Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1803Btlr/Mmmh
Stock Number:
039833-MU
Citation ID:
RRID:MMRRC_039833-MU
Other Names:
R1803 (G1), C57BL/6J-MtgxR1803Btlr
Major Collection:

Strain Information

Zmpste24
Name: zinc metallopeptidase, STE24
Synonyms: A530043O15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230709
Homologene: 4277
Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Rcan2
Name: regulator of calcineurin 2
Synonyms: MCIP2, ZAKI-4, Csp2, Dscr1l1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53901
VEGA: 17
HGNC: HGNC:3041
Homologene: 130985
Sort1
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20661
Homologene: 136097
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 75,309,414 bp
  • C to T, chromosome 2 at 25,560,194 bp
  • T to A, chromosome 2 at 36,053,077 bp
  • G to A, chromosome 2 at 65,670,767 bp
  • G to A, chromosome 2 at 102,834,252 bp
  • G to T, chromosome 2 at 111,664,754 bp
  • C to T, chromosome 2 at 120,030,108 bp
  • A to T, chromosome 2 at 120,701,489 bp
  • C to T, chromosome 3 at 79,737,769 bp
  • G to A, chromosome 3 at 101,835,130 bp
  • C to A, chromosome 3 at 108,325,699 bp
  • A to G, chromosome 3 at 109,102,697 bp
  • A to T, chromosome 4 at 11,281,020 bp
  • A to G, chromosome 4 at 40,224,013 bp
  • C to A, chromosome 4 at 121,065,804 bp
  • T to A, chromosome 4 at 152,032,248 bp
  • A to T, chromosome 4 at 154,335,261 bp
  • G to A, chromosome 4 at 155,860,470 bp
  • A to T, chromosome 4 at 156,222,381 bp
  • A to T, chromosome 5 at 4,756,385 bp
  • A to G, chromosome 5 at 9,427,832 bp
  • C to T, chromosome 5 at 30,917,738 bp
  • A to T, chromosome 5 at 34,636,750 bp
  • A to G, chromosome 5 at 76,561,441 bp
  • C to T, chromosome 5 at 81,771,617 bp
  • T to A, chromosome 5 at 135,857,129 bp
  • C to A, chromosome 5 at 147,367,055 bp
  • A to T, chromosome 6 at 32,517,444 bp
  • C to A, chromosome 6 at 66,804,911 bp
  • C to A, chromosome 6 at 67,954,628 bp
  • A to C, chromosome 6 at 91,074,282 bp
  • A to C, chromosome 6 at 125,332,194 bp
  • G to A, chromosome 7 at 4,993,770 bp
  • A to T, chromosome 7 at 23,835,184 bp
  • G to T, chromosome 7 at 26,835,546 bp
  • G to A, chromosome 7 at 27,418,583 bp
  • T to A, chromosome 7 at 109,898,613 bp
  • T to A, chromosome 7 at 119,464,724 bp
  • T to A, chromosome 8 at 63,927,392 bp
  • T to C, chromosome 8 at 64,759,797 bp
  • T to C, chromosome 8 at 66,877,659 bp
  • T to C, chromosome 8 at 106,192,456 bp
  • A to G, chromosome 9 at 7,052,655 bp
  • T to C, chromosome 9 at 18,876,080 bp
  • C to T, chromosome 9 at 44,384,182 bp
  • A to T, chromosome 9 at 72,452,734 bp
  • A to G, chromosome 9 at 107,984,739 bp
  • A to G, chromosome 9 at 108,488,099 bp
  • T to C, chromosome 9 at 112,127,398 bp
  • C to A, chromosome 10 at 8,298,055 bp
  • A to T, chromosome 10 at 41,424,581 bp
  • T to C, chromosome 10 at 60,331,281 bp
  • T to C, chromosome 10 at 77,564,790 bp
  • T to C, chromosome 10 at 88,553,295 bp
  • T to C, chromosome 10 at 111,275,049 bp
  • A to T, chromosome 11 at 6,228,846 bp
  • A to T, chromosome 11 at 83,946,132 bp
  • G to A, chromosome 11 at 99,851,172 bp
  • G to A, chromosome 11 at 105,147,041 bp
  • A to T, chromosome 11 at 115,260,732 bp
  • A to G, chromosome 12 at 20,433,653 bp
  • T to A, chromosome 12 at 44,572,208 bp
  • G to A, chromosome 12 at 56,858,087 bp
  • G to T, chromosome 12 at 73,179,233 bp
  • T to C, chromosome 12 at 100,407,002 bp
  • T to A, chromosome 13 at 3,564,547 bp
  • T to C, chromosome 13 at 22,502,143 bp
  • T to A, chromosome 13 at 29,517,471 bp
  • A to G, chromosome 13 at 67,751,628 bp
  • A to T, chromosome 13 at 92,504,085 bp
  • T to A, chromosome 14 at 12,091,410 bp
  • C to T, chromosome 14 at 50,360,647 bp
  • G to T, chromosome 14 at 70,616,060 bp
  • T to C, chromosome 15 at 27,748,340 bp
  • T to A, chromosome 15 at 35,430,205 bp
  • A to T, chromosome 16 at 48,622,638 bp
  • T to C, chromosome 16 at 49,867,806 bp
  • A to G, chromosome 16 at 52,268,832 bp
  • T to C, chromosome 16 at 63,602,288 bp
  • C to A, chromosome 16 at 88,884,991 bp
  • A to G, chromosome 17 at 28,165,975 bp
  • A to T, chromosome 17 at 31,161,586 bp
  • C to T, chromosome 17 at 36,285,871 bp
  • G to T, chromosome 17 at 44,037,033 bp
  • A to G, chromosome 17 at 46,503,097 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 56,104,931 bp
  • A to T, chromosome 17 at 71,387,006 bp
  • A to T, chromosome 17 at 79,627,666 bp
  • C to T, chromosome 18 at 31,594,588 bp
  • T to C, chromosome 18 at 44,395,917 bp
  • C to T, chromosome 19 at 4,294,883 bp
  • A to T, chromosome 19 at 13,314,171 bp
  • A to G, chromosome 19 at 25,132,235 bp
  • T to C, chromosome 19 at 40,952,377 bp
  • T to C, chromosome 19 at 44,998,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1803 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039833-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.