Strain Name:
Stock Number:
Citation ID:
Other Names:
R1803 (G1), C57BL/6J-MtgxR1803Btlr
Major Collection:

Gene Information

Name: zinc metallopeptidase, STE24
Synonyms: A530043O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230709
Homologene: 4277
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 80297
Homologene: 11879
Name: regulator of calcineurin 2
Synonyms: MCIP2, ZAKI-4, Csp2, Dscr1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 53901
VEGA: 17
Homologene: 130985
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20661
Homologene: 136097
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319504
VEGA: 12
Homologene: 21041
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70673
Homologene: 11139
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74100
Homologene: 32306
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319387
Homologene: 22878
Name: dematin actin binding protein
Synonyms: dematin, Epb4.9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13829
VEGA: 14
Homologene: 1496
Name: guanosine diphosphate (GDP) dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14569
VEGA: 13
Homologene: 37488
Name: oxysterol binding protein-like 8
Synonyms: ORP-8, D330025H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237542
VEGA: 10
Homologene: 68813
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19270
Homologene: 2129
Name: CDK5 regulatory subunit associated protein 1-like 1
Synonyms: 6620401C13Rik, 1190005B03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 68916
Homologene: 9830
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74355
Homologene: 23665
Name: decapping mRNA 2
Synonyms: 2410015D23Rik, 5730537H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70640
Homologene: 13968
Name: laminin, beta 2
Synonyms: Lamb-2, Lams, npht
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16779
Homologene: 1723
Name: integrin beta 2
Synonyms: Mac-1 beta, 2E6, Cd18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16414
Homologene: 20092
Name: DExD box helicase 52
Synonyms: 2700029C06Rik, ROK1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78394
Homologene: 5093
Name: menage a trois 1
Synonyms: MAT1, E130115E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 17420
Homologene: 1821
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234344
Homologene: 128518
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Name: solute carrier family 25, member 46
Synonyms: 1200007B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67453
VEGA: 18
Homologene: 14518
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243743
Homologene: 77587
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NMDAR2C, NR2C, GluRepsilon3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14813
Homologene: 647
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666173
VEGA: 15
Homologene: 49516
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, D330044F14Rik, D030010H02Rik, 4432416O06Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
Homologene: 14468
Name: aspartyl aminopeptidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13437
Homologene: 6110
Name: microrchidia 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17450
VEGA: 16
Homologene: 7843
Name: kelch-like 2, Mayven
Synonyms: ABP-KELCH, 6030411N21Rik, Mav, 8530402H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 77113
Homologene: 21416
Name: tetratricopeptide repeat domain 7B
Synonyms: Ttc7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104718
VEGA: 12
Homologene: 14675
Name: exocyst complex component 1
Synonyms: Sec3p, SEC3, A730011E05Rik, 2810407P21Rik, Sec3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69940
Homologene: 41241
Name: dpy-19-like 4 (C. elegans)
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381510
Homologene: 18773
Name: FMS-like tyrosine kinase 3
Synonyms: CD135, Flk-2, Flt-3, Flk2, wmfl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14255
Homologene: 3040
Name: B cell linker
Synonyms: SLP-65, BCA, BASH, BLNK, Ly-57, Bca, Ly57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 17060
Homologene: 32038
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Name: uromodulin
Synonyms: Tamm-Horsfall glycoprotein, uromucoid, urehr4, Urehd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22242
Homologene: 2522
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 83771
Homologene: 12890
Name: cadherin 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22295
Homologene: 11142
Name: meiosis-specific nuclear structural protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17427
Homologene: 40628
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13837
VEGA: 16
Homologene: 21083
Name: serine/arginine repetitive matrix 3
Synonyms: 2900083I11Rik, SRm300-like, Srrm2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 58212
Homologene: 136723
Name: G protein-coupled receptor kinase 2
Synonyms: beta ARK, beta ARK1, beta-AR kinase-1, beta-adrenergic receptor kinase-1, Bark-1, Adrbk-1, betaARK1, Adrbk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 110355
Homologene: 1223
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78309
Homologene: 56696
Name: uronyl-2-sulfotransferase
Synonyms: D930010O20Rik, UA2OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 338362
VEGA: 10
Homologene: 4174
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110876
Homologene: 75001
Name: START domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668880
Homologene: 130712
Name: signal peptide, CUB domain, EGF-like 3
Synonyms: D030038I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268935
Homologene: 65059
Name: frizzled class receptor 1
Synonyms: FZ-1, Fz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14362
Homologene: 20750
Name: DENN/MADD domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19347
Homologene: 14584
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 633979
Homologene: 67934
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 6
Synonyms: LAT-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 330836
Homologene: 62496
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231014
Homologene: 27396
Name: sodium channel, nonvoltage-gated 1 alpha
Synonyms: mENaC, ENaC alpha, Scnn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20276
Homologene: 811
Name: myosin binding protein C, slow-type
Synonyms: Slow-type C-protein, 8030451F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 109272
Homologene: 1846
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239081
Homologene: 77905
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54563
Homologene: 41286
Name: relaxin/insulin-like family peptide receptor 1
Synonyms: LOC381489, Lgr7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 381489
Homologene: 11007
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 231002
Homologene: 12949
Name: NPC1 like intracellular cholesterol transporter 1
Synonyms: Niemann-Pick disease, type C1, 9130221N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237636
Homologene: 56585
Name: elastin microfibril interfacer 1
Synonyms: 5830419M17Rik, gp115, EMILIN-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100952
Homologene: 5117
Name: phospholipase A2, group IVB (cytosolic)
Synonyms: A030011C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 211429
Homologene: 3730
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Name: vomeronasal 1 receptor 39
Synonyms: Gm5993
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 546903
Homologene: 110800
Name: vomeronasal 1 receptor 176
Synonyms: Gm5998
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546943
Homologene: 128341
Name: zinc finger protein 85
Synonyms: Zfp71, KRAB19, Zfp85-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 22746
Homologene: 133709
Name: perilipin 4
Synonyms: S3-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57435
Homologene: 69311
Name: major facilitator superfamily domain containing 10
Synonyms: 0610009O03Rik, Tetran
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68294
Homologene: 871
Name: activated leukocyte cell adhesion molecule
Synonyms: DM-GRASP, CD166, MuSC, SC1, BEN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 11658
Homologene: 1229
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: olfactory receptor family 7 subfamily G member 18
Synonyms: GA_x6K02T2PVTD-12618399-12619337, MOR152-1, Olfr830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258559
Homologene: 79360
Name: solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Synonyms: 9930033G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217593
Homologene: 6988
Name: MORN repeat containing 5
Synonyms: 1700010A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75495
Homologene: 16510
Name: zinc finger, FYVE domain containing 16
Synonyms: B130024H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218441
Homologene: 8826
Name: DEAD/H box helicase 58
Synonyms: 6430573D20Rik, RIG-I, DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230073
Homologene: 32215
Name: RIKEN cDNA 4921513D11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Name: histocompatibility 2, M region locus 10.2
Synonyms: 4.7H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 333715
Homologene: 117973
Name: hypoxia up-regulated 1
Synonyms: CBP-140, Orp150, 140 kDa, Grp170, Cab140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12282
Homologene: 4658
Name: CD44 antigen
Synonyms: Ly-24, Pgp-1, HERMES
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12505
Homologene: 508
Name: solute carrier family 25, member 54
Synonyms: 4930443G12Rik, SCaMC-1like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74686
Homologene: 82464
Name: predicted gene 10842
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 26456
Homologene: 22682
Name: olfactory receptor family 5 subfamily B member 111
Synonyms: GA_x6K02T2RE5P-3645346-3644423, MOR202-28, Olfr1465
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258121
Name: olfactory receptor family 4 subfamily K member 49
Synonyms: GA_x6K02T2Q125-72715642-72716580, MOR248-8, Olfr1299
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258886
Homologene: 17426
Name: vomeronasal 1 receptor 202
Synonyms: V1ri7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171258
Homologene: 110880
Name: CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Synonyms: Itgp, 9130415E20Rik, B430305P08Rik, integrin-associated protein, IAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16423
Homologene: 1346
Name: cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms: Coh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13087
Homologene: 85917
Name: mab-21-like 3
Synonyms: BC037703
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242125
Homologene: 17564
Name: taste receptor, type 1, member 1
Synonyms: TR1, T1r1, Gpr70, T1R1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 110326
Homologene: 12888
Name: endothelial differentiation-related factor 1
Synonyms: hypothetical protein 1-9, 0610008L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 59022
Homologene: 2809
Name: immunoglobulin kappa variable 9-123
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 628144
Name: zinc finger protein 579
Synonyms: 1110003A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68490
Homologene: 17629
Name: inka box actin regulator 1
Synonyms: Inka1, 6230427J02Rik, Fam212a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68176
Homologene: 19818
Name: keratin associated protein 4-16
Synonyms: OTTMUSG00000002196
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 435285
Homologene: 128438
Name: predicted gene 10479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 108167321
VEGA: 12
Name: keratin associated protein 19-4
Synonyms: Krtap16-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 170654
VEGA: 16
Name: trefoil factor 1
Synonyms: Bcei, PS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21784
Homologene: 2426
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 75,309,414 bp
  • C to T, chromosome 2 at 25,560,194 bp
  • T to A, chromosome 2 at 36,053,077 bp
  • G to A, chromosome 2 at 65,670,767 bp
  • G to A, chromosome 2 at 102,834,252 bp
  • G to T, chromosome 2 at 111,664,754 bp
  • C to T, chromosome 2 at 120,030,108 bp
  • A to T, chromosome 2 at 120,701,489 bp
  • C to T, chromosome 3 at 79,737,769 bp
  • G to A, chromosome 3 at 101,835,130 bp
  • C to A, chromosome 3 at 108,325,699 bp
  • A to G, chromosome 3 at 109,102,697 bp
  • A to T, chromosome 4 at 11,281,020 bp
  • A to G, chromosome 4 at 40,224,013 bp
  • C to A, chromosome 4 at 121,065,804 bp
  • T to A, chromosome 4 at 152,032,248 bp
  • A to T, chromosome 4 at 154,335,261 bp
  • G to A, chromosome 4 at 155,860,470 bp
  • A to T, chromosome 4 at 156,222,381 bp
  • A to T, chromosome 5 at 4,756,385 bp
  • A to G, chromosome 5 at 9,427,832 bp
  • C to T, chromosome 5 at 30,917,738 bp
  • A to T, chromosome 5 at 34,636,750 bp
  • A to G, chromosome 5 at 76,561,441 bp
  • C to T, chromosome 5 at 81,771,617 bp
  • T to A, chromosome 5 at 135,857,129 bp
  • C to A, chromosome 5 at 147,367,055 bp
  • A to T, chromosome 6 at 32,517,444 bp
  • C to A, chromosome 6 at 66,804,911 bp
  • C to A, chromosome 6 at 67,954,628 bp
  • A to C, chromosome 6 at 91,074,282 bp
  • A to C, chromosome 6 at 125,332,194 bp
  • G to A, chromosome 7 at 4,993,770 bp
  • A to T, chromosome 7 at 23,835,184 bp
  • G to T, chromosome 7 at 26,835,546 bp
  • G to A, chromosome 7 at 27,418,583 bp
  • T to A, chromosome 7 at 109,898,613 bp
  • T to A, chromosome 7 at 119,464,724 bp
  • T to A, chromosome 8 at 63,927,392 bp
  • T to C, chromosome 8 at 64,759,797 bp
  • T to C, chromosome 8 at 66,877,659 bp
  • T to C, chromosome 8 at 106,192,456 bp
  • A to G, chromosome 9 at 7,052,655 bp
  • T to C, chromosome 9 at 18,876,080 bp
  • C to T, chromosome 9 at 44,384,182 bp
  • A to T, chromosome 9 at 72,452,734 bp
  • A to G, chromosome 9 at 107,984,739 bp
  • A to G, chromosome 9 at 108,488,099 bp
  • T to C, chromosome 9 at 112,127,398 bp
  • C to A, chromosome 10 at 8,298,055 bp
  • A to T, chromosome 10 at 41,424,581 bp
  • T to C, chromosome 10 at 60,331,281 bp
  • T to C, chromosome 10 at 77,564,790 bp
  • T to C, chromosome 10 at 88,553,295 bp
  • T to C, chromosome 10 at 111,275,049 bp
  • A to T, chromosome 11 at 6,228,846 bp
  • A to T, chromosome 11 at 83,946,132 bp
  • G to A, chromosome 11 at 99,851,172 bp
  • G to A, chromosome 11 at 105,147,041 bp
  • A to T, chromosome 11 at 115,260,732 bp
  • A to G, chromosome 12 at 20,433,653 bp
  • T to A, chromosome 12 at 44,572,208 bp
  • G to A, chromosome 12 at 56,858,087 bp
  • G to T, chromosome 12 at 73,179,233 bp
  • T to C, chromosome 12 at 100,407,002 bp
  • T to A, chromosome 13 at 3,564,547 bp
  • T to C, chromosome 13 at 22,502,143 bp
  • T to A, chromosome 13 at 29,517,471 bp
  • A to G, chromosome 13 at 67,751,628 bp
  • A to T, chromosome 13 at 92,504,085 bp
  • T to A, chromosome 14 at 12,091,410 bp
  • C to T, chromosome 14 at 50,360,647 bp
  • G to T, chromosome 14 at 70,616,060 bp
  • T to C, chromosome 15 at 27,748,340 bp
  • T to A, chromosome 15 at 35,430,205 bp
  • A to T, chromosome 16 at 48,622,638 bp
  • T to C, chromosome 16 at 49,867,806 bp
  • A to G, chromosome 16 at 52,268,832 bp
  • T to C, chromosome 16 at 63,602,288 bp
  • C to A, chromosome 16 at 88,884,991 bp
  • A to G, chromosome 17 at 28,165,975 bp
  • A to T, chromosome 17 at 31,161,586 bp
  • C to T, chromosome 17 at 36,285,871 bp
  • G to T, chromosome 17 at 44,037,033 bp
  • A to G, chromosome 17 at 46,503,097 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 56,104,931 bp
  • A to T, chromosome 17 at 71,387,006 bp
  • A to T, chromosome 17 at 79,627,666 bp
  • C to T, chromosome 18 at 31,594,588 bp
  • T to C, chromosome 18 at 44,395,917 bp
  • C to T, chromosome 19 at 4,294,883 bp
  • A to T, chromosome 19 at 13,314,171 bp
  • A to G, chromosome 19 at 25,132,235 bp
  • T to C, chromosome 19 at 40,952,377 bp
  • T to C, chromosome 19 at 44,998,020 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1803 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039833-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.