Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1786Btlr/Mmmh
Stock Number:
039817-MU
Citation ID:
RRID:MMRRC_039817-MU
Other Names:
R1786 (G1), C57BL/6J-MtgxR1786Btlr
Major Collection:

Strain Information

Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Pygb
Name: brain glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110078
HGNC: HGNC:9723
Homologene: 100930
Pzp2
Name: PZP alpha-2-macroglobulin like 2
Synonyms: Pzp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Syt4
Name: synaptotagmin IV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20983
VEGA: 18
Homologene: 7559
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 40,607,741 bp
  • A to G, chromosome 1 at 58,169,843 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • G to T, chromosome 1 at 150,604,831 bp
  • G to A, chromosome 2 at 30,827,076 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • G to T, chromosome 2 at 36,087,458 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • T to A, chromosome 2 at 76,586,214 bp
  • T to G, chromosome 2 at 131,516,207 bp
  • C to T, chromosome 2 at 150,816,772 bp
  • T to C, chromosome 2 at 153,906,861 bp
  • T to A, chromosome 2 at 160,896,809 bp
  • C to T, chromosome 2 at 181,391,431 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • A to G, chromosome 3 at 103,874,052 bp
  • A to T, chromosome 3 at 104,818,116 bp
  • T to A, chromosome 4 at 43,665,537 bp
  • T to C, chromosome 4 at 106,762,035 bp
  • T to A, chromosome 4 at 126,745,273 bp
  • T to A, chromosome 4 at 139,423,945 bp
  • T to C, chromosome 4 at 139,644,128 bp
  • T to C, chromosome 4 at 141,021,802 bp
  • T to A, chromosome 5 at 29,474,189 bp
  • T to A, chromosome 5 at 31,058,072 bp
  • T to A, chromosome 5 at 72,696,579 bp
  • C to T, chromosome 5 at 114,263,132 bp
  • C to T, chromosome 5 at 139,426,722 bp
  • T to C, chromosome 5 at 139,547,547 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • A to T, chromosome 6 at 11,900,575 bp
  • T to C, chromosome 6 at 128,491,161 bp
  • T to A, chromosome 6 at 128,576,260 bp
  • T to A, chromosome 7 at 48,824,644 bp
  • A to T, chromosome 7 at 62,377,738 bp
  • G to T, chromosome 7 at 75,611,434 bp
  • G to A, chromosome 7 at 78,477,935 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • T to C, chromosome 7 at 130,892,253 bp
  • C to A, chromosome 7 at 143,592,474 bp
  • A to T, chromosome 8 at 25,164,493 bp
  • A to G, chromosome 8 at 72,058,436 bp
  • A to T, chromosome 8 at 111,297,402 bp
  • A to T, chromosome 8 at 128,498,516 bp
  • A to G, chromosome 9 at 7,081,084 bp
  • A to G, chromosome 9 at 36,909,684 bp
  • A to T, chromosome 9 at 39,772,495 bp
  • G to A, chromosome 9 at 44,819,675 bp
  • T to C, chromosome 9 at 72,308,005 bp
  • T to G, chromosome 10 at 4,519,043 bp
  • T to C, chromosome 10 at 11,609,325 bp
  • C to G, chromosome 10 at 13,182,536 bp
  • T to G, chromosome 10 at 18,524,664 bp
  • T to A, chromosome 10 at 25,993,927 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • T to C, chromosome 11 at 5,977,880 bp
  • T to A, chromosome 11 at 59,013,801 bp
  • C to T, chromosome 11 at 59,076,759 bp
  • T to C, chromosome 11 at 60,707,240 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • T to C, chromosome 11 at 76,792,798 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • T to A, chromosome 11 at 82,981,307 bp
  • C to T, chromosome 11 at 116,441,449 bp
  • T to A, chromosome 12 at 79,268,434 bp
  • A to G, chromosome 12 at 112,852,403 bp
  • C to T, chromosome 13 at 42,183,786 bp
  • T to A, chromosome 13 at 63,210,149 bp
  • A to T, chromosome 13 at 113,081,134 bp
  • A to T, chromosome 14 at 21,985,520 bp
  • A to T, chromosome 14 at 44,858,579 bp
  • A to T, chromosome 14 at 51,888,735 bp
  • A to G, chromosome 14 at 52,222,628 bp
  • T to C, chromosome 14 at 55,751,142 bp
  • A to G, chromosome 14 at 66,862,665 bp
  • G to A, chromosome 14 at 118,553,349 bp
  • A to G, chromosome 14 at 119,061,376 bp
  • A to G, chromosome 15 at 7,181,856 bp
  • A to G, chromosome 15 at 28,313,786 bp
  • A to G, chromosome 15 at 35,879,791 bp
  • G to A, chromosome 15 at 66,906,489 bp
  • A to G, chromosome 15 at 82,618,501 bp
  • A to G, chromosome 15 at 83,505,235 bp
  • T to A, chromosome 15 at 98,075,967 bp
  • A to T, chromosome 16 at 11,150,605 bp
  • A to T, chromosome 16 at 17,280,811 bp
  • T to C, chromosome 16 at 58,475,871 bp
  • G to T, chromosome 16 at 90,964,517 bp
  • T to C, chromosome 17 at 43,624,833 bp
  • T to C, chromosome 17 at 46,161,202 bp
  • T to C, chromosome 17 at 52,893,933 bp
  • A to G, chromosome 18 at 20,834,940 bp
  • A to G, chromosome 18 at 31,443,443 bp
  • T to C, chromosome 18 at 31,994,897 bp
  • T to C, chromosome 18 at 60,546,335 bp
  • A to T, chromosome 18 at 61,129,077 bp
  • A to T, chromosome 18 at 65,991,582 bp
  • T to C, chromosome 18 at 80,117,308 bp
  • T to C, chromosome 18 at 82,621,304 bp
  • T to G, chromosome 19 at 53,926,326 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1786 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039817-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.