Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1804Btlr/Mmmh
Stock Number:
039834-MU
Citation ID:
RRID:MMRRC_039834-MU
Other Names:
R1804 (G1), C57BL/6J-MtgxR1804Btlr
Major Collection:

Strain Information

Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Tesk2
Name: testis-specific kinase 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230661
Homologene: 5188
Dmtn
Name: dematin actin binding protein
Synonyms: dematin, Epb4.9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13829
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Acly
Name: ATP citrate lyase
Synonyms: A730098H14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104112
HGNC: HGNC:115
Homologene: 854
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 11,132,342 bp
  • A to G, chromosome 1 at 75,551,717 bp
  • A to G, chromosome 1 at 184,033,203 bp
  • A to G, chromosome 1 at 184,787,847 bp
  • G to A, chromosome 1 at 188,633,729 bp
  • T to C, chromosome 2 at 28,680,218 bp
  • A to G, chromosome 2 at 29,811,267 bp
  • G to T, chromosome 2 at 86,160,073 bp
  • T to C, chromosome 2 at 111,269,930 bp
  • T to C, chromosome 2 at 112,757,715 bp
  • T to G, chromosome 3 at 83,910,479 bp
  • A to G, chromosome 3 at 103,987,567 bp
  • A to G, chromosome 4 at 12,045,789 bp
  • A to G, chromosome 4 at 86,576,444 bp
  • T to A, chromosome 4 at 106,694,392 bp
  • T to C, chromosome 4 at 111,982,012 bp
  • T to C, chromosome 4 at 116,800,621 bp
  • G to A, chromosome 4 at 155,860,470 bp
  • A to T, chromosome 5 at 6,771,756 bp
  • A to G, chromosome 5 at 32,353,697 bp
  • A to G, chromosome 5 at 65,379,853 bp
  • A to G, chromosome 5 at 76,636,932 bp
  • T to C, chromosome 5 at 84,331,815 bp
  • C to T, chromosome 6 at 8,164,612 bp
  • G to A, chromosome 6 at 42,818,221 bp
  • T to A, chromosome 6 at 47,945,885 bp
  • T to C, chromosome 6 at 52,202,648 bp
  • T to C, chromosome 6 at 83,060,322 bp
  • G to A, chromosome 6 at 118,687,046 bp
  • G to T, chromosome 6 at 123,230,022 bp
  • A to G, chromosome 6 at 132,755,525 bp
  • T to C, chromosome 7 at 28,086,139 bp
  • T to C, chromosome 7 at 46,120,479 bp
  • C to A, chromosome 7 at 81,023,695 bp
  • T to C, chromosome 7 at 127,595,948 bp
  • G to T, chromosome 7 at 133,678,882 bp
  • A to C, chromosome 7 at 137,200,521 bp
  • A to G, chromosome 7 at 141,863,780 bp
  • G to A, chromosome 7 at 142,211,938 bp
  • C to A, chromosome 8 at 14,727,809 bp
  • A to T, chromosome 8 at 128,988,766 bp
  • A to G, chromosome 9 at 38,930,650 bp
  • T to C, chromosome 9 at 45,242,958 bp
  • T to A, chromosome 9 at 86,783,417 bp
  • T to C, chromosome 9 at 89,152,060 bp
  • T to A, chromosome 9 at 89,603,099 bp
  • A to G, chromosome 9 at 100,951,596 bp
  • C to T, chromosome 9 at 107,976,425 bp
  • A to C, chromosome 10 at 13,171,268 bp
  • A to G, chromosome 11 at 6,338,565 bp
  • A to G, chromosome 11 at 78,273,469 bp
  • T to C, chromosome 11 at 100,515,905 bp
  • T to C, chromosome 12 at 24,708,612 bp
  • A to G, chromosome 12 at 80,339,829 bp
  • T to A, chromosome 12 at 104,118,416 bp
  • T to A, chromosome 13 at 59,642,389 bp
  • A to T, chromosome 14 at 50,083,902 bp
  • A to T, chromosome 14 at 54,857,141 bp
  • A to T, chromosome 14 at 55,629,456 bp
  • G to T, chromosome 14 at 70,616,060 bp
  • A to G, chromosome 15 at 5,178,778 bp
  • A to T, chromosome 15 at 35,917,137 bp
  • C to T, chromosome 15 at 39,437,043 bp
  • T to A, chromosome 15 at 74,529,540 bp
  • A to T, chromosome 15 at 85,127,790 bp
  • T to A, chromosome 17 at 30,708,407 bp
  • T to A, chromosome 17 at 30,930,713 bp
  • T to C, chromosome 17 at 35,263,552 bp
  • T to C, chromosome 17 at 46,961,486 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to G, chromosome 18 at 5,213,689 bp
  • C to T, chromosome 18 at 12,223,088 bp
  • T to A, chromosome 18 at 50,090,661 bp
  • A to T, chromosome 18 at 50,177,984 bp
  • A to T, chromosome 18 at 63,865,440 bp
  • A to T, chromosome 19 at 8,773,634 bp
  • G to T, chromosome 19 at 12,618,420 bp
  • T to A, chromosome 19 at 55,210,309 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1804 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039834-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.