Strain Name:
C57BL/6J-MtgxR1803Btlr/Mmmh
Stock Number:
039833-MU
Citation ID:
RRID:MMRRC_039833-MU
Other Names:
R1803 (G1), C57BL/6J-MtgxR1803Btlr
Major Collection:

Gene Information

Zmpste24
Name: zinc metallopeptidase, STE24
Synonyms: A530043O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230709
Homologene: 4277
Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: ROSA62, 1700022P15Rik, nmf261, Spnb4, 5830426A08Rik, dyn, neuroaxonal dystrophy, SpbIV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 80297
Homologene: 11879
Rcan2
Name: regulator of calcineurin 2
Synonyms: Csp2, ZAKI-4, Dscr1l1, MCIP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 53901
VEGA: 17
HGNC: HGNC:3041
Homologene: 130985
Sort1
Name: sortilin 1
Synonyms: Ntr3, neurotensin receptor 3, 2900053A11Rik, sortilin, Ntsr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 20661
Homologene: 136097
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: C030017F07Rik, Bravo, C130076O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, line 27, 5730557K01Rik, csp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 70673
Homologene: 11139
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: R3hdm3, 0710001E13Rik, D9Bwg1012e, Tarpp, ARPP-21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 74100
Homologene: 32306
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: D130075K09Rik, 5430402I23Rik, LEC3, lectomedin 3, Lphn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 319387
Homologene: 22878
Dmtn
Name: dematin actin binding protein
Synonyms: Epb4.9, dematin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 13829
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
Gdi2
Name: guanosine diphosphate (GDP) dissociation inhibitor 2
Synonyms: GDI beta, GDIB, Gdi3, GDI-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: ORP-8, D330025H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237542
VEGA: 10
Homologene: 68813
Ptprg
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: RPTPgamma, 5430405N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Cdkal1
Name: CDK5 regulatory subunit associated protein 1-like 1
Synonyms: 6620401C13Rik, 1190005B03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 68916
Homologene: 9830
Smchd1
Name: SMC hinge domain containing 1
Synonyms: MommeD1, 4931400A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 74355
Homologene: 23665
Dcp2
Name: decapping mRNA 2
Synonyms: 2410015D23Rik, 5730537H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 70640
Homologene: 13968
Lamb2
Name: laminin, beta 2
Synonyms: Lamb-2, npht, Lams
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Itgb2
Name: integrin beta 2
Synonyms: Cd18, 2E6, Mac-1 beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 16414
HGNC: HGNC:6155
Homologene: 20092
Ddx52
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Synonyms: 2700029C06Rik, ROK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 78394
Homologene: 5093
Mnat1
Name: menage a trois 1
Synonyms: E130115E11Rik, MAT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 17420
HGNC: HGNC:7181
Homologene: 1821
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234344
Homologene: 128518
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: Solo, 6720464I07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223435
VEGA: 15
Homologene: 20847
Slc25a46
Name: solute carrier family 25, member 46
Synonyms: 1200007B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 67453
VEGA: 18
Homologene: 14518
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: GluRepsilon3, NR2C, NMDAR2C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 2310042E16Rik, Coh1, 1810042B05Rik, C330002D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: 4432416O06Rik, DHC2, b2b414Clo, Dnchc2, m407Asp, m152Asp, D030010H02Rik, D330044F14Rik, DHC1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Dnpep
Name: aspartyl aminopeptidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13437
HGNC: HGNC:2981
Homologene: 6110
Morc1
Name: microrchidia 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 17450
VEGA: 16
HGNC: HGNC:7198
Homologene: 7843
Klhl2
Name: kelch-like 2, Mayven
Synonyms: 8530402H02Rik, ABP-KELCH, Mav, 6030411N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 77113
HGNC: HGNC:6353
Homologene: 21416
Ttc7b
Name: tetratricopeptide repeat domain 7B
Synonyms: Ttc7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 104718
VEGA: 12
Homologene: 14675
Exoc1
Name: exocyst complex component 1
Synonyms: Sec3p, Sec3l1, 2810407P21Rik, SEC3, A730011E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 69940
Homologene: 41241
Dpy19l4
Name: dpy-19-like 4 (C. elegans)
Synonyms: Narg3, LOC381510
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 381510
Homologene: 18773
Flt3
Name: FMS-like tyrosine kinase 3
Synonyms: Flk2, wmfl, Flt-3, CD135, Flk-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 14255
HGNC: HGNC:3765
Homologene: 3040
Blnk
Name: B cell linker
Synonyms: Bca, Ly-57, SLP-65, BCA, BASH, BLNK, Ly57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 17060
Homologene: 32038
Dock8
Name: dedicator of cytokinesis 8
Synonyms: A130095G14Rik, 1200017A24Rik, 5830472H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 76088
VEGA: 19
Homologene: 52414
Umod
Name: uromodulin
Synonyms: Tamm-Horsfall glycoprotein, uromucoid, Urehd1, urehr4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 22242
Homologene: 2522
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 83771
Homologene: 12890
Cdh23
Name: cadherin 23 (otocadherin)
Synonyms: USH1D, mdfw, ahl, nmf112, nmf181, nmf252, 4930542A03Rik, sals, bob
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 22295
Homologene: 11142
Mns1
Name: meiosis-specific nuclear structural protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 17427
Homologene: 40628
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, End3, Hek, Hek4, Cek4, Mek4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Srrm3
Name: serine/arginine repetitive matrix 3
Synonyms: SRm300-like, 2900083I11Rik, Srrm2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 58212
Homologene: 136723
Grk2
Name: G protein-coupled receptor kinase 2
Synonyms: Adrbk1, beta-adrenergic receptor kinase-1, Bark-1, betaARK1, beta ARK, beta ARK1, beta-AR kinase-1, Adrbk-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 110355
HGNC: HGNC:289
Homologene: 1223
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 78309
Homologene: 56696
Ust
Name: uronyl-2-sulfotransferase
Synonyms: UA2OST, D930010O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 338362
VEGA: 10
Homologene: 4174
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 110876
Homologene: 75001
Stard9
Name: START domain containing 9
Synonyms: E230025N21Rik, 4831403C07Rik, Kif16a, N-3 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 668880
Homologene: 130712
Scube3
Name: signal peptide, CUB domain, EGF-like 3
Synonyms: D030038I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 268935
Homologene: 65059
Fzd1
Name: frizzled class receptor 1
Synonyms: FZ-1, Fz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 14362
HGNC: HGNC:4038
Homologene: 20750
Dennd5a
Name: DENN/MADD domain containing 5A
Synonyms: ORF37, Rab6ip1, 1500012B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 19347
Homologene: 14584
Ak9
Name: adenylate kinase 9
Synonyms: Akd1, Akd2, Gm7127, LOC215946
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 633979
Homologene: 67934
Slc7a6
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 6
Synonyms: LAT-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 330836
Homologene: 62496
9330182L06Rik
Name: RIKEN cDNA 9330182L06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231014
Homologene: 27396
Scnn1a
Name: sodium channel, nonvoltage-gated 1 alpha
Synonyms: Scnn1, ENaC alpha, mENaC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 20276
Homologene: 811
Mybpc1
Name: myosin binding protein C, slow-type
Synonyms: Slow-type C-protein, 8030451F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 109272
HGNC: HGNC:7549
Homologene: 1846
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 239081
Homologene: 77905
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 54563
Homologene: 41286
Rxfp1
Name: relaxin/insulin-like family peptide receptor 1
Synonyms: Lgr7, LOC381489
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 381489
Homologene: 11007
Plekhn1
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 231002
VEGA: 4
Homologene: 12949
Npc1l1
Name: NPC1 like intracellular cholesterol transporter 1
Synonyms: Niemann-Pick disease, type C1, 9130221N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237636
HGNC: HGNC:7898
Homologene: 56585
Emilin1
Name: elastin microfibril interfacer 1
Synonyms: gp115, EMILIN-1, 5830419M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100952
Homologene: 5117
Pla2g4b
Name: phospholipase A2, group IVB (cytosolic)
Synonyms: A030011C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 211429
HGNC: HGNC:9036
Homologene: 3730
AC149051.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
Vmn1r39
Name: vomeronasal 1 receptor 39
Synonyms: Gm5993
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 546903
Homologene: 110800
Vmn1r176
Name: vomeronasal 1 receptor 176
Synonyms: Gm5998
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 546943
Homologene: 128341
Zfp85
Name: zinc finger protein 85
Synonyms: Zfp71, Zfp85-rs1, KRAB19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 22746
Homologene: 133709
Plin4
Name: perilipin 4
Synonyms: S3-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 57435
Homologene: 69311
Mfsd10
Name: major facilitator superfamily domain containing 10
Synonyms: 0610009O03Rik, Tetran
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 68294
Homologene: 871
Alcam
Name: activated leukocyte cell adhesion molecule
Synonyms: BEN, SC1, CD166, DM-GRASP, MuSC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 11658
HGNC: HGNC:400
Homologene: 1229
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, Kv12.1, ELK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 211468
Homologene: 14332
Olfr830
Name: olfactory receptor 830
Synonyms: GA_x6K02T2PVTD-12618399-12619337, MOR152-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258559
Homologene: 79360
Slc25a21
Name: solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Synonyms: 9930033G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 217593
Homologene: 6988
Morn5
Name: MORN repeat containing 5
Synonyms: 1700010A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 75495
Homologene: 16510
Zfyve16
Name: zinc finger, FYVE domain containing 16
Synonyms: B130024H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218441
Homologene: 8826
Ddx58
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Synonyms: 6430573D20Rik, RIG-I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230073
Homologene: 32215
4921513D11Rik
Name: RIKEN cDNA 4921513D11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
H2-M10.2
Name: histocompatibility 2, M region locus 10.2
Synonyms: 4.7H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 333715
Homologene: 117973
Hyou1
Name: hypoxia up-regulated 1
Synonyms: Cab140, Grp170, Orp150, CBP-140, 140 kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12282
Homologene: 4658
Cd44
Name: CD44 antigen
Synonyms: Pgp-1, Ly-24, HERMES
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12505
HGNC: HGNC:1681
Homologene: 508
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: 4930443G12Rik, SCaMC-1like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74686
Homologene: 82464
Gm10842
Name: predicted gene 10842
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
Sema4g
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 26456
Homologene: 22682
Olfr1465
Name: olfactory receptor 1465
Synonyms: GA_x6K02T2RE5P-3645346-3644423, MOR202-28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 258121
Olfr1299
Name: olfactory receptor 1299
Synonyms: MOR248-8, GA_x6K02T2Q125-72715642-72716580
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258886
Homologene: 17426
Vmn1r202
Name: vomeronasal 1 receptor 202
Synonyms: V1ri7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 171258
Homologene: 110880
Cd47
Name: CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Synonyms: integrin-associated protein, Itgp, B430305P08Rik, 9130415E20Rik, IAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 16423
HGNC: HGNC:1682
Homologene: 1346
Cyp2a5
Name: cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms: Coh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 13087
Homologene: 85917
Mab21l3
Name: mab-21-like 3
Synonyms: BC037703
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 242125
Homologene: 17564
Tas1r1
Name: taste receptor, type 1, member 1
Synonyms: TR1, T1r1, T1R1, Gpr70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 110326
Homologene: 12888
Edf1
Name: endothelial differentiation-related factor 1
Synonyms: hypothetical protein 1-9, 0610008L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 59022
HGNC: HGNC:3164
Homologene: 2809
Igkv9-123
Name: immunoglobulin kappa variable 9-123
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 628144
Zfp579
Name: zinc finger protein 579
Synonyms: 1110003A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 68490
Homologene: 17629
Inka1
Name: inka box actin regulator 1
Synonyms: Inka1, 6230427J02Rik, Fam212a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 68176
Homologene: 19818
Krtap4-16
Name: keratin associated protein 4-16
Synonyms: OTTMUSG00000002196
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 435285
Homologene: 128438
Gm10479
Name: predicted gene 10479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 108167321
VEGA: 12
Krtap19-4
Name: keratin associated protein 19-4
Synonyms: Krtap16-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 170654
VEGA: 16
Tff1
Name: trefoil factor 1
Synonyms: Bcei, PS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 21784
Homologene: 2426
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 75,309,414 bp
  • C to T, chromosome 2 at 25,560,194 bp
  • T to A, chromosome 2 at 36,053,077 bp
  • G to A, chromosome 2 at 65,670,767 bp
  • G to A, chromosome 2 at 102,834,252 bp
  • G to T, chromosome 2 at 111,664,754 bp
  • C to T, chromosome 2 at 120,030,108 bp
  • A to T, chromosome 2 at 120,701,489 bp
  • C to T, chromosome 3 at 79,737,769 bp
  • G to A, chromosome 3 at 101,835,130 bp
  • C to A, chromosome 3 at 108,325,699 bp
  • A to G, chromosome 3 at 109,102,697 bp
  • A to T, chromosome 4 at 11,281,020 bp
  • A to G, chromosome 4 at 40,224,013 bp
  • C to A, chromosome 4 at 121,065,804 bp
  • T to A, chromosome 4 at 152,032,248 bp
  • A to T, chromosome 4 at 154,335,261 bp
  • G to A, chromosome 4 at 155,860,470 bp
  • A to T, chromosome 4 at 156,222,381 bp
  • A to T, chromosome 5 at 4,756,385 bp
  • A to G, chromosome 5 at 9,427,832 bp
  • C to T, chromosome 5 at 30,917,738 bp
  • A to T, chromosome 5 at 34,636,750 bp
  • A to G, chromosome 5 at 76,561,441 bp
  • C to T, chromosome 5 at 81,771,617 bp
  • T to A, chromosome 5 at 135,857,129 bp
  • C to A, chromosome 5 at 147,367,055 bp
  • A to T, chromosome 6 at 32,517,444 bp
  • C to A, chromosome 6 at 66,804,911 bp
  • C to A, chromosome 6 at 67,954,628 bp
  • A to C, chromosome 6 at 91,074,282 bp
  • A to C, chromosome 6 at 125,332,194 bp
  • G to A, chromosome 7 at 4,993,770 bp
  • A to T, chromosome 7 at 23,835,184 bp
  • G to T, chromosome 7 at 26,835,546 bp
  • G to A, chromosome 7 at 27,418,583 bp
  • T to A, chromosome 7 at 109,898,613 bp
  • T to A, chromosome 7 at 119,464,724 bp
  • T to A, chromosome 8 at 63,927,392 bp
  • T to C, chromosome 8 at 64,759,797 bp
  • T to C, chromosome 8 at 66,877,659 bp
  • T to C, chromosome 8 at 106,192,456 bp
  • A to G, chromosome 9 at 7,052,655 bp
  • T to C, chromosome 9 at 18,876,080 bp
  • C to T, chromosome 9 at 44,384,182 bp
  • A to T, chromosome 9 at 72,452,734 bp
  • A to G, chromosome 9 at 107,984,739 bp
  • A to G, chromosome 9 at 108,488,099 bp
  • T to C, chromosome 9 at 112,127,398 bp
  • C to A, chromosome 10 at 8,298,055 bp
  • A to T, chromosome 10 at 41,424,581 bp
  • T to C, chromosome 10 at 60,331,281 bp
  • T to C, chromosome 10 at 77,564,790 bp
  • T to C, chromosome 10 at 88,553,295 bp
  • T to C, chromosome 10 at 111,275,049 bp
  • A to T, chromosome 11 at 6,228,846 bp
  • A to T, chromosome 11 at 83,946,132 bp
  • G to A, chromosome 11 at 99,851,172 bp
  • G to A, chromosome 11 at 105,147,041 bp
  • A to T, chromosome 11 at 115,260,732 bp
  • A to G, chromosome 12 at 20,433,653 bp
  • T to A, chromosome 12 at 44,572,208 bp
  • G to A, chromosome 12 at 56,858,087 bp
  • G to T, chromosome 12 at 73,179,233 bp
  • T to C, chromosome 12 at 100,407,002 bp
  • T to A, chromosome 13 at 3,564,547 bp
  • T to C, chromosome 13 at 22,502,143 bp
  • T to A, chromosome 13 at 29,517,471 bp
  • A to G, chromosome 13 at 67,751,628 bp
  • A to T, chromosome 13 at 92,504,085 bp
  • T to A, chromosome 14 at 12,091,410 bp
  • C to T, chromosome 14 at 50,360,647 bp
  • G to T, chromosome 14 at 70,616,060 bp
  • T to C, chromosome 15 at 27,748,340 bp
  • T to A, chromosome 15 at 35,430,205 bp
  • A to T, chromosome 16 at 48,622,638 bp
  • T to C, chromosome 16 at 49,867,806 bp
  • A to G, chromosome 16 at 52,268,832 bp
  • T to C, chromosome 16 at 63,602,288 bp
  • C to A, chromosome 16 at 88,884,991 bp
  • A to G, chromosome 17 at 28,165,975 bp
  • A to T, chromosome 17 at 31,161,586 bp
  • C to T, chromosome 17 at 36,285,871 bp
  • G to T, chromosome 17 at 44,037,033 bp
  • A to G, chromosome 17 at 46,503,097 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 56,104,931 bp
  • A to T, chromosome 17 at 71,387,006 bp
  • A to T, chromosome 17 at 79,627,666 bp
  • C to T, chromosome 18 at 31,594,588 bp
  • T to C, chromosome 18 at 44,395,917 bp
  • C to T, chromosome 19 at 4,294,883 bp
  • A to T, chromosome 19 at 13,314,171 bp
  • A to G, chromosome 19 at 25,132,235 bp
  • T to C, chromosome 19 at 40,952,377 bp
  • T to C, chromosome 19 at 44,998,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1803 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039833-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.