome 7 at 16,077,973 bp
  • A to T, chromosome 7 at 28,762,055 bp
  • T to C, chromosome 7 at 30,233,068 bp
  • T to A, chromosome 7 at 44,352,737 bp
  • A to C, chromosome 7 at 44,845,131 bp
  • A to T, chromosome 7 at 45,369,927 bp
  • G to A, chromosome 7 at 45,907,002 bp
  • A to T, chromosome 7 at 81,476,733 bp
  • A to T, chromosome 7 at 126,110,082 bp
  • T to A, chromosome 7 at 127,785,124 bp
  • T to C, chromosome 7 at 138,869,866 bp
  • C to A, chromosome 7 at 143,592,474 bp
  • G to T, chromosome 8 at 8,623,237 bp
  • A to G, chromosome 8 at 21,963,463 bp
  • G to T, chromosome 8 at 69,909,936 bp
  • A to C, chromosome 8 at 92,359,688 bp
  • A to G, chromosome 8 at 113,654,834 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • C to T, chromosome 9 at 22,358,604 bp
  • T to C, chromosome 9 at 22,659,119 bp
  • T to C, chromosome 9 at 32,322,192 bp
  • T to A, chromosome 9 at 38,848,972 bp
  • T to C, chromosome 9 at 39,394,222 bp
  • T to C, chromosome 9 at 44,134,706 bp
  • T to C, chromosome 9 at 44,694,362 bp
  • T to A, chromosome 9 at 53,458,983 bp
  • C to A, chromosome 9 at 59,633,538 bp
  • T to G, chromosome 9 at 120,016,907 bp
  • A to G, chromosome 10 at 12,463,339 bp
  • T to C, chromosome 10 at 33,911,636 bp
  • T to A, chromosome 10 at 80,584,026 bp
  • T to C, chromosome 10 at 88,570,568 bp
  • A to G, chromosome 11 at 55,223,672 bp
  • A to G, chromosome 11 at 59,073,633 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to G, chromosome 11 at 102,200,516 bp
  • A to T, chromosome 12 at 81,722,226 bp
  • A to C, chromosome 12 at 108,875,741 bp
  • A to T, chromosome 13 at 11,700,371 bp
  • T to G, chromosome 13 at 24,871,396 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • A to C, chromosome 14 at 32,552,561 bp
  • T to C, chromosome 15 at 75,947,911 bp
  • CCTTCTTCTTCTTCTTCTTCTT to CCTTCTTCTTCTTCTTCTT, chromosome 15 at 80,261,049 bp
  • T to C, chromosome 15 at 101,813,973 bp
  • C to T, chromosome 16 at 33,940,562 bp
  • T to A, chromosome 16 at 36,966,222 bp
  • G to T, chromosome 16 at 76,292,890 bp
  • T to C, chromosome 17 at 20,356,513 bp
  • T to C, chromosome 17 at 20,419,185 bp
  • A to T, chromosome 17 at 25,102,738 bp
  • G to A, chromosome 17 at 34,590,754 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • G to A, chromosome 18 at 20,591,880 bp
  • T to A, chromosome 18 at 80,079,825 bp
  • T to C, chromosome 19 at 50,228,309 bp
  • A to T, chromosome Y at 1,367,093 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1783 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039814-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.