Strain Detail Sheet
Strain Name:
C57BL/6J-MtgxR1786Btlr/Mmmh
Stock Number:
039817-MU
Citation ID:
RRID:MMRRC_039817-MU
Other Names:
R1786 (G1), C57BL/6J-MtgxR1786Btlr
Major Collection:
Lhx6
Name: LIM homeobox protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1306803
NCBI: 16874
Ensembl: ENSMUSG00000026890
VEGA: OTTMUSG00000012098
HGNC: HGNC:21735
Homologene: 7401
UCSC: Chr2:36081950-36105998
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:97385
NCBI: 18213
Ensembl: ENSMUSG00000059146
VEGA: OTTMUSG00000021139
HGNC: HGNC:8033
Homologene: 49183
CCDS: CCDS21371.1, CCDS21372.1
UCSC: Chr7:78179986-78579180
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pygb
Name: brain glycogen phosphorylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:97828
NCBI: 110078
Ensembl: ENSMUSG00000033059
VEGA: OTTMUSG00000015772
HGNC: HGNC:9723
Homologene: 100930
CCDS: CCDS16862.1
UCSC: Chr2:150786796-150831748
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:87854
NCBI: 11287
Ensembl: ENSMUSG00000030359
VEGA: OTTMUSG00000022212
Homologene: 104112
CCDS: CCDS39650.1
UCSC: Chr6:128483567-128526720
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:97054
NCBI: 17454
Ensembl: ENSMUSG00000002227
VEGA: OTTMUSG00000022217
HGNC: HGNC:7200
Homologene: 10365
CCDS: CCDS38579.1, CCDS51033.1
UCSC: Chr3:104794828-104818595
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Syt4
Name: synaptotagmin IV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:101759
NCBI: 20983
Ensembl: ENSMUSG00000024261
VEGA: 18
HGNC: HGNC:11512
Homologene: 7559
CCDS: CCDS29109.1
UCSC: Chr18:31437808-31447415
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:1919311
NCBI: 72061
Ensembl: ENSMUSG00000021458
VEGA: OTTMUSG00000030849
HGNC: HGNC:1361
Homologene: 66273
CCDS: CCDS36699.1
UCSC: Chr13:62964893-63326096
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Plekha1
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Synonyms: TAPP1, C920009D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:2442213
NCBI: 101476
Ensembl: ENSMUSG00000040268
VEGA: OTTMUSG00000029137
HGNC: HGNC:14335
Homologene: 11001
CCDS: CCDS21907.1, CCDS85434.1
UCSC: Chr7:130860556-130913308
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mnx1
Name: motor neuron and pancreas homeobox 1
Synonyms: HB9, MNR2, Hlxb9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:109160
NCBI: 15285
Ensembl: ENSMUSG00000001566
VEGA: OTTMUSG00000037528
HGNC: HGNC:4979
Homologene: 21137
CCDS: CCDS19150.1
UCSC: Chr5:29473823-29478470
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1918767
NCBI: 71517
Ensembl: ENSMUSG00000030982
VEGA: OTTMUSG00000025727
HGNC: HGNC:24641
Homologene: 10659
CCDS: CCDS21776.2
UCSC: Chr7:118740197-118841491
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1916969
NCBI: 69719
Ensembl: ENSMUSG00000013629
VEGA: OTTMUSG00000022393
HGNC: HGNC:1424
Homologene: 1412
UCSC: Chr5:31054696-31078479
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:2384583
NCBI: 235469
Ensembl: ENSMUSG00000038535
VEGA: OTTMUSG00000044709
HGNC: HGNC:25953
Homologene: 17151
CCDS: CCDS40683.1, CCDS81035.1
UCSC: Chr9:72274888-72363779
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Trappc8
Name: trafficking protein particle complex 8
Synonyms: 5033403J15Rik, D030074E01Rik, Trs85
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:2443008
NCBI: 75964
Ensembl: ENSMUSG00000033382
VEGA: 18
HGNC: HGNC:29169
Homologene: 40993
CCDS: CCDS29087.1, CCDS50233.1
UCSC: Chr18:20817216-20896389
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:2448506
NCBI: 224020
Ensembl: ENSMUSG00000041720
VEGA: OTTMUSG00000032611
HGNC: HGNC:8983
Homologene: 11171
CCDS: CCDS37271.1
UCSC: Chr16:17280351-17406314
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:96995
NCBI: 214162
Ensembl: ENSMUSG00000002028
VEGA: OTTMUSG00000021055
HGNC: HGNC:7132
Homologene: 4338
CCDS: CCDS40603.1
UCSC: Chr9:44803355-44881298
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Akap13
Name: A kinase (PRKA) anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:2676556
NCBI: 75547
Ensembl: ENSMUSG00000066406
VEGA: OTTMUSG00000034140
HGNC: HGNC:371
Homologene: 4903
CCDS: CCDS52276.1
UCSC: Chr7:75455508-75754609
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Abcc4
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:2443111
NCBI: 239273
Ensembl: ENSMUSG00000032849
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
CCDS: CCDS27335.1, CCDS49565.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:3036247
NCBI: 231876
Ensembl: ENSMUSG00000038970
VEGA: OTTMUSG00000042434
HGNC: HGNC:17880
Homologene: 8948
CCDS: CCDS39376.1
UCSC: Chr5:144100371-144188204
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:2445054
NCBI: 223870
Ensembl: ENSMUSG00000033075
VEGA: OTTMUSG00000042971
HGNC: HGNC:17927
Homologene: 8731
CCDS: CCDS49717.1
UCSC: Chr15:98038744-98093967
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd-1, Ssdh1, ALDH4, A930035F14Rik, Ahd1, P5CDH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2443883
NCBI: 212647
Ensembl: ENSMUSG00000028737
VEGA: OTTMUSG00000010054
HGNC: HGNC:406
Homologene: 6081
CCDS: CCDS18848.1
UCSC: Chr4:139622871-139649691
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dctn4
Name: dynactin 4
Synonyms: p62, 4930547K17Rik, 1110001K06Rik, C130039E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:1914915
NCBI: 67665
Ensembl: ENSMUSG00000024603
VEGA: 18
HGNC: HGNC:15518
Homologene: 9430
CCDS: CCDS37832.1
UCSC: Chr18:60526159-60558762
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:1915022
NCBI: 67772
Ensembl: ENSMUSG00000053754
VEGA: OTTMUSG00000023392
HGNC: HGNC:20153
Homologene: 72405
CCDS: CCDS36919.1
UCSC: Chr14:52198151-52257807
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, B230378H13Rik, Tacc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:2443510
NCBI: 320165
Ensembl: ENSMUSG00000065954
VEGA: OTTMUSG00000060528
HGNC: HGNC:11522
Homologene: 4575
CCDS: CCDS40302.1, CCDS40303.1
UCSC: Chr8:25154552-25256583
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Asb6
Name: ankyrin repeat and SOCS box-containing 6
Synonyms: 2510004M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1919573
NCBI: 72323
Ensembl: ENSMUSG00000039483
VEGA: OTTMUSG00000011879
HGNC: HGNC:17181
Homologene: 9895
CCDS: CCDS38096.1
UCSC: Chr2:30823097-30828300
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zdhhc13
Name: zinc finger, DHHC domain containing 13
Synonyms: kojak, 2410004E01Rik, Hip14l, skc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1919227
NCBI: 243983
Ensembl: ENSMUSG00000030471
VEGA: OTTMUSG00000030356
HGNC: HGNC:18413
Homologene: 75106
CCDS: CCDS52259.1
UCSC: Chr7:48789003-48827437
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1932915
NCBI: 83431
Ensembl: ENSMUSG00000018736
VEGA: OTTMUSG00000005956
HGNC: HGNC:17620
Homologene: 32567
CCDS: CCDS24870.1
UCSC: Chr11:68821434-68853131
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:1916380
NCBI: 666173
Ensembl: ENSMUSG00000037646
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
CCDS: CCDS49592.1
UCSC: Chr15:35371143-35931229
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1916366
NCBI: 69116
Ensembl: ENSMUSG00000066036
VEGA: OTTMUSG00000009956
HGNC: HGNC:30313
Homologene: 10804
CCDS: CCDS51340.1
UCSC: Chr4:139380659-139489533
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lman1
Name: lectin, mannose-binding, 1
Synonyms: 2610020P13Rik, ERGIC53, MCFD1, F5F8D, gp58, MR60, P58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:1917611
NCBI: 70361
Ensembl: ENSMUSG00000041891
VEGA: OTTMUSG00000030654
HGNC: HGNC:6631
Homologene: 4070
CCDS: CCDS29313.1
UCSC: Chr18:65980739-66002635
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Rfwd3
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:2384584
NCBI: 234736
Ensembl: ENSMUSG00000033596
VEGA: OTTMUSG00000061896
HGNC: HGNC:25539
Homologene: 41230
CCDS: CCDS22672.1
UCSC: Chr8:111270944-111300222
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gper1
Name: G protein-coupled estrogen receptor 1
Synonyms: 6330420K13Rik, Ceprl, GPCR-Br, CMKRL2, FEG-1, Gper, Gpr30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1924104
NCBI: 76854
Ensembl: ENSMUSG00000053647
VEGA: OTTMUSG00000021296
HGNC: HGNC:4485
Homologene: 15855
CCDS: CCDS19811.1
UCSC: Chr5:139422969-139427800
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Magel2
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1351648
NCBI: 27385
Ensembl: ENSMUSG00000056972
VEGA: OTTMUSG00000059565
HGNC: HGNC:6814
Homologene: 8460
CCDS: CCDS52264.1
UCSC: Chr7:62376979-62381640
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lifr
Name: LIF receptor alpha
Synonyms: soluble differentiation-stimulating factor receptor, A230075M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:96788
NCBI: 16880
Ensembl: ENSMUSG00000054263
VEGA: 15
HGNC: HGNC:6597
Homologene: 1735
CCDS: CCDS27369.1, CCDS49577.1
UCSC: Chr15:7090615-7197489
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:107736
NCBI: 110350
Ensembl: ENSMUSG00000047193
VEGA: OTTMUSG00000033489
HGNC: HGNC:2962
Homologene: 14468
CCDS: CCDS40528.1
UCSC: Chr9:6928503-7177282
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cars
Name: cysteinyl-tRNA synthetase
Synonyms: CA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1351477
NCBI: 27267
Ensembl: ENSMUSG00000010755
VEGA: OTTMUSG00000024014
HGNC: HGNC:1493
Homologene: 1328
CCDS: CCDS40198.1, CCDS57597.1
UCSC: Chr7:143557230-143600090
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cntrl
Name: centriolin
Synonyms: IB3/5, 6720467O09Rik, Ma2a8, Cep1, b2b1468Clo, Cep110
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1889576
NCBI: 26920
Ensembl: ENSMUSG00000057110
VEGA: OTTMUSG00000012039
HGNC: HGNC:1858
Homologene: 38260
CCDS: CCDS57170.2
UCSC: Chr2:35109492-35178822
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nop9
Name: NOP9 nucleolar protein
Synonyms: 2610027L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:1915092
NCBI: 67842
Ensembl: ENSMUSG00000019297
VEGA: OTTMUSG00000027854
HGNC: HGNC:19826
Homologene: 41678
CCDS: CCDS27126.1
UCSC: Chr14:55745693-55755634
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:1924767
NCBI: 211978
Ensembl: ENSMUSG00000066440
VEGA: 12
HGNC: HGNC:20761
Homologene: 9102
CCDS: CCDS36481.1
UCSC: Chr12:79232346-79296310
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:1926950
NCBI: 329002
Ensembl: ENSMUSG00000041258
VEGA: OTTMUSG00000044389
HGNC: HGNC:13028
Homologene: 7198
CCDS: CCDS50337.1
UCSC: Chr18:82593593-82693100
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pard6g
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:2135606
NCBI: 93737
Ensembl: ENSMUSG00000056214
VEGA: 18
HGNC: HGNC:16076
Homologene: 36487
CCDS: CCDS29363.1
UCSC: Chr18:80046872-80119640
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2449313
NCBI: 276919
Ensembl: ENSMUSG00000049396
VEGA: OTTMUSG00000006230
HGNC: HGNC:15717
Homologene: 69193
CCDS: CCDS25061.1
UCSC: Chr11:76210571-76217572
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Smox
Name: spermine oxidase
Synonyms: B130066H01Rik, SMO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:2445356
NCBI: 228608
Ensembl: ENSMUSG00000027333
VEGA: OTTMUSG00000016182
HGNC: HGNC:15862
Homologene: 69268
UCSC: Chr2:131491784-131525183
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Uncx
Name: UNC homeobox
Synonyms: Chx4, Uncx4.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:108013
NCBI: 22255
Ensembl: ENSMUSG00000029546
VEGA: OTTMUSG00000038278
HGNC: HGNC:33194
Homologene: 56598
CCDS: CCDS19813.1
UCSC: Chr5:139543898-139548179
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc9a4
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: NHE4, D730009J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:105074
NCBI: 110895
Ensembl: ENSMUSG00000026065
VEGA: OTTMUSG00000050474
HGNC: HGNC:11077
Homologene: 72232
CCDS: CCDS14913.1
UCSC: Chr1:40579713-40630731
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Avil
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1333798
NCBI: 11567
Ensembl: ENSMUSG00000025432
VEGA: OTTMUSG00000034112
HGNC: HGNC:14188
Homologene: 38200
CCDS: CCDS24221.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ccn4
Name: cellular communication network factor 4
Synonyms: Elm1, CCN4, Wisp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:1197008
NCBI: 22402
Ensembl: ENSMUSG00000005124
VEGA: OTTMUSG00000028045
HGNC: HGNC:12769
Homologene: 2883
CCDS: CCDS27510.1
UCSC: Chr15:66891325-66923205
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:107718
NCBI: 110082
Ensembl: ENSMUSG00000022262
VEGA: OTTMUSG00000026038
HGNC: HGNC:2950
Homologene: 1048
CCDS: CCDS27404.1
UCSC: Chr15:28154854-28472045
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Uggt2
Name: UDP-glucose glycoprotein glucosyltransferase 2
Synonyms: 3110001A05Rik, 1810064L21Rik, 3110027P15Rik, A230065J02Rik, Ugcgl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:1913685
NCBI: 66435
Ensembl: ENSMUSG00000042104
VEGA: OTTMUSG00000033561
HGNC: HGNC:15664
Homologene: 56875
CCDS: CCDS37013.2
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:2685047
NCBI: 545370
Ensembl: ENSMUSG00000066842
VEGA: OTTMUSG00000021664
HGNC: HGNC:19194
Homologene: 23741
CCDS: CCDS15357.2
UCSC: Chr1:150562500-150993777
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Foxn4
Name: forkhead box N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:2151057
NCBI: 116810
Ensembl: ENSMUSG00000042002
VEGA: OTTMUSG00000014418
HGNC: HGNC:21399
Homologene: 17526
CCDS: CCDS19562.1
UCSC: Chr5:114254164-114274600
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:1346037
NCBI: 23920
Ensembl: ENSMUSG00000005640
VEGA: OTTMUSG00000035156
HGNC: HGNC:6093
Homologene: 56539
CCDS: CCDS17454.1
UCSC: Chr3:87796908-87816101
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Kif5c
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1098269
NCBI: 16574
Ensembl: ENSMUSG00000026764
VEGA: OTTMUSG00000012481
HGNC: HGNC:6325
Homologene: 56234
CCDS: CCDS16024.1
UCSC: Chr2:49619314-49774778
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:2679727
NCBI: 210510
Ensembl: ENSMUSG00000040140
VEGA: OTTMUSG00000028302
HGNC: HGNC:21339
Homologene: 19364
CCDS: CCDS28797.1, CCDS50115.1
UCSC: Chr17:43615334-43631351
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ncdn
Name: neurochondrin
Synonyms: neurochondrin-2, neurochondrin-1, norbin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1347351
NCBI: 26562
Ensembl: ENSMUSG00000028833
VEGA: OTTMUSG00000009274
HGNC: HGNC:17597
Homologene: 8064
CCDS: CCDS18659.1
UCSC: Chr4:126743750-126753637
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2681862
NCBI: 380698
Ensembl: ENSMUSG00000061462
VEGA: OTTMUSG00000005776
HGNC: HGNC:15719
Homologene: 70869
UCSC: Chr11:58994256-59136375
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Myo7b
Name: myosin VIIB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:107709
NCBI: 17922
Ensembl: ENSMUSG00000024388
VEGA: OTTMUSG00000033977
HGNC: HGNC:7607
Homologene: 81947
CCDS: CCDS50244.1
UCSC: Chr18:31959234-32036931
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nrp1
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:106206
NCBI: 18186
Ensembl: ENSMUSG00000025810
VEGA: OTTMUSG00000061647
HGNC: HGNC:8004
Homologene: 2876
CCDS: CCDS22790.1
UCSC: Chr8:128358283-128505476
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nhsl1
Name: NHS-like 1
Synonyms: A630035H13Rik, D10Bwg0940e, 5730409E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:106390
NCBI: 215819
Ensembl: ENSMUSG00000039835
VEGA: OTTMUSG00000034982
HGNC: HGNC:21021
Homologene: 27834
CCDS: CCDS35853.1, CCDS48508.1
UCSC: Chr10:18318562-18533892
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cpd
Name: carboxypeptidase D
Synonyms: D830034L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:107265
NCBI: 12874
Ensembl: ENSMUSG00000020841
VEGA: OTTMUSG00000006239
HGNC: HGNC:2301
Homologene: 999
CCDS: CCDS25071.1
UCSC: Chr11:76777208-76847008
Genome Browser [Click image to go to Jbrowse]
Additional Resources
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:3039594
NCBI: 232400
Ensembl: ENSMUSG00000047228
VEGA: OTTMUSG00000056389
Homologene: 45969
CCDS: CCDS39651.1
UCSC: Chr6:128539822-128581606
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zc3h7a
Name: zinc finger CCCH type containing 7 A
Synonyms: A430104C18Rik, Zc3h7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:2445044
NCBI: 106205
Ensembl: ENSMUSG00000037965
VEGA: OTTMUSG00000026400
HGNC: HGNC:30959
Homologene: 8563
CCDS: CCDS49762.1
UCSC: Chr16:11136594-11176393
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:96100
NCBI: 110521
Ensembl: ENSMUSG00000021366
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
CCDS: CCDS36643.1
UCSC: Chr13:42051970-42185030
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Aox3
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:1918974
NCBI: 71724
Ensembl: ENSMUSG00000064294
VEGA: OTTMUSG00000021877
HGNC: HGNC:19049
Homologene: 90899
CCDS: CCDS14969.1
UCSC: Chr1:58113135-58200452
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Osbpl6
Name: oxysterol binding protein-like 6
Synonyms: ORP-6, 1110062M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:2139014
NCBI: 99031
Ensembl: ENSMUSG00000042359
VEGA: OTTMUSG00000013133
HGNC: HGNC:16388
Homologene: 101447
UCSC: Chr2:76406508-76600647
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:2388662
NCBI: 240753
Ensembl: ENSMUSG00000041757
VEGA: OTTMUSG00000049641
HGNC: HGNC:17053
Homologene: 135779
CCDS: CCDS15292.1, CCDS48361.1
UCSC: Chr1:133163768-133303435
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1891342
NCBI: 64899
Ensembl: ENSMUSG00000027412
VEGA: OTTMUSG00000001176
HGNC: HGNC:14451
Homologene: 84844
CCDS: CCDS16998.1
UCSC: Chr2:160880670-160906000
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1917631
NCBI: 70381
Ensembl: ENSMUSG00000066621
VEGA: OTTMUSG00000025570
HGNC: HGNC:22214
Homologene: 9120
CCDS: CCDS39377.1
UCSC: Chr5:144194442-144223606
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2684912
NCBI: 217341
Ensembl: ENSMUSG00000070331
VEGA: OTTMUSG00000003897
HGNC: HGNC:25326
Homologene: 12951
CCDS: CCDS25667.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr372
Name: olfactory receptor 372
Synonyms: GA_x6K02T2NUPS-191522-192466, MOR282-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:3030206
NCBI: 404315
Ensembl: ENSMUSG00000069998
VEGA: OTTMUSG00000061130
HGNC: HGNC:15391
Homologene: 17287
CCDS: CCDS52592.1
UCSC: Chr8:72057660-72058675
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zbtb46
Name: zinc finger and BTB domain containing 46
Synonyms: 4933406L05Rik, 2610019F01Rik, Btbd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1919397
NCBI: 72147
Ensembl: ENSMUSG00000027583
VEGA: OTTMUSG00000016707
HGNC: HGNC:16094
Homologene: 81908
CCDS: CCDS17212.1, CCDS50854.1
UCSC: Chr2:181371261-181492983
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ccdc170
Name: coiled-coil domain containing 170
Synonyms: LOC237250, Gm221
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:2685067
NCBI: 100504234
Ensembl: ENSMUSG00000019767
VEGA: OTTMUSG00000032752
HGNC: HGNC:21177
Homologene: 69393
CCDS: CCDS56677.1
UCSC: Chr10:4481416-4562374
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Bpifb6
Name: BPI fold containing family B, member 6
Synonyms: LOC228796, Bpil3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:2684965
NCBI: 228796
Ensembl: ENSMUSG00000068009
VEGA: OTTMUSG00000016851
HGNC: HGNC:16504
Homologene: 18375
CCDS: CCDS16920.1
UCSC: Chr2:153900388-153912795
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:3529431
NCBI: 230872
Ensembl: ENSMUSG00000040860
VEGA: OTTMUSG00000010088
HGNC: HGNC:21299
Homologene: 16811
CCDS: CCDS18861.1, CCDS51346.1
UCSC: Chr4:141016637-141060616
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Synj1
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:1354961
NCBI: 104015
Ensembl: ENSMUSG00000022973
VEGA: OTTMUSG00000027935
HGNC: HGNC:11503
Homologene: 48252
CCDS: CCDS49906.1, CCDS49907.1
UCSC: Chr16:90936092-91012134
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cdc20b
Name: cell division cycle 20B
Synonyms: EG238896, EG622422
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:3644472
NCBI: 238896
Ensembl: ENSMUSG00000078926
VEGA: OTTMUSG00000042682
HGNC: HGNC:24222
Homologene: 65056
CCDS: CCDS59591.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
St3gal6
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms: ST3Gal VI, 1700023B24Rik, Siat10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:1888707
NCBI: 54613
Ensembl: ENSMUSG00000022747
VEGA: OTTMUSG00000025631
HGNC: HGNC:18080
Homologene: 4448
CCDS: CCDS28230.1
UCSC: Chr16:58469742-58524253
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ndufa4
Name: Ndufa4, mitochondrial complex associated
Synonyms: MLRQ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:107686
NCBI: 17992
Ensembl: ENSMUSG00000029632
VEGA: OTTMUSG00000057021
HGNC: HGNC:7687
Homologene: 37629
CCDS: CCDS39427.1
UCSC: Chr6:11900373-11907446
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Acot11
Name: acyl-CoA thioesterase 11
Synonyms: BFIT1, 2010309H15Rik, Them1, 1110020M10Rik, Thea
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1913736
NCBI: 329910
Ensembl: ENSMUSG00000034853
VEGA: OTTMUSG00000008201
HGNC: HGNC:18156
Homologene: 11977
CCDS: CCDS18426.1, CCDS84764.1
UCSC: Chr4:106744555-106806086
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:2445160
NCBI: 211468
Ensembl: ENSMUSG00000035580
VEGA: OTTMUSG00000044933
HGNC: HGNC:18864
Homologene: 14332
CCDS: CCDS57101.1
UCSC: Chr17:52602709-52979194
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Llgl1
Name: LLGL1 scribble cell polarity complex component
Synonyms: Lgl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:102682
NCBI: 16897
Ensembl: ENSMUSG00000020536
VEGA: OTTMUSG00000007769
HGNC: HGNC:6628
Homologene: 31220
CCDS: CCDS48812.1, CCDS48813.1
UCSC: Chr11:60699668-60714188
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ltv1
Name: LTV1 ribosome biogenesis factor
Synonyms: 2610020N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:2447810
NCBI: 353258
Ensembl: ENSMUSG00000019814
VEGA: 10
HGNC: HGNC:21173
Homologene: 6338
CCDS: CCDS35845.1
UCSC: Chr10:13178597-13193137
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfp503
Name: zinc finger protein 503
Synonyms: B830002A16Rik, Nolz-1, Nolz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:1353644
NCBI: 218820
Ensembl: ENSMUSG00000039081
VEGA: OTTMUSG00000036886
HGNC: HGNC:23589
Homologene: 41888
CCDS: CCDS36822.1
UCSC: Chr14:21983962-21989601
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Txk
Name: TXK tyrosine kinase
Synonyms: Rlk, Btkl, PTK4, A130089B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:102960
NCBI: 22165
Ensembl: ENSMUSG00000054892
VEGA: OTTMUSG00000054700
HGNC: HGNC:12434
Homologene: 2497
UCSC: Chr5:72695978-72752992
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm9797
Name: predicted pseudogene 9797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:3704349
NCBI: 100039343
Ensembl: ENSMUSG00000045455
VEGA: 10
UCSC: Chr10:11609224-11610438
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tmem200a
Name: transmembrane protein 200A
Synonyms: C030003D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1924470
NCBI: 77220
Ensembl: ENSMUSG00000049420
VEGA: 10
HGNC: HGNC:21075
Homologene: 14175
CCDS: CCDS23755.1
UCSC: Chr10:25991182-26079052
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pknox2
Name: Pbx/knotted 1 homeobox 2
Synonyms: Prep2, D230005H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:2445415
NCBI: 208076
Ensembl: ENSMUSG00000035934
VEGA: OTTMUSG00000040107
HGNC: HGNC:16714
Homologene: 32527
CCDS: CCDS22974.1
UCSC: Chr9:36890979-37147327
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ptpn22
Name: protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms: 70zpep, Ptpn8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:107170
NCBI: 19260
Ensembl: ENSMUSG00000027843
VEGA: OTTMUSG00000022455
HGNC: HGNC:9652
Homologene: 7498
CCDS: CCDS38577.1
UCSC: Chr3:103856802-103912252
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dpysl2
Name: dihydropyrimidinase-like 2
Synonyms: Ulip2, Crmp2, TOAD-64, DRP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:1349763
NCBI: 12934
Ensembl: ENSMUSG00000022048
VEGA: OTTMUSG00000016382
HGNC: HGNC:3014
Homologene: 74392
CCDS: CCDS27224.1
UCSC: Chr14:66802864-66910911
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1351650
NCBI: 27375
Ensembl: ENSMUSG00000034917
VEGA: 10
HGNC: HGNC:11829
Homologene: 8458
CCDS: CCDS24051.1
UCSC: Chr10:81273188-81291581
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ttll1
Name: tubulin tyrosine ligase-like 1
Synonyms: 6330444E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:2443047
NCBI: 319953
Ensembl: ENSMUSG00000022442
VEGA: OTTMUSG00000023450
HGNC: HGNC:1312
Homologene: 8174
CCDS: CCDS27702.1
UCSC: Chr15:83483769-83518919
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cyp2d34
Name: cytochrome P450, family 2, subfamily d, polypeptide 34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:2385022
NCBI: 223706
Ensembl: ENSMUSG00000094559
VEGA: 15
Homologene: 86099
CCDS: CCDS37161.1
UCSC: Chr15:82615963-82620956
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pdcd4
Name: programmed cell death 4
Synonyms: MA-3, TIS, D19Ucla1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:107490
NCBI: 18569
Ensembl: ENSMUSG00000024975
VEGA: 19
HGNC: HGNC:8763
Homologene: 7879
CCDS: CCDS29903.1
UCSC: Chr19:53892231-53929861
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gtpbp2
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1860138
NCBI: 56055
Ensembl: ENSMUSG00000023952
VEGA: OTTMUSG00000035552
HGNC: HGNC:4670
Homologene: 10420
CCDS: CCDS50122.1
UCSC: Chr17:46159584-46169370
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr341
Name: olfactory receptor 341
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3030175
NCBI: 258952
Ensembl: ENSMUSG00000075387
VEGA: OTTMUSG00000012217
Homologene: 74160
CCDS: CCDS15974.1
UCSC: Chr2:36479187-36480128
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ptgdr
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:102966
NCBI: 19214
Ensembl: ENSMUSG00000071489
VEGA: OTTMUSG00000036408
HGNC: HGNC:9591
Homologene: 736
CCDS: CCDS26971.1
UCSC: Chr14:44851235-44859375
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mettl17
Name: methyltransferase like 17
Synonyms: 2310032K15Rik, D14Ertd209e, Mett11d1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:1098577
NCBI: 52535
Ensembl: ENSMUSG00000004561
VEGA: OTTMUSG00000036453
HGNC: HGNC:19280
Homologene: 11226
CCDS: CCDS36913.1
UCSC: Chr14:51884842-51891868
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Fam221b
Name: family with sequence similarity 221, member B
Synonyms: 4930412F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2441678
NCBI: 242408
Ensembl: ENSMUSG00000043633
VEGA: OTTMUSG00000007048
HGNC: HGNC:30762
Homologene: 52184
CCDS: CCDS18107.1
UCSC: Chr4:43659622-43668859
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Csf1r
Name: colony stimulating factor 1 receptor
Synonyms: CSF-1R, M-CSFR, CD115, Fim-2, Fms, Csfmr, Fim2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:1339758
NCBI: 12978
Ensembl: ENSMUSG00000024621
VEGA: OTTMUSG00000014918
HGNC: HGNC:2433
Homologene: 3817
CCDS: CCDS29280.1
UCSC: Chr18:61096809-61131139
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Golim4
Name: golgi integral membrane protein 4
Synonyms: GPP130, P138, 3110027H23Rik, Golph4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:1920374
NCBI: 73124
Ensembl: ENSMUSG00000034109
VEGA: OTTMUSG00000029722
HGNC: HGNC:15448
Homologene: 8716
CCDS: CCDS17416.1, CCDS71251.1
UCSC: Chr3:75876183-75956949
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gpr132
Name: G protein-coupled receptor 132
Synonyms: G2 accumulation, G2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:1890220
NCBI: 56696
Ensembl: ENSMUSG00000021298
VEGA: 12
HGNC: HGNC:17482
Homologene: 8350
CCDS: CCDS26199.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slfn9
Name: schlafen 9
Synonyms: 9830137M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2445121
NCBI: 237886
Ensembl: ENSMUSG00000069793
VEGA: OTTMUSG00000000923
HGNC: HGNC:26481
Homologene: 45432
CCDS: CCDS25154.1
UCSC: Chr11:82978382-82991830
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Camk2b
Name: calcium/calmodulin-dependent protein kinase II, beta
Synonyms: CaMK II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:88257
NCBI: 12323
Ensembl: ENSMUSG00000057897
VEGA: OTTMUSG00000005105
HGNC: HGNC:1461
Homologene: 111050
UCSC: Chr11:5969642-6066125
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1915585
NCBI: 55978
Ensembl: ENSMUSG00000001105
VEGA: OTTMUSG00000000139
HGNC: HGNC:30989
Homologene: 49559
CCDS: CCDS25111.1
UCSC: Chr11:78536436-78541473
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr968
Name: olfactory receptor 968
Synonyms: GA_x6K02T2PVTD-33470347-33469403, MOR171-15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:3030802
NCBI: 258605
Ensembl: ENSMUSG00000095903
VEGA: 9
Homologene: 121532
CCDS: CCDS23060.1
UCSC: Chr9:39771772-39772798
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
- T to G, chromosome 1 at 40,607,741 bp
- A to G, chromosome 1 at 58,169,843 bp
- C to A, chromosome 1 at 133,279,365 bp
- G to T, chromosome 1 at 150,604,831 bp
- G to A, chromosome 2 at 30,827,076 bp
- CAGAG to CAG, chromosome 2 at 35,122,806 bp
- G to T, chromosome 2 at 36,087,458 bp
- A to G, chromosome 2 at 36,480,047 bp
- T to A, chromosome 2 at 49,758,805 bp
- T to A, chromosome 2 at 76,586,214 bp
- T to G, chromosome 2 at 131,516,207 bp
- C to T, chromosome 2 at 150,816,772 bp
- T to C, chromosome 2 at 153,906,861 bp
- T to A, chromosome 2 at 160,896,809 bp
- C to T, chromosome 2 at 181,391,431 bp
- A to T, chromosome 3 at 75,908,149 bp
- G to A, chromosome 3 at 87,810,572 bp
- A to G, chromosome 3 at 103,874,052 bp
- A to T, chromosome 3 at 104,818,116 bp
- T to A, chromosome 4 at 43,665,537 bp
- T to C, chromosome 4 at 106,762,035 bp
- T to A, chromosome 4 at 126,745,273 bp
- T to A, chromosome 4 at 139,423,945 bp
- T to C, chromosome 4 at 139,644,128 bp
- T to C, chromosome 4 at 141,021,802 bp
- T to A, chromosome 5 at 29,474,189 bp
- T to A, chromosome 5 at 31,058,072 bp
- T to A, chromosome 5 at 72,696,579 bp
- C to T, chromosome 5 at 114,263,132 bp
- C to T, chromosome 5 at 139,426,722 bp
- T to C, chromosome 5 at 139,547,547 bp
- C to T, chromosome 5 at 144,174,988 bp
- T to A, chromosome 5 at 144,208,645 bp
- A to T, chromosome 6 at 11,900,575 bp
- T to C, chromosome 6 at 128,491,161 bp
- T to A, chromosome 6 at 128,576,260 bp
- T to A, chromosome 7 at 48,824,644 bp
- A to T, chromosome 7 at 62,377,738 bp
- G to T, chromosome 7 at 75,611,434 bp
- G to A, chromosome 7 at 78,477,935 bp
- T to C, chromosome 7 at 118,794,575 bp
- T to C, chromosome 7 at 130,892,253 bp
- C to A, chromosome 7 at 143,592,474 bp
- A to T, chromosome 8 at 25,164,493 bp
- A to G, chromosome 8 at 72,058,436 bp
- A to T, chromosome 8 at 111,297,402 bp
- A to T, chromosome 8 at 128,498,516 bp
- A to G, chromosome 9 at 7,081,084 bp
- A to G, chromosome 9 at 36,909,684 bp
- A to T, chromosome 9 at 39,772,495 bp
- G to A, chromosome 9 at 44,819,675 bp
- T to C, chromosome 9 at 72,308,005 bp
- T to G, chromosome 10 at 4,519,043 bp
- T to C, chromosome 10 at 11,609,325 bp
- C to G, chromosome 10 at 13,182,536 bp
- T to G, chromosome 10 at 18,524,664 bp
- T to A, chromosome 10 at 25,993,927 bp
- T to A, chromosome 10 at 81,278,054 bp
- T to G, chromosome 10 at 127,011,892 bp
- T to C, chromosome 11 at 5,977,880 bp
- T to A, chromosome 11 at 59,013,801 bp
- C to T, chromosome 11 at 59,076,759 bp
- T to C, chromosome 11 at 60,707,240 bp
- CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
- G to C, chromosome 11 at 76,211,050 bp
- T to C, chromosome 11 at 76,792,798 bp
- G to A, chromosome 11 at 78,540,034 bp
- T to A, chromosome 11 at 82,981,307 bp
- C to T, chromosome 11 at 116,441,449 bp
- T to A, chromosome 12 at 79,268,434 bp
- A to G, chromosome 12 at 112,852,403 bp
- C to T, chromosome 13 at 42,183,786 bp
- T to A, chromosome 13 at 63,210,149 bp
- A to T, chromosome 13 at 113,081,134 bp
- A to T, chromosome 14 at 21,985,520 bp
- A to T, chromosome 14 at 44,858,579 bp
- A to T, chromosome 14 at 51,888,735 bp
- A to G, chromosome 14 at 52,222,628 bp
- T to C, chromosome 14 at 55,751,142 bp
- A to G, chromosome 14 at 66,862,665 bp
- G to A, chromosome 14 at 118,553,349 bp
- A to G, chromosome 14 at 119,061,376 bp
- A to G, chromosome 15 at 7,181,856 bp
- A to G, chromosome 15 at 28,313,786 bp
- A to G, chromosome 15 at 35,879,791 bp
- G to A, chromosome 15 at 66,906,489 bp
- A to G, chromosome 15 at 82,618,501 bp
- A to G, chromosome 15 at 83,505,235 bp
- T to A, chromosome 15 at 98,075,967 bp
- A to T, chromosome 16 at 11,150,605 bp
- A to T, chromosome 16 at 17,280,811 bp
- T to C, chromosome 16 at 58,475,871 bp
- G to T, chromosome 16 at 90,964,517 bp
- T to C, chromosome 17 at 43,624,833 bp
- T to C, chromosome 17 at 46,161,202 bp
- T to C, chromosome 17 at 52,893,933 bp
- A to G, chromosome 18 at 20,834,940 bp
- A to G, chromosome 18 at 31,443,443 bp
- T to C, chromosome 18 at 31,994,897 bp
- T to C, chromosome 18 at 60,546,335 bp
- A to T, chromosome 18 at 61,129,077 bp
- A to T, chromosome 18 at 65,991,582 bp
- T to C, chromosome 18 at 80,117,308 bp
- T to C, chromosome 18 at 82,621,304 bp
- T to G, chromosome 19 at 53,926,326 bp
Genotype Determination
- Genotyping Protocol(s)
- Center protocol and contact for technical support will be shipped with mice.
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1786 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Colony Surveillance Program and Current Health Reports
Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
Click button to Request this one strain. (Use the
MMRRC Catalog Search to request more than one strain.)
| MMRRC Item # | Description | Distribution Fee / Unit (US $) *Shipping & Handling not included* |
Units | Notes |
|---|---|---|---|---|
| 039817-MU-RESUS | Litter recovered from cryo-archive | $5,475.00 / Non-Profit | Litter | Recovered litter4; additional fees for any special requests. |
| Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information. | ||||
Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the
Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.