Strain Name:
Stock Number:
Citation ID:
Other Names:
R1784 (G1), C57BL/6J-MtgxR1784Btlr
Major Collection:

Strain Information

Name: tripartite motif-containing 32
Synonyms: 3f3, 1810045E12Rik, Zfp117, BBS11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69807
Homologene: 36327
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
Homologene: 6107
Name: cholinergic receptor, nicotinic, alpha polypeptide 6
Synonyms: Acra6, alpha6 nAChR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11440
Homologene: 20888
Name: paired related homeobox 1
Synonyms: K-2, Prx1, mHox, Pmx1, mHox, A230024N07Rik, MHox1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18933
Homologene: 7896
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56486
Homologene: 134119
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Name: peptidylprolyl isomerase (cyclophilin)-like 2
Synonyms: C130078A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66053
Homologene: 8643
Name: cyclin-dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18557
Homologene: 1949
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: Ftf, LRH-1, D1Ertd308e, UF2-H3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26424
Homologene: 20827
Name: DEAD box helicase 10
Synonyms: 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 77591
Homologene: 20922
Name: chemokine (C-X-C motif) receptor 4
Synonyms: PB-CKR, fusin, CD184, Cmkar4, Sdf1r, b2b220Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12767
Homologene: 20739
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105689
Homologene: 9005
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106585
Homologene: 9059
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382034
Homologene: 40964
Name: SLAIN motif family, member 2
Synonyms: 8030444K12Rik, 5033405K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75991
Homologene: 18952
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68743
Homologene: 41281
Name: zinc finger CCCH type containing 11A
Synonyms: 1110003F06Rik, 5730454B08Rik, G630041M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70579
Homologene: 8888
Name: LIM domain and actin binding 1
Synonyms: 1110021C24Rik, 3526402A12Rik, epithelial protein lost in neoplasm, EPLIN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 65970
Homologene: 9484
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Name: karyopherin (importin) alpha 3
Synonyms: IPOA4, importin alpha 4, importin alpha 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16648
VEGA: 14
Homologene: 20520
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67886
Homologene: 18927
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12847
Homologene: 3218
Name: tetratricopeptide repeat domain 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd-1, Ssdh1, ALDH4, A930035F14Rik, Ahd1, P5CDH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212647
Homologene: 6081
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Name: zinc finger protein 281
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226442
Homologene: 8270
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf-GPI, complement-glycosylphosphatidylinositol, GPI-DAF, Cromer blood group, Daf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
Homologene: 479
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238271
VEGA: 12
Homologene: 15858
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: T200, B220, CD45, Lyt-4, Ly-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
Homologene: 2126
Name: DENN/MADD domain containing 1B
Synonyms: F730008N07Rik, 4632404N19Rik, 4930467M19Rik, 6820401H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329260
Homologene: 11739
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Name: UPF2 regulator of nonsense transcripts homolog (yeast)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 326622
Homologene: 6101
Name: TNF receptor-associated factor 7
Synonyms: RFWD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224619
Homologene: 12998
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18703
Homologene: 1984
Name: kringle containing transmembrane protein 1
Synonyms: Krm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 84035
Homologene: 12935
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235627
Homologene: 86422
Name: biregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 117606
Homologene: 32819
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329252
Homologene: 49680
Name: ribophorin II
Synonyms: Rpn-2, 1300012C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20014
Homologene: 2214
Name: cytotoxic granule-associated RNA binding protein 1
Synonyms: mTIA-1, 2310050N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21841
Homologene: 20692
Name: cyclin-dependent kinase 12
Synonyms: 1810022J16Rik, Crk7, D11Ertd752e, Crkrs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69131
Homologene: 128632
Name: TBC1 domain family, member 19
Synonyms: 2810453K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67249
Homologene: 10130
Name: zinc finger protein 169
Synonyms: 4930429A13Rik, 1700025J14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67911
Homologene: 2572
Name: E74-like factor 2
Synonyms: NERF-2, 2610036A20Rik, A230104O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69257
Homologene: 5006
Name: cytochrome b5 reductase 1
Synonyms: B5R.1, 1500005G05Rik, Nqo3a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72017
Homologene: 96059
Name: family with sequence similarity 72, member A
Synonyms: 2700049P18Rik, P17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108900
Homologene: 82352
Name: tubulin, gamma complex associated protein 2
Synonyms: 1700022B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74237
Homologene: 55980
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67313
Homologene: 10103
Name: ubiquitin specific peptidase 42
Synonyms: 3110031A07Rik, 2410140K03Rik, D5Ertd591e, A630018G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76800
Homologene: 35425
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Name: kinesin family member 18B
Synonyms: N-8 kinesin, 3000004C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70218
Homologene: 15214
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269700
Homologene: 28297
Name: tumor necrosis factor receptor superfamily, member 25
Synonyms: WSL-1, Wsl, APO-3, TR3, DDR3, WSL-LR, LARD, TRAMP, DR3, Tnfrsf12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 85030
Homologene: 13202
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
Homologene: 135710
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Name: phosphodiesterase 4B, cAMP specific
Synonyms: dunce, Dpde4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18578
Homologene: 1953
Name: troponin I, skeletal, slow 1
Synonyms: 2700018B22Rik, ssTnI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21952
Homologene: 2462
Name: chloride channel, voltage-sensitive 1
Synonyms: SMCC1, Clc-1, Clc1, NMF355, nmf355
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12723
Homologene: 63
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
Homologene: 8092
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13710
Homologene: 3265
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215615
Homologene: 10628
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100705
Homologene: 74382
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270120
Homologene: 82252
Name: MRG/MORF4L binding protein
Synonyms: 1600027N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 73247
Homologene: 10104
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
Homologene: 72102
Name: CD180 antigen
Synonyms: RP105, Ly78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17079
Homologene: 4077
Name: phosphodiesterase 5A, cGMP-specific
Synonyms: PDE5A1, Pde5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242202
Homologene: 842
Name: sucrase isomaltase (alpha-glucosidase)
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69983
Homologene: 37424
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17164
Homologene: 56412
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 192188
Homologene: 23022
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70417
Homologene: 23771
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
Homologene: 20357
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12292
Homologene: 37257
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: 1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
Homologene: 66200
Name: mitochondrial ribosomal protein L3
Synonyms: 5930422H18Rik, 2010320L16Rik, dcr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 94062
Homologene: 31431
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53311
Homologene: 3661
Name: predicted gene 12887
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 666927
Homologene: 111034
Name: solute carrier family 22 (organic cation transporter), member 5
Synonyms: Octn2, Lstpl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20520
Homologene: 68295
Name: otoancorin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 246190
Homologene: 71803
Name: cathepsin E
Synonyms: CE, CatE, A430072O03Rik, C920004C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
Homologene: 37551
Name: RAD50 interactor 1
Synonyms: 2810450M21Rik, 1500019C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72772
Homologene: 11070
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11630
Homologene: 18168
Name: chitinase-like 1
Synonyms: Brp39, Gp39, Chi3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12654
Homologene: 55569
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 620928
Homologene: 115466
Name: NADH:ubiquinone oxidoreductase subunit B5
Synonyms: 0610007D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66046
Homologene: 31093
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76422
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Name: olfactory receptor family 8 subfamily B member 12I
Synonyms: GA_x6K02T2PVTD-13912679-13911744, MOR141-1, Olfr870
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 57251
Homologene: 138319
Name: cell wall biogenesis 43 C-terminal homolog
Synonyms: C130090K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231293
Homologene: 5474
Name: RAB7B, member RAS oncogene family
Synonyms: Rab7b, 5430435G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226421
Homologene: 64833
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: rabenosyn, RAB effector
Synonyms: 5330426D11Rik, Rabenosyn-5, Zfyve20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78287
Homologene: 41477
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Name: ITPR interacting domain containing 1
Synonyms: D530004J12Rik, Ccdc129
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232016
Homologene: 52344
Name: DEAD box helicase 59
Synonyms: 4833411G06Rik, 1210002B07Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67997
Homologene: 12222
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Name: TBC1 domain family, member 31
Synonyms: LOC210544, D330013L20Rik, Wdr67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 210544
Homologene: 17089
Name: transmembrane 9 superfamily member 1
Synonyms: MP70, 1200014D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74140
Homologene: 4671
Name: F-box and leucine-rich repeat protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 30840
VEGA: 15
Homologene: 8130
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215798
Homologene: 10724
Name: guanylate kinase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14923
Homologene: 665
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 626596
Homologene: 75047
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
Homologene: 20086
Name: renin 1 structural
Synonyms: Ren1d, Ren-A, Rn-1, Ren, Rnr, Ren-1, Ren1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
Homologene: 20151
Name: rosbin, round spermatid basic protein 1
Synonyms: C230004D03Rik, Rsbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229675
Homologene: 10154
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73647
Homologene: 38208
Name: keratin 23
Synonyms: K23, CK23, Krt1-23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 94179
Homologene: 9172
Name: vascular cell adhesion molecule 1
Synonyms: CD106, Vcam-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22329
Homologene: 838
Name: coiled-coil domain containing 186
Synonyms: Otg1, 1810028B20Rik, A630007B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 213993
Homologene: 9963
Name: cystathionine beta-synthase
Synonyms: HIP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12411
Homologene: 37258
Name: adaptor-related protein complex AP-1, mu subunit 1
Synonyms: AP47, mu1A, [m]1A, Adtm1A, Cltnm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11767
Homologene: 4017
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
Synonyms: AU023434
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233332
Homologene: 16373
Name: protocadherin beta 3
Synonyms: PcdhbC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93874
Homologene: 115665
Name: vomeronasal 2, receptor 81
Synonyms: pheromone recepter, EC1-VR2, V2rf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216144
Homologene: 83483
Name: zinc finger, BED type containing 6
Synonyms: similar to Zinc finger BED domain containing protein 4, Gm8466, MGR, Gm38394
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 667118
Homologene: 130066
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240754
Homologene: 49504
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms: ADAM-TS5, 9530092O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 23794
VEGA: 16
Homologene: 5109
Name: MAS-related GPR, member A2B
Synonyms: MrgA2, Mrgpra2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 235712
Homologene: 79615
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22789
Homologene: 7609
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240752
Homologene: 20582
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: LC-PTP, BPTP-4, C920001D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320139
Homologene: 15411
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93689
Homologene: 8118
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20668
Homologene: 4159
Name: proprotein convertase subtilisin/kexin type 4
Synonyms: PC4, SPC5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18551
Homologene: 22495
Name: NADH:ubiquinone oxidoreductase complex assembly factor 7
Synonyms: 2410091C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 73694
VEGA: 17
Homologene: 12508
Name: ATPase, H+ transporting, lysosomal accessory protein 1-like
Synonyms: EG435376
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 435376
Homologene: 28130
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Synonyms: SK1, Asapk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23971
Homologene: 81740
Name: POTE ankyrin domain family member 1
Synonyms: Pote1, 4930430A15Rik, A26c3, Potea
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67575
Homologene: 69410
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64214
Homologene: 11281
Name: RIKEN cDNA 4930453N24 gene
Synonyms: din
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67609
Homologene: 27867
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Name: polypeptide N-acetylgalactosaminyltransferase 17
Synonyms: E330012B09Rik, Gcap8, Galnt19, Wbscr17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 212996
Homologene: 49707
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71884
Homologene: 68318
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
Homologene: 8652
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
Homologene: 2041
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
Name: HEAT repeat containing 4
Synonyms: Gm17673
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 101055670
Homologene: 45728
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64435
Homologene: 12929
Name: ethanolamine kinase 2
Synonyms: 4933417N20Rik, Eki2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214253
Homologene: 10072
Name: olfactory receptor family 2 subfamily F member 1
Synonyms: GA_x6K02T2P3E9-4815856-4814903, MOR257-8P, Olfr453
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
Homologene: 128151
Name: aldo-keto reductase family 1, member C12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 622402
Homologene: 121208
Name: Fc fragment of IgM receptor
Synonyms: 1810037B05Rik, FcmuR, Faim3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69169
Homologene: 48347
Name: PIN2/TERF1 interacting, telomerase inhibitor 1
Synonyms: LPTS, 2210403I16Rik, 2610028A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 72400
VEGA: 14
Homologene: 134540
Name: ladinin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16763
Homologene: 4059
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215714
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226422
Homologene: 20842
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: mOST-PTP, Esp, OST-PTP, OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Name: glutaredoxin 2 (thioltransferase)
Synonyms: 1700010P22Rik, Grx2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69367
Homologene: 41098
Name: bolA-like 1 (E. coli)
Synonyms: 1810037G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69168
Homologene: 41103
Name: predicted gene 10563
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Name: recombination signal binding protein for immunoglobulin kappa J region-like
Synonyms: RBP-J kappa-like, RBP-L, Rbpsuhl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19668
Homologene: 7512
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,486,756 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • C to A, chromosome 1 at 131,766,012 bp
  • C to T, chromosome 1 at 131,766,038 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • A to C, chromosome 1 at 133,356,457 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • G to C, chromosome 1 at 133,359,445 bp
  • A to T, chromosome 1 at 133,359,983 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • C to T, chromosome 1 at 133,363,890 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to T, chromosome 1 at 133,377,046 bp
  • A to G, chromosome 1 at 133,387,076 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • A to G, chromosome 1 at 134,149,394 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • T to G, chromosome 1 at 134,313,731 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,450,094 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • A to G, chromosome 1 at 136,160,121 bp
  • T to C, chromosome 1 at 136,160,292 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,739,740 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • T to A, chromosome 1 at 163,261,967 bp
  • T to A, chromosome 1 at 172,111,987 bp
  • A to T, chromosome 2 at 6,027,450 bp
  • T to A, chromosome 2 at 111,170,357 bp
  • T to C, chromosome 2 at 157,289,521 bp
  • T to C, chromosome 2 at 164,408,108 bp
  • T to A, chromosome 2 at 180,585,449 bp
  • T to C, chromosome 3 at 32,744,840 bp
  • A to T, chromosome 3 at 51,257,572 bp
  • A to T, chromosome 3 at 72,965,645 bp
  • C to T, chromosome 3 at 96,197,110 bp
  • T to G, chromosome 3 at 103,961,589 bp
  • T to A, chromosome 3 at 116,114,515 bp
  • G to T, chromosome 3 at 122,748,240 bp
  • A to G, chromosome 3 at 131,605,967 bp
  • T to A, chromosome 4 at 65,614,397 bp
  • T to C, chromosome 4 at 102,605,260 bp
  • T to A, chromosome 4 at 121,616,518 bp
  • A to G, chromosome 4 at 139,644,161 bp
  • T to A, chromosome 4 at 152,118,304 bp
  • C to T, chromosome 4 at 155,635,880 bp
  • T to A, chromosome 5 at 23,809,843 bp
  • T to G, chromosome 5 at 53,829,372 bp
  • A to G, chromosome 5 at 72,957,614 bp
  • T to C, chromosome 5 at 73,408,218 bp
  • TGGGG to TGGG, chromosome 5 at 114,209,767 bp
  • A to T, chromosome 5 at 121,301,839 bp
  • A to T, chromosome 5 at 131,150,963 bp
  • T to C, chromosome 5 at 143,714,626 bp
  • T to A, chromosome 6 at 42,299,514 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 55,968,541 bp
  • C to T, chromosome 6 at 86,413,915 bp
  • A to T, chromosome 6 at 92,190,019 bp
  • A to G, chromosome 7 at 47,464,879 bp
  • C to T, chromosome 7 at 67,149,956 bp
  • T to C, chromosome 7 at 85,857,878 bp
  • T to C, chromosome 7 at 121,125,439 bp
  • T to C, chromosome 7 at 139,998,055 bp
  • A to T, chromosome 8 at 27,406,784 bp
  • T to A, chromosome 8 at 72,252,849 bp
  • G to A, chromosome 8 at 120,568,253 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • A to C, chromosome 9 at 15,996,315 bp
  • A to T, chromosome 9 at 20,170,913 bp
  • C to T, chromosome 9 at 22,358,604 bp
  • T to A, chromosome 9 at 53,240,552 bp
  • C to T, chromosome 9 at 105,057,067 bp
  • T to A, chromosome 9 at 110,630,857 bp
  • T to C, chromosome 10 at 14,439,782 bp
  • T to A, chromosome 10 at 44,004,019 bp
  • C to A, chromosome 10 at 79,270,655 bp
  • T to C, chromosome 10 at 80,323,570 bp
  • T to G, chromosome 10 at 86,938,039 bp
  • GGG to GGGTGG, chromosome 11 at 5,201,792 bp
  • G to A, chromosome 11 at 53,866,351 bp
  • A to T, chromosome 11 at 59,185,312 bp
  • G to A, chromosome 11 at 66,085,020 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to C, chromosome 11 at 98,249,970 bp
  • A to T, chromosome 11 at 99,492,964 bp
  • A to G, chromosome 11 at 102,915,541 bp
  • C to T, chromosome 11 at 118,069,519 bp
  • T to C, chromosome 12 at 75,137,691 bp
  • T to C, chromosome 12 at 83,967,572 bp
  • T to C, chromosome 13 at 4,274,340 bp
  • C to T, chromosome 13 at 48,489,819 bp
  • T to C, chromosome 13 at 76,139,479 bp
  • T to A, chromosome 13 at 90,905,281 bp
  • T to C, chromosome 13 at 102,705,859 bp
  • G to T, chromosome 14 at 55,641,591 bp
  • T to A, chromosome 14 at 61,367,701 bp
  • A to G, chromosome 14 at 63,878,110 bp
  • A to T, chromosome 14 at 103,155,178 bp
  • T to A, chromosome 15 at 36,087,436 bp
  • T to A, chromosome 15 at 57,963,920 bp
  • C to T, chromosome 15 at 76,538,058 bp
  • G to T, chromosome 15 at 99,780,463 bp
  • C to G, chromosome 16 at 17,089,419 bp
  • T to C, chromosome 16 at 44,496,419 bp
  • T to C, chromosome 16 at 64,769,022 bp
  • T to A, chromosome 16 at 85,877,915 bp
  • A to G, chromosome 17 at 24,512,379 bp
  • G to T, chromosome 17 at 31,620,949 bp
  • G to T, chromosome 17 at 65,984,076 bp
  • A to T, chromosome 17 at 78,937,629 bp
  • G to A, chromosome 18 at 37,301,878 bp
  • T to C, chromosome 18 at 57,240,792 bp
  • A to C, chromosome 19 at 56,809,220 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1784 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039815-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.