Strain Name:
C57BL/6J-MtgxR1786Btlr/Mmmh
Stock Number:
039817-MU
Citation ID:
RRID:MMRRC_039817-MU
Other Names:
R1786 (G1), C57BL/6J-MtgxR1786Btlr
Major Collection:

Strain Information

Lhx6
Name: LIM homeobox protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16874
Homologene: 7401
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Pygb
Name: brain glycogen phosphorylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110078
HGNC: HGNC:9723
Homologene: 100930
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11287
Homologene: 104112
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Syt4
Name: synaptotagmin IV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 20983
VEGA: 18
Homologene: 7559
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Plekha1
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Synonyms: TAPP1, C920009D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101476
Homologene: 11001
Mnx1
Name: motor neuron and pancreas homeobox 1
Synonyms: HB9, MNR2, Hlxb9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15285
HGNC: HGNC:4979
Homologene: 21137
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71517
Homologene: 10659
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Trappc8
Name: trafficking protein particle complex 8
Synonyms: 5033403J15Rik, D030074E01Rik, Trs85
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 75964
VEGA: 18
Homologene: 40993
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231876
Homologene: 8948
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223870
Homologene: 8731
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd-1, Ssdh1, A930035F14Rik, ALDH4, Ahd1, P5CDH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212647
HGNC: HGNC:406
Homologene: 6081
Dctn4
Name: dynactin 4
Synonyms: p62, 4930547K17Rik, 1110001K06Rik, C130039E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67665
VEGA: 18
Homologene: 9430
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67772
Homologene: 72405
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, B230378H13Rik, Tacc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 320165
Homologene: 4575
Asb6
Name: ankyrin repeat and SOCS box-containing 6
Synonyms: 2510004M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72323
Homologene: 9895
Zdhhc13
Name: zinc finger, DHHC domain containing 13
Synonyms: kojak, 2410004E01Rik, Hip14l, skc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243983
Homologene: 75106
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Lman1
Name: lectin, mannose-binding, 1
Synonyms: ERGIC53, MCFD1, F5F8D, gp58, MR60, 2610020P13Rik, P58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70361
HGNC: HGNC:6631
Homologene: 4070
Rfwd3
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234736
Homologene: 41230
Gper1
Name: G protein-coupled estrogen receptor 1
Synonyms: 6330420K13Rik, Ceprl, GPCR-Br, CMKRL2, FEG-1, Gper, Gpr30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76854
HGNC: HGNC:4485
Homologene: 15855
Magel2
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Lifr
Name: LIF receptor alpha
Synonyms: soluble differentiation-stimulating factor receptor, A230075M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16880
VEGA: 15
HGNC: HGNC:6597
Homologene: 1735
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Cars1
Name: cysteinyl-tRNA synthetase 1
Synonyms: CA3, Cars
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Cntrl
Name: centriolin
Synonyms: IB3/5, 6720467O09Rik, Ma2a8, Cep1, b2b1468Clo, Cep110
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Nop9
Name: NOP9 nucleolar protein
Synonyms: 2610027L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67842
Homologene: 41678
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 329002
Homologene: 7198
Pard6g
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Smox
Name: spermine oxidase
Synonyms: B130066H01Rik, SMO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228608
Homologene: 69268
Uncx
Name: UNC homeobox
Synonyms: Chx4, Uncx4.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22255
Homologene: 56598
Slc9a4
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: NHE4, D730009J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 110895
Homologene: 72232
Avil
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11567
Homologene: 38200
Ccn4
Name: cellular communication network factor 4
Synonyms: Elm1, CCN4, Wisp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 22402
Homologene: 2883
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1537Clo, b2b1565Clo, b2b1154Clo, b2b1134Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Uggt2
Name: UDP-glucose glycoprotein glucosyltransferase 2
Synonyms: 3110001A05Rik, 1810064L21Rik, 3110027P15Rik, A230065J02Rik, Ugcgl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66435
Homologene: 56875
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Foxn4
Name: forkhead box N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 116810
Homologene: 17526
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
Kif5c
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16574
HGNC: HGNC:6325
Homologene: 56234
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210510
Homologene: 19364
Ncdn
Name: neurochondrin
Synonyms: neurochondrin-2, neurochondrin-1, norbin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26562
Homologene: 8064
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Myo7b
Name: myosin VIIB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17922
HGNC: HGNC:7607
Homologene: 81947
Nrp1
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18186
HGNC: HGNC:8004
Homologene: 2876
Nhsl1
Name: NHS like 1
Synonyms: A630035H13Rik, D10Bwg0940e, 5730409E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215819
Homologene: 27834
Cpd
Name: carboxypeptidase D
Synonyms: D830034L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12874
HGNC: HGNC:2301
Homologene: 999
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232400
Homologene: 45969
Zc3h7a
Name: zinc finger CCCH type containing 7 A
Synonyms: A430104C18Rik, Zc3h7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 106205
Homologene: 8563
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Aox3
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71724
Homologene: 90899
Osbpl6
Name: oxysterol binding protein-like 6
Synonyms: ORP-6, 1110062M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99031
Homologene: 101447
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 64899
Homologene: 84844
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70381
Homologene: 9120
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217341
Homologene: 12951
Or2z8
Name: olfactory receptor family 2 subfamily Z member 8
Synonyms: GA_x6K02T2NUPS-191522-192466, MOR282-1, Olfr372
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 404315
Homologene: 17287
Zbtb46
Name: zinc finger and BTB domain containing 46
Synonyms: 4933406L05Rik, 2610019F01Rik, Btbd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72147
Homologene: 81908
Ccdc170
Name: coiled-coil domain containing 170
Synonyms: LOC237250, Gm221
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 100504234
Homologene: 69393
Bpifb6
Name: BPI fold containing family B, member 6
Synonyms: LOC228796, Bpil3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228796
Homologene: 18375
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230872
Homologene: 16811
Synj1
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 104015
Homologene: 48252
Cdc20b
Name: cell division cycle 20B
Synonyms: EG238896, EG622422
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238896
Homologene: 65056
St3gal6
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms: ST3Gal VI, 1700023B24Rik, Siat10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 54613
Homologene: 4448
Ndufa4
Name: Ndufa4, mitochondrial complex associated
Synonyms: MLRQ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17992
HGNC: HGNC:7687
Homologene: 37629
Acot11
Name: acyl-CoA thioesterase 11
Synonyms: BFIT1, 2010309H15Rik, Them1, 1110020M10Rik, Thea
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329910
Homologene: 11977
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Llgl1
Name: LLGL1 scribble cell polarity complex component
Synonyms: Lgl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16897
HGNC: HGNC:6628
Homologene: 31220
Ltv1
Name: LTV1 ribosome biogenesis factor
Synonyms: 2610020N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 353258
VEGA: 10
Homologene: 6338
Zfp503
Name: zinc finger protein 503
Synonyms: B830002A16Rik, Nolz-1, Nolz1, ZNF503, Zpo2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218820
Homologene: 41888
Txk
Name: TXK tyrosine kinase
Synonyms: Rlk, Btkl, PTK4, A130089B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22165
Homologene: 2497
Gm9797
Name: predicted pseudogene 9797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 100039343
VEGA: 10
Tmem200a
Name: transmembrane protein 200A
Synonyms: C030003D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 77220
VEGA: 10
Homologene: 14175
Pknox2
Name: Pbx/knotted 1 homeobox 2
Synonyms: Prep2, D230005H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208076
Homologene: 32527
Ptpn22
Name: protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms: 70zpep, Ptpn8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19260
HGNC: HGNC:9652
Homologene: 7498
Dpysl2
Name: dihydropyrimidinase-like 2
Synonyms: Ulip2, Crmp2, DRP2, TOAD-64
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12934
HGNC: HGNC:3014
Homologene: 74392
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Ttll1
Name: tubulin tyrosine ligase-like 1
Synonyms: 6330444E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319953
HGNC: HGNC:1312
Homologene: 8174
Cyp2d34
Name: cytochrome P450, family 2, subfamily d, polypeptide 34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223706
VEGA: 15
HGNC: HGNC:2625
Homologene: 86099
Pdcd4
Name: programmed cell death 4
Synonyms: MA-3, TIS, D19Ucla1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18569
VEGA: 19
HGNC: HGNC:8763
Homologene: 7879
Gtpbp2
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 56055
HGNC: HGNC:4670
Homologene: 10420
Or1j13
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258952
Homologene: 74160
Ptgdr
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19214
HGNC: HGNC:9591
Homologene: 736
Mettl17
Name: methyltransferase like 17
Synonyms: 2310032K15Rik, D14Ertd209e, Mett11d1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 52535
Homologene: 11226
Fam221b
Name: family with sequence similarity 221, member B
Synonyms: 4930412F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242408
Homologene: 52184
Csf1r
Name: colony stimulating factor 1 receptor
Synonyms: CSF-1R, M-CSFR, CD115, Fim-2, Fms, Csfmr, Fim2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12978
HGNC: HGNC:2433
Homologene: 3817
Golim4
Name: golgi integral membrane protein 4
Synonyms: GPP130, P138, 3110027H23Rik, Golph4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73124
Homologene: 8716
Gpr132
Name: G protein-coupled receptor 132
Synonyms: G2 accumulation, G2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 56696
VEGA: 12
Homologene: 8350
Slfn9
Name: schlafen 9
Synonyms: 9830137M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237886
Homologene: 45432
Camk2b
Name: calcium/calmodulin-dependent protein kinase II, beta
Synonyms: CaMK II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12323
HGNC: HGNC:1461
Homologene: 111050
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Or8g53
Name: olfactory receptor family 8 subfamily G member 53
Synonyms: GA_x6K02T2PVTD-33470347-33469403, MOR171-15, Olfr968
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258605
VEGA: 9
Homologene: 121532
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 40,607,741 bp
  • A to G, chromosome 1 at 58,169,843 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • G to T, chromosome 1 at 150,604,831 bp
  • G to A, chromosome 2 at 30,827,076 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • G to T, chromosome 2 at 36,087,458 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • T to A, chromosome 2 at 76,586,214 bp
  • T to G, chromosome 2 at 131,516,207 bp
  • C to T, chromosome 2 at 150,816,772 bp
  • T to C, chromosome 2 at 153,906,861 bp
  • T to A, chromosome 2 at 160,896,809 bp
  • C to T, chromosome 2 at 181,391,431 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • A to G, chromosome 3 at 103,874,052 bp
  • A to T, chromosome 3 at 104,818,116 bp
  • T to A, chromosome 4 at 43,665,537 bp
  • T to C, chromosome 4 at 106,762,035 bp
  • T to A, chromosome 4 at 126,745,273 bp
  • T to A, chromosome 4 at 139,423,945 bp
  • T to C, chromosome 4 at 139,644,128 bp
  • T to C, chromosome 4 at 141,021,802 bp
  • T to A, chromosome 5 at 29,474,189 bp
  • T to A, chromosome 5 at 31,058,072 bp
  • T to A, chromosome 5 at 72,696,579 bp
  • C to T, chromosome 5 at 114,263,132 bp
  • C to T, chromosome 5 at 139,426,722 bp
  • T to C, chromosome 5 at 139,547,547 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • A to T, chromosome 6 at 11,900,575 bp
  • T to C, chromosome 6 at 128,491,161 bp
  • T to A, chromosome 6 at 128,576,260 bp
  • T to A, chromosome 7 at 48,824,644 bp
  • A to T, chromosome 7 at 62,377,738 bp
  • G to T, chromosome 7 at 75,611,434 bp
  • G to A, chromosome 7 at 78,477,935 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • T to C, chromosome 7 at 130,892,253 bp
  • C to A, chromosome 7 at 143,592,474 bp
  • A to T, chromosome 8 at 25,164,493 bp
  • A to G, chromosome 8 at 72,058,436 bp
  • A to T, chromosome 8 at 111,297,402 bp
  • A to T, chromosome 8 at 128,498,516 bp
  • A to G, chromosome 9 at 7,081,084 bp
  • A to G, chromosome 9 at 36,909,684 bp
  • A to T, chromosome 9 at 39,772,495 bp
  • G to A, chromosome 9 at 44,819,675 bp
  • T to C, chromosome 9 at 72,308,005 bp
  • T to G, chromosome 10 at 4,519,043 bp
  • T to C, chromosome 10 at 11,609,325 bp
  • C to G, chromosome 10 at 13,182,536 bp
  • T to G, chromosome 10 at 18,524,664 bp
  • T to A, chromosome 10 at 25,993,927 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • T to C, chromosome 11 at 5,977,880 bp
  • T to A, chromosome 11 at 59,013,801 bp
  • C to T, chromosome 11 at 59,076,759 bp
  • T to C, chromosome 11 at 60,707,240 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • T to C, chromosome 11 at 76,792,798 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • T to A, chromosome 11 at 82,981,307 bp
  • C to T, chromosome 11 at 116,441,449 bp
  • T to A, chromosome 12 at 79,268,434 bp
  • A to G, chromosome 12 at 112,852,403 bp
  • C to T, chromosome 13 at 42,183,786 bp
  • T to A, chromosome 13 at 63,210,149 bp
  • A to T, chromosome 13 at 113,081,134 bp
  • A to T, chromosome 14 at 21,985,520 bp
  • A to T, chromosome 14 at 44,858,579 bp
  • A to T, chromosome 14 at 51,888,735 bp
  • A to G, chromosome 14 at 52,222,628 bp
  • T to C, chromosome 14 at 55,751,142 bp
  • A to G, chromosome 14 at 66,862,665 bp
  • G to A, chromosome 14 at 118,553,349 bp
  • A to G, chromosome 14 at 119,061,376 bp
  • A to G, chromosome 15 at 7,181,856 bp
  • A to G, chromosome 15 at 28,313,786 bp
  • A to G, chromosome 15 at 35,879,791 bp
  • G to A, chromosome 15 at 66,906,489 bp
  • A to G, chromosome 15 at 82,618,501 bp
  • A to G, chromosome 15 at 83,505,235 bp
  • T to A, chromosome 15 at 98,075,967 bp
  • A to T, chromosome 16 at 11,150,605 bp
  • A to T, chromosome 16 at 17,280,811 bp
  • T to C, chromosome 16 at 58,475,871 bp
  • G to T, chromosome 16 at 90,964,517 bp
  • T to C, chromosome 17 at 43,624,833 bp
  • T to C, chromosome 17 at 46,161,202 bp
  • T to C, chromosome 17 at 52,893,933 bp
  • A to G, chromosome 18 at 20,834,940 bp
  • A to G, chromosome 18 at 31,443,443 bp
  • T to C, chromosome 18 at 31,994,897 bp
  • T to C, chromosome 18 at 60,546,335 bp
  • A to T, chromosome 18 at 61,129,077 bp
  • A to T, chromosome 18 at 65,991,582 bp
  • T to C, chromosome 18 at 80,117,308 bp
  • T to C, chromosome 18 at 82,621,304 bp
  • T to G, chromosome 19 at 53,926,326 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1786 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039817-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.