Strain Detail Sheet
Strain Name:
C57BL/6J-MtgxR1803Btlr/Mmmh
Stock Number:
039833-MU
Citation ID:
RRID:MMRRC_039833-MU
Other Names:
R1803 (G1), C57BL/6J-MtgxR1803Btlr
Major Collection:
Zmpste24
Name: zinc metallopeptidase, STE24
Synonyms: A530043O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1890508
NCBI: 230709
Ensembl: ENSMUSG00000043207
VEGA: OTTMUSG00000008909
HGNC: HGNC:12877
Homologene: 4277
CCDS: CCDS18600.1
UCSC: Chr4:121059237-121098249
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1890574
NCBI: 80297
Ensembl: ENSMUSG00000011751
VEGA: OTTMUSG00000023763
HGNC: HGNC:14896
Homologene: 11879
CCDS: CCDS21019.1, CCDS57530.1
UCSC: Chr7:27356383-27447704
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Rcan2
Name: regulator of calcineurin 2
Synonyms: MCIP2, ZAKI-4, Csp2, Dscr1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1858219
NCBI: 53901
Ensembl: ENSMUSG00000039601
VEGA: 17
HGNC: HGNC:3041
Homologene: 130985
CCDS: CCDS28800.1, CCDS28801.1
UCSC: Chr17:43801281-44039516
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Sort1
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:1338015
NCBI: 20661
Ensembl: ENSMUSG00000068747
VEGA: OTTMUSG00000007304
HGNC: HGNC:11186
Homologene: 136097
CCDS: CCDS17756.1, CCDS80003.1
UCSC: Chr3:108284053-108361519
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:104750
NCBI: 319504
Ensembl: ENSMUSG00000020598
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
CCDS: CCDS49056.1, CCDS49057.1
UCSC: Chr12:44328832-44605194
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1917923
NCBI: 70673
Ensembl: ENSMUSG00000039410
VEGA: OTTMUSG00000010585
HGNC: HGNC:14000
Homologene: 11139
UCSC: Chr4:154316122-154636873
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:107562
NCBI: 74100
Ensembl: ENSMUSG00000032503
VEGA: OTTMUSG00000034741
HGNC: HGNC:16968
Homologene: 32306
UCSC: Chr9:112065091-112236021
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:2441950
NCBI: 319387
Ensembl: ENSMUSG00000037605
VEGA: OTTMUSG00000029552
HGNC: HGNC:20974
Homologene: 22878
UCSC: Chr5:81019560-81827825
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dmtn
Name: dematin actin binding protein
Synonyms: dematin, Epb4.9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:99670
NCBI: 13829
Ensembl: ENSMUSG00000022099
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
CCDS: CCDS27259.1
UCSC: Chr14:70602184-70636048
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gdi2
Name: guanosine diphosphate (GDP) dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:99845
NCBI: 14569
Ensembl: ENSMUSG00000021218
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
CCDS: CCDS36581.1
UCSC: Chr13:3538075-3566261
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: ORP-8, D330025H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:2443807
NCBI: 237542
Ensembl: ENSMUSG00000020189
VEGA: 10
HGNC: HGNC:16396
Homologene: 68813
CCDS: CCDS24166.1, CCDS36056.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ptprg
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:97814
NCBI: 19270
Ensembl: ENSMUSG00000021745
VEGA: OTTMUSG00000029429
HGNC: HGNC:9671
Homologene: 2129
CCDS: CCDS26816.1, CCDS84092.1
UCSC: Chr14:11553553-12242040
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cdkal1
Name: CDK5 regulatory subunit associated protein 1-like 1
Synonyms: 6620401C13Rik, 1190005B03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:1921765
NCBI: 68916
Ensembl: ENSMUSG00000006191
VEGA: OTTMUSG00000000663
HGNC: HGNC:21050
Homologene: 9830
CCDS: CCDS26412.1, CCDS84016.1
UCSC: Chr13:29191746-29855684
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1921605
NCBI: 74355
Ensembl: ENSMUSG00000024054
VEGA: OTTMUSG00000033170
HGNC: HGNC:29090
Homologene: 23665
CCDS: CCDS28958.2
UCSC: Chr17:71344489-71475343
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dcp2
Name: decapping mRNA 2
Synonyms: 2410015D23Rik, 5730537H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:1917890
NCBI: 70640
Ensembl: ENSMUSG00000024472
VEGA: OTTMUSG00000055564
HGNC: HGNC:24452
Homologene: 13968
CCDS: CCDS50275.1
UCSC: Chr18:44380500-44424969
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lamb2
Name: laminin, beta 2
Synonyms: Lamb-2, Lams, npht
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:99916
NCBI: 16779
Ensembl: ENSMUSG00000052911
VEGA: OTTMUSG00000050824
HGNC: HGNC:6487
Homologene: 1723
CCDS: CCDS23528.1
UCSC: Chr9:108479857-108490530
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Itgb2
Name: integrin beta 2
Synonyms: Mac-1 beta, 2E6, Cd18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:96611
NCBI: 16414
Ensembl: ENSMUSG00000000290
VEGA: OTTMUSG00000019985
HGNC: HGNC:6155
Homologene: 20092
CCDS: CCDS23956.1
UCSC: Chr10:77530329-77565681
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ddx52
Name: DExD box helicase 52
Synonyms: 2700029C06Rik, ROK1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1925644
NCBI: 78394
Ensembl: ENSMUSG00000020677
VEGA: OTTMUSG00000000973
HGNC: HGNC:20038
Homologene: 5093
CCDS: CCDS25180.1
UCSC: Chr11:83942090-83963088
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mnat1
Name: menage a trois 1
Synonyms: MAT1, E130115E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:106207
NCBI: 17420
Ensembl: ENSMUSG00000021103
VEGA: OTTMUSG00000047017
HGNC: HGNC:7181
Homologene: 1821
CCDS: CCDS49087.1
UCSC: Chr12:73112181-73273988
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:2682306
NCBI: 234344
Ensembl: ENSMUSG00000014907
VEGA: OTTMUSG00000031172
HGNC: HGNC:25126
Homologene: 128518
CCDS: CCDS52562.1
UCSC: Chr8:66859957-66890564
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:1927230
NCBI: 223435
Ensembl: ENSMUSG00000022263
VEGA: 15
HGNC: HGNC:12303
Homologene: 20847
CCDS: CCDS49587.1
UCSC: Chr15:27730649-28027034
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc25a46
Name: solute carrier family 25, member 46
Synonyms: 1200007B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:1914703
NCBI: 67453
Ensembl: ENSMUSG00000024259
VEGA: 18
HGNC: HGNC:25198
Homologene: 14518
CCDS: CCDS29110.1
UCSC: Chr18:31580168-31609902
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:2179061
NCBI: 243743
Ensembl: ENSMUSG00000029765
VEGA: OTTMUSG00000014752
HGNC: HGNC:9102
Homologene: 77587
CCDS: CCDS19985.2
UCSC: Chr6:32144543-32588192
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NMDAR2C, NR2C, GluRepsilon3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:95822
NCBI: 14813
Ensembl: ENSMUSG00000020734
VEGA: OTTMUSG00000003665
HGNC: HGNC:4587
Homologene: 647
CCDS: CCDS25624.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:1916380
NCBI: 666173
Ensembl: ENSMUSG00000037646
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
CCDS: CCDS49592.1
UCSC: Chr15:35371143-35931229
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:107736
NCBI: 110350
Ensembl: ENSMUSG00000047193
VEGA: OTTMUSG00000033489
HGNC: HGNC:2962
Homologene: 14468
CCDS: CCDS40528.1
UCSC: Chr9:6928503-7177282
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dnpep
Name: aspartyl aminopeptidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:1278328
NCBI: 13437
Ensembl: ENSMUSG00000026209
VEGA: OTTMUSG00000048821
HGNC: HGNC:2981
Homologene: 6110
CCDS: CCDS15070.1, CCDS78623.1
UCSC: Chr1:75308565-75317654
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Morc1
Name: microrchidia 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:1316740
NCBI: 17450
Ensembl: ENSMUSG00000022652
VEGA: 16
HGNC: HGNC:7198
Homologene: 7843
CCDS: CCDS37351.1
UCSC: Chr16:48431237-48630905
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Klhl2
Name: kelch-like 2, Mayven
Synonyms: ABP-KELCH, 6030411N21Rik, Mav, 8530402H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:1924363
NCBI: 77113
Ensembl: ENSMUSG00000031605
VEGA: OTTMUSG00000061229
HGNC: HGNC:6353
Homologene: 21416
CCDS: CCDS85544.1
UCSC: Chr8:64739673-64850029
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ttc7b
Name: tetratricopeptide repeat domain 7B
Synonyms: Ttc7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:2144724
NCBI: 104718
Ensembl: ENSMUSG00000033530
VEGA: 12
HGNC: HGNC:19858
Homologene: 14675
CCDS: CCDS49141.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Exoc1
Name: exocyst complex component 1
Synonyms: Sec3p, SEC3, A730011E05Rik, 2810407P21Rik, Sec3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:2445020
NCBI: 69940
Ensembl: ENSMUSG00000036435
VEGA: OTTMUSG00000026487
HGNC: HGNC:30380
Homologene: 41241
UCSC: Chr5:76529307-76570298
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dpy19l4
Name: dpy-19-like 4 (C. elegans)
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2685869
NCBI: 381510
Ensembl: ENSMUSG00000045205
VEGA: OTTMUSG00000004592
HGNC: HGNC:27829
Homologene: 18773
CCDS: CCDS38692.1
UCSC: Chr4:11261315-11322505
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Flt3
Name: FMS-like tyrosine kinase 3
Synonyms: CD135, Flk-2, Flt-3, Flk2, wmfl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:95559
NCBI: 14255
Ensembl: ENSMUSG00000042817
VEGA: OTTMUSG00000020408
HGNC: HGNC:3765
Homologene: 3040
CCDS: CCDS39400.1
UCSC: Chr5:147330741-147400489
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Blnk
Name: B cell linker
Synonyms: SLP-65, BCA, BASH, BLNK, Ly-57, Bca, Ly57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:96878
NCBI: 17060
Ensembl: ENSMUSG00000061132
VEGA: OTTMUSG00000031860
HGNC: HGNC:14211
Homologene: 32038
CCDS: CCDS37983.1
UCSC: Chr19:40928927-40994535
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:1921396
NCBI: 76088
Ensembl: ENSMUSG00000052085
VEGA: 19
HGNC: HGNC:19191
Homologene: 52414
CCDS: CCDS37943.1
UCSC: Chr19:24999511-25202432
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Umod
Name: uromodulin
Synonyms: Tamm-Horsfall glycoprotein, uromucoid, urehr4, Urehd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:102674
NCBI: 22242
Ensembl: ENSMUSG00000030963
VEGA: OTTMUSG00000059102
HGNC: HGNC:12559
Homologene: 2522
CCDS: CCDS21780.1
UCSC: Chr7:119462708-119479262
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1933547
NCBI: 83771
Ensembl: ENSMUSG00000029072
VEGA: OTTMUSG00000010892
HGNC: HGNC:15661
Homologene: 12890
CCDS: CCDS19046.1
UCSC: Chr4:155859268-155863353
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cdh23
Name: cadherin 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1890219
NCBI: 22295
Ensembl: ENSMUSG00000012819
VEGA: OTTMUSG00000017511
HGNC: HGNC:13733
Homologene: 11142
CCDS: CCDS56704.1
UCSC: Chr10:60302748-60696513
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mns1
Name: meiosis-specific nuclear structural protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:107933
NCBI: 17427
Ensembl: ENSMUSG00000032221
VEGA: OTTMUSG00000044713
HGNC: HGNC:29636
Homologene: 40628
CCDS: CCDS40684.1
UCSC: Chr9:72438517-72458581
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:99612
NCBI: 13837
Ensembl: ENSMUSG00000052504
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
CCDS: CCDS28264.1
UCSC: Chr16:63545218-63864157
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Srrm3
Name: serine/arginine repetitive matrix 3
Synonyms: 2900083I11Rik, SRm300-like, Srrm2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1920309
NCBI: 58212
Ensembl: ENSMUSG00000039860
VEGA: OTTMUSG00000029498
HGNC: HGNC:26729
Homologene: 136723
CCDS: CCDS39319.2
UCSC: Chr5:135806860-135874773
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Grk2
Name: G protein-coupled receptor kinase 2
Synonyms: beta ARK, beta ARK1, beta-AR kinase-1, beta-adrenergic receptor kinase-1, Bark-1, Adrbk-1, betaARK1, Adrbk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:87940
NCBI: 110355
Ensembl: ENSMUSG00000024858
VEGA: OTTMUSG00000035343
HGNC: HGNC:289
Homologene: 1223
CCDS: CCDS29426.1, CCDS70915.1
UCSC: Chr19:4285999-4306222
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1925559
NCBI: 78309
Ensembl: ENSMUSG00000040327
VEGA: OTTMUSG00000043230
HGNC: HGNC:15982
Homologene: 56696
CCDS: CCDS37636.2
UCSC: Chr17:46500609-46546388
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ust
Name: uronyl-2-sulfotransferase
Synonyms: D930010O20Rik, UA2OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:2442406
NCBI: 338362
Ensembl: ENSMUSG00000047712
VEGA: 10
HGNC: HGNC:17223
Homologene: 4174
CCDS: CCDS35835.1
UCSC: Chr10:8204753-8518825
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:98248
NCBI: 110876
Ensembl: ENSMUSG00000075318
VEGA: OTTMUSG00000012963
HGNC: HGNC:10588
Homologene: 75001
CCDS: CCDS38130.1, CCDS84529.1
UCSC: Chr2:65620740-65767448
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Stard9
Name: START domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3045258
NCBI: 668880
Ensembl: ENSMUSG00000033705
VEGA: OTTMUSG00000015627
HGNC: HGNC:19162
Homologene: 130712
UCSC: Chr2:120629091-120729033
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Scube3
Name: signal peptide, CUB domain, EGF-like 3
Synonyms: D030038I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:3045253
NCBI: 268935
Ensembl: ENSMUSG00000038677
VEGA: OTTMUSG00000021032
HGNC: HGNC:13655
Homologene: 65059
CCDS: CCDS37527.1
UCSC: Chr17:28142100-28174848
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Fzd1
Name: frizzled class receptor 1
Synonyms: FZ-1, Fz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1196625
NCBI: 14362
Ensembl: ENSMUSG00000044674
VEGA: OTTMUSG00000021313
HGNC: HGNC:4038
Homologene: 20750
CCDS: CCDS19072.1
UCSC: Chr5:4753839-4758216
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dennd5a
Name: DENN/MADD domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1201681
NCBI: 19347
Ensembl: ENSMUSG00000035901
VEGA: OTTMUSG00000026153
HGNC: HGNC:19344
Homologene: 14584
CCDS: CCDS21741.1, CCDS80781.1
UCSC: Chr7:109893780-109960470
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ak9
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:2685080
NCBI: 633979
Ensembl: ENSMUSG00000091415
VEGA: OTTMUSG00000037166
HGNC: HGNC:33814
Homologene: 67934
UCSC: Chr10:41303432-41433569
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc7a6
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 6
Synonyms: LAT-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:2142598
NCBI: 330836
Ensembl: ENSMUSG00000031904
VEGA: OTTMUSG00000061944
HGNC: HGNC:11064
Homologene: 62496
CCDS: CCDS22631.1
UCSC: Chr8:106168836-106198714
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:2443264
NCBI: 231014
Ensembl: ENSMUSG00000056004
VEGA: OTTMUSG00000025805
HGNC: HGNC:21945
Homologene: 27396
CCDS: CCDS19089.1
UCSC: Chr5:9266123-9481827
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Scnn1a
Name: sodium channel, nonvoltage-gated 1 alpha
Synonyms: mENaC, ENaC alpha, Scnn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:101782
NCBI: 20276
Ensembl: ENSMUSG00000030340
VEGA: OTTMUSG00000038566
HGNC: HGNC:10599
Homologene: 811
CCDS: CCDS39641.2
UCSC: Chr6:125321052-125344943
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mybpc1
Name: myosin binding protein C, slow-type
Synonyms: Slow-type C-protein, 8030451F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1336213
NCBI: 109272
Ensembl: ENSMUSG00000020061
VEGA: OTTMUSG00000031731
HGNC: HGNC:7549
Homologene: 1846
CCDS: CCDS48666.1, CCDS56739.1
UCSC: Chr10:88518279-88605236
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:3045226
NCBI: 239081
Ensembl: ENSMUSG00000051969
VEGA: OTTMUSG00000044436
Homologene: 77905
CCDS: CCDS27012.2
UCSC: Chr14:50357914-50363663
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:1859555
NCBI: 54563
Ensembl: ENSMUSG00000030091
VEGA: OTTMUSG00000023319
HGNC: HGNC:30052
Homologene: 41286
CCDS: CCDS39565.1
UCSC: Chr6:91013067-91117010
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Rxfp1
Name: relaxin/insulin-like family peptide receptor 1
Synonyms: LOC381489, Lgr7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:2682211
NCBI: 381489
Ensembl: ENSMUSG00000034009
VEGA: OTTMUSG00000044333
HGNC: HGNC:19718
Homologene: 11007
CCDS: CCDS17420.1
UCSC: Chr3:79641600-79737951
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Plekhn1
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2387630
NCBI: 231002
Ensembl: ENSMUSG00000078485
VEGA: 4
HGNC: HGNC:25284
Homologene: 12949
CCDS: CCDS51407.1
UCSC: Chr4:156221456-156228542
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Npc1l1
Name: NPC1 like intracellular cholesterol transporter 1
Synonyms: Niemann-Pick disease, type C1, 9130221N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2685089
NCBI: 237636
Ensembl: ENSMUSG00000020447
VEGA: OTTMUSG00000000776
HGNC: HGNC:7898
Homologene: 56585
CCDS: CCDS24413.1
UCSC: Chr11:6211011-6230245
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Emilin1
Name: elastin microfibril interfacer 1
Synonyms: 5830419M17Rik, gp115, EMILIN-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1926189
NCBI: 100952
Ensembl: ENSMUSG00000029163
VEGA: OTTMUSG00000035952
HGNC: HGNC:19880
Homologene: 5117
CCDS: CCDS19167.1
UCSC: Chr5:30913382-30921279
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pla2g4b
Name: phospholipase A2, group IVB (cytosolic)
Synonyms: A030011C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:2384819
NCBI: 211429
Ensembl: ENSMUSG00000098488
VEGA: OTTMUSG00000015287
HGNC: HGNC:9036
Homologene: 3730
CCDS: CCDS38209.2
UCSC: Chr2:120033433-120043033
Genome Browser [Click image to go to Jbrowse]
Additional Resources
AC149051.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Vmn1r39
Name: vomeronasal 1 receptor 39
Synonyms: Gm5993
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:3644802
NCBI: 546903
Ensembl: ENSMUSG00000093755
VEGA: OTTMUSG00000040015
Homologene: 110800
CCDS: CCDS51803.1
UCSC: Chr6:66804415-66805332
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vmn1r176
Name: vomeronasal 1 receptor 176
Synonyms: Gm5998
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:3809206
NCBI: 546943
Ensembl: ENSMUSG00000096859
VEGA: OTTMUSG00000038010
Homologene: 128341
CCDS: CCDS52136.1
UCSC: Chr7:23834812-23835726
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfp85
Name: zinc finger protein 85
Synonyms: Zfp71, KRAB19, Zfp85-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:107767
NCBI: 22746
Ensembl: ENSMUSG00000058331
VEGA: OTTMUSG00000032931
Homologene: 133709
CCDS: CCDS36717.1
UCSC: Chr13:67747800-67755134
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Plin4
Name: perilipin 4
Synonyms: S3-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1929709
NCBI: 57435
Ensembl: ENSMUSG00000002831
VEGA: OTTMUSG00000046184
HGNC: HGNC:29393
Homologene: 69311
CCDS: CCDS79565.1
UCSC: Chr17:56100587-56109953
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mfsd10
Name: major facilitator superfamily domain containing 10
Synonyms: 0610009O03Rik, Tetran
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1915544
NCBI: 68294
Ensembl: ENSMUSG00000001082
VEGA: OTTMUSG00000023147
HGNC: HGNC:16894
Homologene: 871
CCDS: CCDS19217.1
UCSC: Chr5:34633644-34637209
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Alcam
Name: activated leukocyte cell adhesion molecule
Synonyms: DM-GRASP, CD166, MuSC, SC1, BEN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:1313266
NCBI: 11658
Ensembl: ENSMUSG00000022636
VEGA: OTTMUSG00000036124
HGNC: HGNC:400
Homologene: 1229
CCDS: CCDS37356.1, CCDS84242.1
UCSC: Chr16:52248996-52453064
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:2445160
NCBI: 211468
Ensembl: ENSMUSG00000035580
VEGA: OTTMUSG00000044933
HGNC: HGNC:18864
Homologene: 14332
CCDS: CCDS57101.1
UCSC: Chr17:52602709-52979194
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr830
Name: olfactory receptor 830
Synonyms: GA_x6K02T2PVTD-12618399-12619337, MOR152-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:3030664
NCBI: 258559
Ensembl: ENSMUSG00000062868
VEGA: OTTMUSG00000061150
Homologene: 79360
CCDS: CCDS22848.1
UCSC: Chr9:18874960-18876276
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc25a21
Name: solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Synonyms: 9930033G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:2445059
NCBI: 217593
Ensembl: ENSMUSG00000035472
VEGA: OTTMUSG00000023139
HGNC: HGNC:14411
Homologene: 6988
CCDS: CCDS25925.1, CCDS49069.1
UCSC: Chr12:56712634-57197472
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Morn5
Name: MORN repeat containing 5
Synonyms: 1700010A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1922745
NCBI: 75495
Ensembl: ENSMUSG00000026894
VEGA: OTTMUSG00000012101
HGNC: HGNC:17841
Homologene: 16510
CCDS: CCDS15968.1
UCSC: Chr2:36049473-36079709
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfyve16
Name: zinc finger, FYVE domain containing 16
Synonyms: B130024H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:2145181
NCBI: 218441
Ensembl: ENSMUSG00000021706
VEGA: OTTMUSG00000024652
HGNC: HGNC:20756
Homologene: 8826
CCDS: CCDS26682.1
UCSC: Chr13:92487101-92530922
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ddx58
Name: DEAD/H box helicase 58
Synonyms: 6430573D20Rik, RIG-I, DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2442858
NCBI: 230073
Ensembl: ENSMUSG00000040296
VEGA: OTTMUSG00000006554
HGNC: HGNC:19102
Homologene: 32215
CCDS: CCDS18043.1
UCSC: Chr4:40203777-40239825
Genome Browser [Click image to go to Jbrowse]
Additional Resources
4921513D11Rik
Name: RIKEN cDNA 4921513D11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1918173
H2-M10.2
Name: histocompatibility 2, M region locus 10.2
Synonyms: 4.7H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1276525
NCBI: 333715
Ensembl: ENSMUSG00000023083
VEGA: OTTMUSG00000014948
Homologene: 117973
CCDS: CCDS28720.1
UCSC: Chr17:36284281-36286421
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Hyou1
Name: hypoxia up-regulated 1
Synonyms: CBP-140, Orp150, 140 kDa, Grp170, Cab140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:108030
NCBI: 12282
Ensembl: ENSMUSG00000032115
VEGA: OTTMUSG00000034194
HGNC: HGNC:16931
Homologene: 4658
CCDS: CCDS23107.1
UCSC: Chr9:44379490-44392369
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cd44
Name: CD44 antigen
Synonyms: Ly-24, Pgp-1, HERMES
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:88338
NCBI: 12505
Ensembl: ENSMUSG00000005087
VEGA: OTTMUSG00000014837
HGNC: HGNC:1681
Homologene: 508
UCSC: Chr2:102811141-102901669
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: 4930443G12Rik, SCaMC-1like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:1921936
NCBI: 74686
Ensembl: ENSMUSG00000027880
VEGA: OTTMUSG00000007309
Homologene: 82464
CCDS: CCDS51052.1
UCSC: Chr3:109080499-109116582
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm10842
Name: predicted gene 10842
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:3642916
Ensembl: ENSMUSG00000075485
Sema4g
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:1347047
NCBI: 26456
Ensembl: ENSMUSG00000025207
VEGA: OTTMUSG00000014898
HGNC: HGNC:10735
Homologene: 22682
CCDS: CCDS29853.1
UCSC: Chr19:44988966-45003397
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr1465
Name: olfactory receptor 1465
Synonyms: GA_x6K02T2RE5P-3645346-3644423, MOR202-28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:3031299
NCBI: 258121
Ensembl: ENSMUSG00000062199
VEGA: OTTMUSG00000059501
CCDS: CCDS29655.1
UCSC: Chr19:13313360-13314283
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr1299
Name: olfactory receptor 1299
Synonyms: GA_x6K02T2Q125-72715642-72716580, MOR248-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3031133
NCBI: 258886
Ensembl: ENSMUSG00000109219
VEGA: OTTMUSG00000015070
Homologene: 17426
CCDS: CCDS38197.1
UCSC: Chr2:111661453-111665166
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vmn1r202
Name: vomeronasal 1 receptor 202
Synonyms: V1ri7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:2159693
NCBI: 171258
Ensembl: ENSMUSG00000094379
VEGA: OTTMUSG00000000501
Homologene: 110880
CCDS: CCDS26320.1
UCSC: Chr13:22501337-22502245
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cd47
Name: CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Synonyms: Itgp, 9130415E20Rik, B430305P08Rik, integrin-associated protein, IAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:96617
NCBI: 16423
Ensembl: ENSMUSG00000055447
VEGA: OTTMUSG00000014965
HGNC: HGNC:1682
Homologene: 1346
CCDS: CCDS28212.1
UCSC: Chr16:49855253-49912424
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cyp2a5
Name: cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms: Coh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:88597
NCBI: 13087
Ensembl: ENSMUSG00000005547
VEGA: OTTMUSG00000036784
Homologene: 85917
CCDS: CCDS21008.1
UCSC: Chr7:26835339-26843264
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mab21l3
Name: mab-21-like 3
Synonyms: BC037703
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:2446273
NCBI: 242125
Ensembl: ENSMUSG00000044313
VEGA: OTTMUSG00000026626
HGNC: HGNC:26787
Homologene: 17564
CCDS: CCDS17684.1
UCSC: Chr3:101813076-101836726
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tas1r1
Name: taste receptor, type 1, member 1
Synonyms: TR1, T1r1, Gpr70, T1R1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1927505
NCBI: 110326
Ensembl: ENSMUSG00000028950
VEGA: OTTMUSG00000010375
HGNC: HGNC:14448
Homologene: 12888
CCDS: CCDS18985.1
UCSC: Chr4:152027914-152038490
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Edf1
Name: endothelial differentiation-related factor 1
Synonyms: hypothetical protein 1-9, 0610008L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1891227
NCBI: 59022
Ensembl: ENSMUSG00000015092
VEGA: OTTMUSG00000012162
HGNC: HGNC:3164
Homologene: 2809
CCDS: CCDS15780.1
UCSC: Chr2:25557821-25562082
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Igkv9-123
Name: immunoglobulin kappa variable 9-123
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:3643848
NCBI: 628144
Ensembl: ENSMUSG00000076512
VEGA: OTTMUSG00000052575
UCSC: Chr6:67954230-67954690
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfp579
Name: zinc finger protein 579
Synonyms: 1110003A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1915740
NCBI: 68490
Ensembl: ENSMUSG00000051550
VEGA: OTTMUSG00000033386
HGNC: HGNC:26646
Homologene: 17629
CCDS: CCDS39744.1
UCSC: Chr7:4992852-4996101
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Inka1
Name: inka box actin regulator 1
Synonyms: Inka1, 6230427J02Rik, Fam212a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:1915426
NCBI: 68176
Ensembl: ENSMUSG00000042106
VEGA: OTTMUSG00000042013
HGNC: HGNC:32480
Homologene: 19818
CCDS: CCDS52919.1
UCSC: Chr9:107984223-107985916
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Krtap4-16
Name: keratin associated protein 4-16
Synonyms: OTTMUSG00000002196
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:3651030
NCBI: 435285
Ensembl: ENSMUSG00000046474
VEGA: OTTMUSG00000002196
HGNC: HGNC:18908
Homologene: 128438
CCDS: CCDS36326.1
UCSC: Chr11:99850655-99851605
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm10479
Name: predicted gene 10479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:3704385
NCBI: 108167321
Ensembl: ENSMUSG00000116606
VEGA: 12
UCSC: Chr12:20415521-20462084
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Krtap19-4
Name: keratin associated protein 19-4
Synonyms: Krtap16-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:2157757
NCBI: 170654
Ensembl: ENSMUSG00000043982
VEGA: 16
CCDS: CCDS37387.1
UCSC: Chr16:88884786-88885089
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tff1
Name: trefoil factor 1
Synonyms: Bcei, PS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:88135
NCBI: 21784
Ensembl: ENSMUSG00000024032
VEGA: OTTMUSG00000020096
HGNC: HGNC:11755
Homologene: 2426
CCDS: CCDS37546.1
UCSC: Chr17:31161395-31165062
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
- A to T, chromosome 1 at 75,309,414 bp
- C to T, chromosome 2 at 25,560,194 bp
- T to A, chromosome 2 at 36,053,077 bp
- G to A, chromosome 2 at 65,670,767 bp
- G to A, chromosome 2 at 102,834,252 bp
- G to T, chromosome 2 at 111,664,754 bp
- C to T, chromosome 2 at 120,030,108 bp
- A to T, chromosome 2 at 120,701,489 bp
- C to T, chromosome 3 at 79,737,769 bp
- G to A, chromosome 3 at 101,835,130 bp
- C to A, chromosome 3 at 108,325,699 bp
- A to G, chromosome 3 at 109,102,697 bp
- A to T, chromosome 4 at 11,281,020 bp
- A to G, chromosome 4 at 40,224,013 bp
- C to A, chromosome 4 at 121,065,804 bp
- T to A, chromosome 4 at 152,032,248 bp
- A to T, chromosome 4 at 154,335,261 bp
- G to A, chromosome 4 at 155,860,470 bp
- A to T, chromosome 4 at 156,222,381 bp
- A to T, chromosome 5 at 4,756,385 bp
- A to G, chromosome 5 at 9,427,832 bp
- C to T, chromosome 5 at 30,917,738 bp
- A to T, chromosome 5 at 34,636,750 bp
- A to G, chromosome 5 at 76,561,441 bp
- C to T, chromosome 5 at 81,771,617 bp
- T to A, chromosome 5 at 135,857,129 bp
- C to A, chromosome 5 at 147,367,055 bp
- A to T, chromosome 6 at 32,517,444 bp
- C to A, chromosome 6 at 66,804,911 bp
- C to A, chromosome 6 at 67,954,628 bp
- A to C, chromosome 6 at 91,074,282 bp
- A to C, chromosome 6 at 125,332,194 bp
- G to A, chromosome 7 at 4,993,770 bp
- A to T, chromosome 7 at 23,835,184 bp
- G to T, chromosome 7 at 26,835,546 bp
- G to A, chromosome 7 at 27,418,583 bp
- T to A, chromosome 7 at 109,898,613 bp
- T to A, chromosome 7 at 119,464,724 bp
- T to A, chromosome 8 at 63,927,392 bp
- T to C, chromosome 8 at 64,759,797 bp
- T to C, chromosome 8 at 66,877,659 bp
- T to C, chromosome 8 at 106,192,456 bp
- A to G, chromosome 9 at 7,052,655 bp
- T to C, chromosome 9 at 18,876,080 bp
- C to T, chromosome 9 at 44,384,182 bp
- A to T, chromosome 9 at 72,452,734 bp
- A to G, chromosome 9 at 107,984,739 bp
- A to G, chromosome 9 at 108,488,099 bp
- T to C, chromosome 9 at 112,127,398 bp
- C to A, chromosome 10 at 8,298,055 bp
- A to T, chromosome 10 at 41,424,581 bp
- T to C, chromosome 10 at 60,331,281 bp
- T to C, chromosome 10 at 77,564,790 bp
- T to C, chromosome 10 at 88,553,295 bp
- T to C, chromosome 10 at 111,275,049 bp
- A to T, chromosome 11 at 6,228,846 bp
- A to T, chromosome 11 at 83,946,132 bp
- G to A, chromosome 11 at 99,851,172 bp
- G to A, chromosome 11 at 105,147,041 bp
- A to T, chromosome 11 at 115,260,732 bp
- A to G, chromosome 12 at 20,433,653 bp
- T to A, chromosome 12 at 44,572,208 bp
- G to A, chromosome 12 at 56,858,087 bp
- G to T, chromosome 12 at 73,179,233 bp
- T to C, chromosome 12 at 100,407,002 bp
- T to A, chromosome 13 at 3,564,547 bp
- T to C, chromosome 13 at 22,502,143 bp
- T to A, chromosome 13 at 29,517,471 bp
- A to G, chromosome 13 at 67,751,628 bp
- A to T, chromosome 13 at 92,504,085 bp
- T to A, chromosome 14 at 12,091,410 bp
- C to T, chromosome 14 at 50,360,647 bp
- G to T, chromosome 14 at 70,616,060 bp
- T to C, chromosome 15 at 27,748,340 bp
- T to A, chromosome 15 at 35,430,205 bp
- A to T, chromosome 16 at 48,622,638 bp
- T to C, chromosome 16 at 49,867,806 bp
- A to G, chromosome 16 at 52,268,832 bp
- T to C, chromosome 16 at 63,602,288 bp
- C to A, chromosome 16 at 88,884,991 bp
- A to G, chromosome 17 at 28,165,975 bp
- A to T, chromosome 17 at 31,161,586 bp
- C to T, chromosome 17 at 36,285,871 bp
- G to T, chromosome 17 at 44,037,033 bp
- A to G, chromosome 17 at 46,503,097 bp
- GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
- G to T, chromosome 17 at 56,104,931 bp
- A to T, chromosome 17 at 71,387,006 bp
- A to T, chromosome 17 at 79,627,666 bp
- C to T, chromosome 18 at 31,594,588 bp
- T to C, chromosome 18 at 44,395,917 bp
- C to T, chromosome 19 at 4,294,883 bp
- A to T, chromosome 19 at 13,314,171 bp
- A to G, chromosome 19 at 25,132,235 bp
- T to C, chromosome 19 at 40,952,377 bp
- T to C, chromosome 19 at 44,998,020 bp
Genotype Determination
- Genotyping Protocol(s)
- Center protocol and contact for technical support will be shipped with mice.
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1803 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Colony Surveillance Program and Current Health Reports
Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
Click button to Request this one strain. (Use the
MMRRC Catalog Search to request more than one strain.)
| MMRRC Item # | Description | Distribution Fee / Unit (US $) | Units | Notes |
|---|---|---|---|---|
| 039833-MU-RESUS | Litter recovered from cryo-archive | $5,475.00 / Non-Profit | Litter | Recovered litter4; additional fees for any special requests. |
| Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information. | ||||
Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the
Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.