Strain Name:
Stock Number:
Citation ID:
Other Names:
R1785 (G1), C57BL/6J-MtgxR1785Btlr
Major Collection:

Gene Information

Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18763
VEGA: 17
Homologene: 250
Name: LIM homeobox protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16874
Homologene: 7401
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
Homologene: 6107
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18213
Homologene: 49183
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14048
Homologene: 74943
Name: engrailed 1
Synonyms: Mo-en.1, En-1, engrailed-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13798
Homologene: 50663
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56486
Homologene: 134119
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
Homologene: 31279
Name: ENAH actin regulator
Synonyms: Mena, Ndpp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13800
Homologene: 134005
Name: chromobox 5
Synonyms: heterochromatin protein 1 alpha, HP1a, Hp1a, 2610029O15Rik, HP1, Hp1alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12419
Homologene: 7257
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Rb-Bp2, Plu1, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
Homologene: 12725
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 17454
Homologene: 10365
Name: synaptotagmin IV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 20983
VEGA: 18
Homologene: 7559
Name: sphingosine phosphate lyase 1
Synonyms: D10Xrf456
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20397
Homologene: 2897
Name: cyclin-dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18557
Homologene: 1949
Name: motor neuron and pancreas homeobox 1
Synonyms: HB9, MNR2, Hlxb9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15285
Homologene: 21137
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: Ftf, LRH-1, D1Ertd308e, UF2-H3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26424
Homologene: 20827
Name: chemokine (C-X-C motif) receptor 4
Synonyms: PB-CKR, fusin, CD184, Cmkar4, Sdf1r, b2b220Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12767
Homologene: 20739
Name: diazepam binding inhibitor
Synonyms: diazepam-binding inhibitor, Acbp, EP, endozepine
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13167
Homologene: 39086
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71517
Homologene: 10659
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain II-B, NMHC-B, SMemb, nonmuscle myosin heavy chain IIB, 9330167F11Rik, 5730504C04Rik, NMHC II-B, Myhn2, Myosin IIB, Myhn-2, myosin IIB, Fltn, Fltn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 77579
Homologene: 55941
Name: peroxisome proliferator activator receptor delta
Synonyms: Nr1c2, PPARdelta/beta, Pparb, Peroxisome proliferator-activated receptor beta, NUC1, PPAR-delta, Pparb/d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19015
Homologene: 4544
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68743
Homologene: 41281
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69719
Homologene: 1412
Name: trafficking protein particle complex 8
Synonyms: 5033403J15Rik, D030074E01Rik, Trs85
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 75964
VEGA: 18
Homologene: 40993
Name: coiled-coil domain containing 93
Synonyms: 9230102M16Rik, 4633402D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70829
Homologene: 10393
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214162
Homologene: 4338
Name: A kinase (PRKA) anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
Homologene: 4903
Name: zinc finger CCCH type containing 11A
Synonyms: 1110003F06Rik, 5730454B08Rik, G630041M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70579
Homologene: 8888
Name: signal transducer and activator of transcription 3
Synonyms: Aprf, 1110034C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20848
Homologene: 7960
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239273
VEGA: 14
Homologene: 74563
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231876
Homologene: 8948
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67886
Homologene: 18927
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17345
Homologene: 1814
Name: VPS26 retromer complex component A
Synonyms: HB58, H beta 58, Vps26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 30930
VEGA: 10
Homologene: 68420
Name: cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms: C130030P16Rik, 8430414L16Rik, Hrpt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214498
Homologene: 11571
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd-1, Ssdh1, ALDH4, A930035F14Rik, Ahd1, P5CDH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212647
Homologene: 6081
Name: dynactin 4
Synonyms: p62, 4930547K17Rik, 1110001K06Rik, C130039E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67665
VEGA: 18
Homologene: 9430
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67772
Homologene: 72405
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, Tacc1, B230378H13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 320165
Homologene: 4575
Name: DEAD box helicase 18
Synonyms: 2310005B10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66942
Homologene: 6697
Name: trafficking protein particle complex 10
Synonyms: LOC380642, B230307C21Rik, Tmem1, b2b2613Clo, b2b2416Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216131
VEGA: 10
Homologene: 37751
Name: ankyrin repeat and SOCS box-containing 6
Synonyms: 2510004M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72323
Homologene: 9895
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Name: zinc finger, DHHC domain containing 13
Synonyms: kojak, 2410004E01Rik, Hip14l, skc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243983
Homologene: 75106
Name: zinc finger protein 281
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226442
Homologene: 8270
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf-GPI, complement-glycosylphosphatidylinositol, GPI-DAF, Cromer blood group, Daf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
Homologene: 479
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108073
Homologene: 20233
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: T200, B220, CD45, Lyt-4, Ly-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
Homologene: 2126
Name: Rho GTPase activating protein 23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 58996
Homologene: 104145
Name: DENN/MADD domain containing 1B
Synonyms: F730008N07Rik, 4632404N19Rik, 4930467M19Rik, 6820401H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329260
Homologene: 11739
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666173
VEGA: 15
Homologene: 49516
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Name: lectin, mannose-binding, 1
Synonyms: ERGIC53, MCFD1, F5F8D, gp58, MR60, 2610020P13Rik, P58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70361
Homologene: 4070
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18703
Homologene: 1984
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234736
Homologene: 41230
Name: G protein-coupled estrogen receptor 1
Synonyms: 6330420K13Rik, Ceprl, GPCR-Br, CMKRL2, FEG-1, Gper, Gpr30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76854
Homologene: 15855
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27385
Homologene: 8460
Name: cadherin 19, type 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227485
Homologene: 23286
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329252
Homologene: 49680
Name: LIF receptor alpha
Synonyms: soluble differentiation-stimulating factor receptor, A230075M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16880
VEGA: 15
Homologene: 1735
Name: pre B cell leukemia homeobox 1
Synonyms: Pbx-1, D230003C07Rik, 2310056B04Rik, Pbx1a, Pbx1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18514
Homologene: 20574
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13417
VEGA: 17
Homologene: 1049
Name: centriolin
Synonyms: IB3/5, 6720467O09Rik, Ma2a8, Cep1, b2b1468Clo, Cep110
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26920
Homologene: 38260
Name: NOP9 nucleolar protein
Synonyms: 2610027L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67842
Homologene: 41678
Name: cytochrome b5 reductase 1
Synonyms: B5R.1, 1500005G05Rik, Nqo3a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72017
Homologene: 96059
Name: family with sequence similarity 72, member A
Synonyms: 2700049P18Rik, P17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108900
Homologene: 82352
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67313
Homologene: 10103
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 329002
Homologene: 7198
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Name: tripartite motif-containing 33
Synonyms: Tif1g, 8030451N04Rik, ectodermin, Ecto
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 94093
Homologene: 9296
Name: DGCR8, microprocessor complex subunit
Synonyms: N41, D16H22S788E, D16Wis2, Gy1, D16H22S1742E, Vo59c07, DiGeorge syndrome critical region gene 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 94223
Homologene: 11223
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: NHE4, D730009J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 110895
Homologene: 72232
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
Homologene: 135710
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68428
Homologene: 10084
Name: T-box 1
Synonyms: nmf219
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 21380
VEGA: 16
Homologene: 7966
Name: calpain 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268958
Homologene: 21392
Name: troponin I, skeletal, slow 1
Synonyms: 2700018B22Rik, ssTnI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21952
Homologene: 2462
Name: histocompatibility 2, K1, K region
Synonyms: H-2K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14972
Homologene: 128352
Name: cellular communication network factor 4
Synonyms: Elm1, CCN4, Wisp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 22402
Homologene: 2883
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78249
Homologene: 51953
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1537Clo, b2b1565Clo, b2b1154Clo, b2b1134Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110082
Homologene: 1048
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: UDP-glucose glycoprotein glucosyltransferase 2
Synonyms: 3110001A05Rik, 1810064L21Rik, 3110027P15Rik, A230065J02Rik, Ugcgl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66435
Homologene: 56875
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
Homologene: 8092
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13710
Homologene: 3265
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215615
Homologene: 10628
Name: forkhead box N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 116810
Homologene: 17526
Name: contactin associated protein-like 5C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23920
Homologene: 56539
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17164
Homologene: 56412
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319229
Homologene: 68290
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20271
Homologene: 22738
Name: SREBF chaperone
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235623
Homologene: 8160
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241201
Homologene: 68391
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12292
Homologene: 37257
Name: neurochondrin
Synonyms: neurochondrin-2, neurochondrin-1, norbin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26562
Homologene: 8064
Name: myosin VIIB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17922
Homologene: 81947
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: 1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
Homologene: 66200
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18186
Homologene: 2876
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53311
Homologene: 3661
Name: cathepsin E
Synonyms: CE, CatE, A430072O03Rik, C920004C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
Homologene: 37551
Name: receptor-interacting serine-threonine kinase 4
Synonyms: PKK, DIk, RIP4, ANKK2, Ankrd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 72388
Homologene: 10772
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71724
Homologene: 90899
Name: chitinase-like 1
Synonyms: Brp39, Gp39, Chi3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12654
Homologene: 55569
Name: olfactory receptor family 5 subfamily K member 3
Synonyms: GA_x54KRFPKG5P-55369823-55370749, MOR184-5, Olfr195
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 259000
Homologene: 128109
Name: F-box and WD-40 domain protein 10
Synonyms: SM2SH2, SM25H2, Fbw10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 213980
Homologene: 32757
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76422
Name: RAR-related orphan receptor alpha
Synonyms: Nr1f1, 9530021D13Rik, tmgc26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19883
Homologene: 56594
Name: myeloperoxidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17523
Homologene: 55450
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 64899
Homologene: 84844
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241197
Homologene: 68430
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70381
Homologene: 9120
Name: olfactory receptor family 2 subfamily Z member 8
Synonyms: GA_x6K02T2NUPS-191522-192466, MOR282-1, Olfr372
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 404315
Homologene: 17287
Name: zinc finger and BTB domain containing 46
Synonyms: 4933406L05Rik, 2610019F01Rik, Btbd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72147
Homologene: 81908
Name: RAB7B, member RAS oncogene family
Synonyms: Rab7b, 5430435G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226421
Homologene: 64833
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Name: vomeronasal 2, receptor 55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100042499
Homologene: 104040
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230872
Homologene: 16811
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 104015
Homologene: 48252
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319901
Homologene: 12964
Name: keratin associated protein 16-1
Synonyms: AI450886
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100504183
Homologene: 99988
Name: DEAD box helicase 59
Synonyms: 4833411G06Rik, 1210002B07Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67997
Homologene: 12222
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Name: Ndufa4, mitochondrial complex associated
Synonyms: MLRQ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17992
Homologene: 37629
Name: acyloxyacyl hydrolase
Synonyms: 4930433E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 27052
VEGA: 13
Homologene: 1238
Name: complement component factor h
Synonyms: Mud-1, Sas-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
Homologene: 20086
Name: PHD finger protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18676
VEGA: 13
Homologene: 3934
Name: acyl-CoA thioesterase 11
Synonyms: BFIT1, 2010309H15Rik, Them1, 1110020M10Rik, Thea
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329910
Homologene: 11977
Name: renin 1 structural
Synonyms: Ren1d, Ren-A, Rn-1, Ren, Rnr, Ren-1, Ren1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
Homologene: 20151
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: Spi8, NK10, ovalbumin, CAP-2, CAP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20725
Homologene: 74445
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73647
Homologene: 38208
Name: phospholipase A2, group VI
Synonyms: iPLA2, iPLA2beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 53357
Homologene: 2635
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 636808
Homologene: 43974
Name: Fas death domain-associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13163
Homologene: 1033
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms: 5730527A11Rik, Nhe9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 331004
Homologene: 69753
Name: xin actin-binding repeat containing 1
Synonyms: Xin, mXin alpha, Cmya1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22437
Homologene: 7998
Name: TXK tyrosine kinase
Synonyms: Rlk, Btkl, PTK4, A130089B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22165
Homologene: 2497
Name: tripartite motif-containing 41
Synonyms: RINCK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 211007
Homologene: 14140
Name: protein phosphatase 1F (PP2C domain containing)
Synonyms: 4933427B07Rik, 1110021B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 68606
Homologene: 22828
Name: olfactory receptor family 4 subfamily A member 68
Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8, Olfr1240
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
Name: zinc finger, BED type containing 6
Synonyms: similar to Zinc finger BED domain containing protein 4, Gm8466, MGR, Gm38394
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 667118
Homologene: 130066
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240754
Homologene: 49504
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22789
Homologene: 7609
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240752
Homologene: 20582
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: LC-PTP, BPTP-4, C920001D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320139
Homologene: 15411
Name: protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms: 70zpep, Ptpn8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19260
Homologene: 7498
Name: dihydropyrimidinase-like 2
Synonyms: Ulip2, Crmp2, TOAD-64, DRP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12934
Homologene: 74392
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243362
Homologene: 64844
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93689
Homologene: 8118
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20668
Homologene: 4159
Name: secernin 2
Synonyms: SES2, D11Moh48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217140
Homologene: 26698
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64214
Homologene: 11281
Name: pseudouridylate synthase 7-like
Synonyms: 3000003F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78895
Homologene: 12842
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71884
Homologene: 68318
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
Homologene: 8652
Name: Fas apoptotic inhibitory molecule 2
Synonyms: NMP25, 2900002L20Rik, lifeguard, Lfg, Tmbim2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72393
VEGA: 15
Homologene: 8192
Name: programmed cell death 4
Synonyms: MA-3, TIS, D19Ucla1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18569
VEGA: 19
Homologene: 7879
Name: olfactory receptor family 11 subfamily M member 3
Synonyms: GA_x6K02T2NBG7-5241885-5241019, GA_x6K02T04SN1-554-3, MOR122-1, Olfr234, Olfr279
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 258502
Homologene: 74008
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
Homologene: 2041
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258952
Homologene: 74160
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19214
Homologene: 736
Name: methyltransferase like 17
Synonyms: 2310032K15Rik, D14Ertd209e, Mett11d1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 52535
Homologene: 11226
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64435
Homologene: 12929
Name: ethanolamine kinase 2
Synonyms: 4933417N20Rik, Eki2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214253
Homologene: 10072
Name: family with sequence similarity 221, member B
Synonyms: 4930412F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242408
Homologene: 52184
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18788
Homologene: 20571
Name: colony stimulating factor 1 receptor
Synonyms: CSF-1R, M-CSFR, CD115, Fim-2, Fms, Csfmr, Fim2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12978
Homologene: 3817
Name: Fc fragment of IgM receptor
Synonyms: 1810037B05Rik, FcmuR, Faim3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69169
Homologene: 48347
Name: golgi integral membrane protein 4
Synonyms: GPP130, P138, 3110027H23Rik, Golph4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73124
Homologene: 8716
Name: predicted gene 8374
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Name: epilepsy, progressive myoclonic epilepsy, type 2 gene alpha
Synonyms: laforin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13853
Homologene: 38087
Name: G protein-coupled receptor 132
Synonyms: G2 accumulation, G2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 56696
VEGA: 12
Homologene: 8350
Name: ladinin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16763
Homologene: 4059
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215714
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226422
Homologene: 20842
Name: KiSS-1 metastasis-suppressor
Synonyms: metastin, kisspeptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 280287
Homologene: 1701
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: mOST-PTP, Esp, OST-PTP, OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Name: G protein-coupled receptor 25
Synonyms: LOC383563
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 383563
Homologene: 3872
Name: glutaredoxin 2 (thioltransferase)
Synonyms: 1700010P22Rik, Grx2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69367
Homologene: 41098
Name: predicted gene 10563
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 14,170,974 bp
  • T to G, chromosome 1 at 40,607,741 bp
  • A to G, chromosome 1 at 58,169,843 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • CAT to CATTAT, chromosome 1 at 115,900,919 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • A to G, chromosome 1 at 118,855,424 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to T, chromosome 1 at 120,063,246 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • C to T, chromosome 1 at 120,120,108 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 120,603,621 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • C to T, chromosome 1 at 130,804,529 bp
  • A to G, chromosome 1 at 130,804,569 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • C to A, chromosome 1 at 131,766,012 bp
  • C to T, chromosome 1 at 131,766,038 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • A to T, chromosome 1 at 133,359,983 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • A to G, chromosome 1 at 133,363,923 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to A, chromosome 1 at 133,387,071 bp
  • A to G, chromosome 1 at 133,387,076 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • G to C, chromosome 1 at 135,283,977 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • TCC to TCCGCC, chromosome 1 at 135,386,281 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • A to C, chromosome 1 at 135,819,031 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to T, chromosome 1 at 136,070,627 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • T to C, chromosome 1 at 136,160,292 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • G to A, chromosome 1 at 136,260,710 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • T to C, chromosome 1 at 140,136,788 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • AAAATAA to AAAATAAAAATAA, chromosome 1 at 143,686,014 bp
  • C to T, chromosome 1 at 143,739,740 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • G to T, chromosome 1 at 150,604,831 bp
  • T to G, chromosome 1 at 168,431,378 bp
  • A to T, chromosome 1 at 181,956,429 bp
  • G to A, chromosome 2 at 30,827,076 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • G to T, chromosome 2 at 36,087,458 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • A to C, chromosome 2 at 76,885,926 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • T to A, chromosome 2 at 135,325,667 bp
  • T to A, chromosome 2 at 160,896,809 bp
  • C to T, chromosome 2 at 181,391,431 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • AGACTG to A, chromosome 3 at 103,329,220 bp
  • A to G, chromosome 3 at 103,874,052 bp
  • A to T, chromosome 3 at 104,818,116 bp
  • T to A, chromosome 4 at 43,665,537 bp
  • T to C, chromosome 4 at 106,762,035 bp
  • T to A, chromosome 4 at 126,745,273 bp
  • T to A, chromosome 4 at 139,423,945 bp
  • T to C, chromosome 4 at 139,644,128 bp
  • T to C, chromosome 4 at 141,021,802 bp
  • C to T, chromosome 4 at 155,635,880 bp
  • T to A, chromosome 5 at 29,474,189 bp
  • T to A, chromosome 5 at 31,058,072 bp
  • T to A, chromosome 5 at 72,696,579 bp
  • C to T, chromosome 5 at 114,263,132 bp
  • C to T, chromosome 5 at 139,426,722 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • T to C, chromosome 5 at 151,045,168 bp
  • A to T, chromosome 6 at 11,900,575 bp
  • G to C, chromosome 6 at 111,358,295 bp
  • A to T, chromosome 7 at 12,668,184 bp
  • T to A, chromosome 7 at 48,824,644 bp
  • A to T, chromosome 7 at 62,377,738 bp
  • G to T, chromosome 7 at 75,611,434 bp
  • G to A, chromosome 7 at 78,477,935 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • T to A, chromosome 7 at 135,704,241 bp
  • A to T, chromosome 8 at 25,164,493 bp
  • A to G, chromosome 8 at 72,058,436 bp
  • A to T, chromosome 8 at 111,297,402 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • A to T, chromosome 8 at 128,498,516 bp
  • C to T, chromosome 9 at 22,358,604 bp
  • G to A, chromosome 9 at 44,819,675 bp
  • G to A, chromosome 9 at 69,376,837 bp
  • A to T, chromosome 9 at 95,019,193 bp
  • C to T, chromosome 9 at 110,374,055 bp
  • A to T, chromosome 9 at 119,521,129 bp
  • T to G, chromosome 9 at 120,016,907 bp
  • G to A, chromosome 10 at 5,346,808 bp
  • A to G, chromosome 10 at 11,343,682 bp
  • G to T, chromosome 10 at 61,105,535 bp
  • A to T, chromosome 10 at 62,468,397 bp
  • A to G, chromosome 10 at 78,197,872 bp
  • C to A, chromosome 11 at 48,807,592 bp
  • T to A, chromosome 11 at 62,859,857 bp
  • A to G, chromosome 11 at 68,807,289 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to G, chromosome 11 at 87,797,361 bp
  • G to A, chromosome 11 at 97,033,309 bp
  • A to G, chromosome 11 at 97,451,561 bp
  • A to T, chromosome 11 at 99,985,776 bp
  • A to T, chromosome 11 at 100,894,149 bp
  • T to A, chromosome 12 at 79,268,434 bp
  • A to G, chromosome 12 at 112,852,403 bp
  • C to T, chromosome 13 at 20,910,057 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • T to C, chromosome 13 at 48,817,567 bp
  • T to C, chromosome 14 at 7,364,194 bp
  • A to T, chromosome 14 at 44,858,579 bp
  • A to T, chromosome 14 at 51,888,735 bp
  • A to G, chromosome 14 at 52,222,628 bp
  • T to C, chromosome 14 at 55,751,142 bp
  • A to G, chromosome 14 at 66,862,665 bp
  • G to A, chromosome 14 at 118,553,349 bp
  • A to G, chromosome 14 at 119,061,376 bp
  • A to G, chromosome 15 at 7,181,856 bp
  • A to G, chromosome 15 at 28,313,786 bp
  • A to G, chromosome 15 at 35,879,791 bp
  • G to A, chromosome 15 at 66,906,489 bp
  • T to C, chromosome 15 at 79,306,345 bp
  • T to C, chromosome 15 at 94,540,637 bp
  • A to T, chromosome 15 at 98,497,835 bp
  • A to G, chromosome 15 at 99,512,542 bp
  • G to A, chromosome 15 at 103,213,124 bp
  • A to G, chromosome 16 at 16,910,970 bp
  • G to A, chromosome 16 at 18,280,505 bp
  • A to C, chromosome 16 at 18,585,129 bp
  • A to G, chromosome 16 at 59,149,297 bp
  • G to T, chromosome 16 at 90,964,517 bp
  • A to C, chromosome 16 at 97,750,131 bp
  • T to C, chromosome 17 at 24,591,099 bp
  • T to G, chromosome 17 at 28,298,481 bp
  • T to C, chromosome 17 at 30,722,937 bp
  • T to C, chromosome 17 at 33,911,842 bp
  • C to A, chromosome 17 at 33,997,348 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to G, chromosome 17 at 45,638,697 bp
  • A to G, chromosome 17 at 58,162,291 bp
  • A to G, chromosome 18 at 20,834,940 bp
  • A to G, chromosome 18 at 31,443,443 bp
  • T to C, chromosome 18 at 31,994,897 bp
  • T to C, chromosome 18 at 60,546,335 bp
  • A to T, chromosome 18 at 61,129,077 bp
  • A to T, chromosome 18 at 65,991,582 bp
  • T to C, chromosome 18 at 80,117,308 bp
  • T to C, chromosome 18 at 82,621,304 bp
  • T to G, chromosome 19 at 53,926,326 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1785 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039816-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.