Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1804Btlr/Mmmh
Stock Number:
039834-MU
Citation ID:
RRID:MMRRC_039834-MU
Other Names:
R1804 (G1), C57BL/6J-MtgxR1804Btlr
Major Collection:

Strain Information

Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Tesk2
Name: testis-specific kinase 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230661
Homologene: 5188
Dmtn
Name: dematin actin binding protein
Synonyms: dematin, Epb4.9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13829
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Acly
Name: ATP citrate lyase
Synonyms: A730098H14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104112
HGNC: HGNC:115
Homologene: 854
Rnf40
Name: ring finger protein 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233900
Homologene: 8856
Hsd17b4
Name: hydroxysteroid (17-beta) dehydrogenase 4
Synonyms: 17[b]-HSD, MFE-2, perMFE-2, multifunctional protein 2, D-bifunctional protein, Mfp-2, MFP2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15488
HGNC: HGNC:5213
Homologene: 358
Wdr7
Name: WD repeat domain 7
Synonyms: TGF-beta resistance associated gene, TRAG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Ogdh
Name: oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms: alpha-ketoglutarate dehydrogenase, 2210412K19Rik, 2210403E04Rik, d1401
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18293
HGNC: HGNC:8124
Homologene: 55662
Stag1
Name: STAG1 cohesin complex component
Synonyms: SA-1, Scc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20842
Homologene: 21191
Rraga
Name: Ras-related GTP binding A
Synonyms: FIP-1, 1300010C19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68441
Homologene: 68522
Rims2
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, 2810036I15Rik, Syt3-rs
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Cep135
Name: centrosomal protein 135
Synonyms: LOC381644, Cep4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381644
Homologene: 45709
Snap91
Name: synaptosomal-associated protein 91
Synonyms: F1-20, 91kDa, AP180
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20616
Homologene: 8429
Hoxa5
Name: homeobox A5
Synonyms: Hox-1.3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15402
HGNC: HGNC:5106
Homologene: 40726
Minar1
Name: membrane integral NOTCH2 associated receptor 1
Synonyms: DD1, AF529169
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209743
Homologene: 17782
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Npc1
Name: NPC intracellular cholesterol transporter 1
Synonyms: D18Ertd723e, D18Ertd139e, C85354, lcsd, A430089E03Rik, nmf164
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18145
HGNC: HGNC:7897
Homologene: 228
Zfp592
Name: zinc finger protein 592
Synonyms: A730014M16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233410
Homologene: 8759
Ebf3
Name: early B cell factor 3
Synonyms: O/E-2, Olf-1/EBF-like 2, 3110018A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13593
Homologene: 56472
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Golm1
Name: golgi membrane protein 1
Synonyms: D030064E01Rik, PSEC0257, GP73, 2310001L02Rik, Golph2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105348
VEGA: 13
Homologene: 12346
Tsc1
Name: TSC complex subunit 1
Synonyms: hamartin, tuberous sclerosis 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64930
Homologene: 314
Prkaa1
Name: protein kinase, AMP-activated, alpha 1 catalytic subunit
Synonyms: C130083N04Rik, AMPKalpha1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105787
VEGA: 15
HGNC: HGNC:9376
Homologene: 49590
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229473
Homologene: 9057
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83771
Homologene: 12890
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Epha5
Name: Eph receptor A5
Synonyms: Cek7, bsk, Els1, Rek7, Hek7, Ehk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Tas2r124
Name: taste receptor, type 2, member 124
Synonyms: Tas2r24, mGR24, mt2r50, T2R24
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387351
Homologene: 87293
Mroh7
Name: maestro heat-like repeat family member 7
Synonyms: LOC381538, Gm1027, Heatr8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381538
Homologene: 19633
Klb
Name: klotho beta
Synonyms: betaKlotho
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83379
Homologene: 12820
Col28a1
Name: collagen, type XXVIII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213945
Homologene: 66345
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Bltp2
Name: bridge-like lipid transfer protein family member 2
Synonyms: 2610507B11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72503
Homologene: 34730
Slc4a3
Name: solute carrier family 4 (anion exchanger), member 3
Synonyms: Ae3, A930038D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20536
Homologene: 129474
Plb1
Name: phospholipase B1
Synonyms: 4632413E21Rik, 4930433E17Rik, 4930539A06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665270
Homologene: 82108
Uba7
Name: ubiquitin-like modifier activating enzyme 7
Synonyms: 1300004C08Rik, Ube1l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74153
Homologene: 2502
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207618
Homologene: 52304
Dlgap2
Name: DLG associated protein 2
Synonyms: SAP90/PSD-95-associated protein 2, PSD-95/SAP90-binding protein 2, 6430596N04Rik, DAP2, Sapap2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244310
HGNC: HGNC:2906
Homologene: 3484
Gucy2g
Name: guanylate cyclase 2g
Synonyms: 2410077I05Rik, GC-G
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73707
Homologene: 44544
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Or5al1
Name: olfactory receptor family 5 subfamily AL member 1
Synonyms: GA_x6K02T2Q125-47629317-47628376, MOR185-10, Olfr1042
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257941
Homologene: 133665
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: SMC1beta, Smc1l2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Or8d23
Name: olfactory receptor family 8 subfamily D member 23
Synonyms: GA_x6K02T2PVTD-32626123-32627049, MOR171-46, Olfr930
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258269
VEGA: 9
HGNC: HGNC:8481
Homologene: 138304
Or4k35
Name: olfactory receptor family 4 subfamily K member 35
Synonyms: GA_x6K02T2Q125-72321818-72320907, MOR248-11, Olfr1277
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258391
Homologene: 105176
Glp1r
Name: glucagon-like peptide 1 receptor
Synonyms: GLP-1R, GLP1Rc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14652
VEGA: 17
HGNC: HGNC:4324
Homologene: 1558
Phtf1
Name: putative homeodomain transcription factor 1
Synonyms: Phft
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18685
HGNC: HGNC:8939
Homologene: 4817
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: B830018M07Rik, Bai1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Ipo4
Name: importin 4
Synonyms: 8430408O15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75751
Homologene: 5835
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1291.1Clo, b2b1163.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Zfp438
Name: zinc finger protein 438
Synonyms: 9430091M14Rik, B830013J05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240186
VEGA: 18
Homologene: 18695
Skint7
Name: selection and upkeep of intraepithelial T cells 7
Synonyms: C130057D23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 328505
Homologene: 106613
Or2q1
Name: olfactory receptor family 2 subfamily Q member 1
Synonyms: GA_x6K02T2P3E9-4742413-4741481, MOR257-3, Olfr450
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258437
Homologene: 51720
Dqx1
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93838
Homologene: 14143
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: 4930540C21Rik, 4930517G15Rik, Ccdc7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
4930579C12Rik
Name: RIKEN cDNA 4930579C12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319213
Gm4952
Name: predicted gene 4952
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240549
Homologene: 72602
Or4k15c
Name: olfactory receptor family 4 subfamily K member 15C
Synonyms: GA_x6K02T2PMLR-5775299-5774334, MOR246-4, Olfr726
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258313
Homologene: 44957
1700056E22Rik
Name: RIKEN cDNA 1700056E22 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73363
Homologene: 137387
Mmp21
Name: matrix metallopeptidase 21
Synonyms: b2b873Clo, b2b2458Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214766
Homologene: 17519
Tmem179b
Name: transmembrane protein 179B
Synonyms: 1500003K22Rik, 0610031L02Rik, 1810059G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67706
VEGA: 19
Homologene: 12177
Zfp783
Name: zinc finger protein 783
Synonyms: ENSMUSG00000072653, A230106D06Rik, Gm20494
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232785
Clec4n
Name: C-type lectin domain family 4, member n
Synonyms: dectin-2, Clecsf10, Nkcl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56620
Homologene: 84615
Dcaf5
Name: DDB1 and CUL4 associated factor 5
Synonyms: BCRP2, BCRG2, 9430020B07Rik, Wdr22
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320808
VEGA: 12
Homologene: 18564
Serpina3a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms: 4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74069
HGNC: HGNC:16
Mtarc1
Name: mitochondrial amidoxime reducing component 1
Synonyms: 1300013F15Rik, Mosc1, Marc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66112
Homologene: 129604
Homez
Name: homeodomain leucine zipper-encoding gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239099
Homologene: 10828
Zc2hc1b
Name: zinc finger, C2HC-type containing 1B
Synonyms: 4930519B02Rik, Fam164b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75122
VEGA: 10
Homologene: 77965
Smim35
Name: small integral membrane protein 35
Synonyms: BC049352
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 408059
Homologene: 136435
Tnfaip8
Name: tumor necrosis factor, alpha-induced protein 8
Synonyms: Gg2-1, Ssc-2, Nded, E130304C20Rik, Gm10539, Tipe
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106869
Homologene: 8649
Rrm2
Name: ribonucleotide reductase M2
Synonyms: R2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20135
Homologene: 20277
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 11,132,342 bp
  • A to G, chromosome 1 at 75,551,717 bp
  • A to G, chromosome 1 at 184,033,203 bp
  • A to G, chromosome 1 at 184,787,847 bp
  • G to A, chromosome 1 at 188,633,729 bp
  • T to C, chromosome 2 at 28,680,218 bp
  • A to G, chromosome 2 at 29,811,267 bp
  • G to T, chromosome 2 at 86,160,073 bp
  • T to C, chromosome 2 at 111,269,930 bp
  • T to C, chromosome 2 at 112,757,715 bp
  • T to G, chromosome 3 at 83,910,479 bp
  • A to G, chromosome 3 at 103,987,567 bp
  • A to G, chromosome 4 at 12,045,789 bp
  • A to G, chromosome 4 at 86,576,444 bp
  • T to A, chromosome 4 at 106,694,392 bp
  • T to C, chromosome 4 at 111,982,012 bp
  • T to C, chromosome 4 at 116,800,621 bp
  • G to A, chromosome 4 at 155,860,470 bp
  • A to T, chromosome 5 at 6,771,756 bp
  • A to G, chromosome 5 at 32,353,697 bp
  • A to G, chromosome 5 at 65,379,853 bp
  • A to G, chromosome 5 at 76,636,932 bp
  • T to C, chromosome 5 at 84,331,815 bp
  • C to T, chromosome 6 at 8,164,612 bp
  • G to A, chromosome 6 at 42,818,221 bp
  • T to A, chromosome 6 at 47,945,885 bp
  • T to C, chromosome 6 at 52,202,648 bp
  • T to C, chromosome 6 at 83,060,322 bp
  • G to A, chromosome 6 at 118,687,046 bp
  • G to T, chromosome 6 at 123,230,022 bp
  • A to G, chromosome 6 at 132,755,525 bp
  • T to C, chromosome 7 at 28,086,139 bp
  • T to C, chromosome 7 at 46,120,479 bp
  • C to A, chromosome 7 at 81,023,695 bp
  • T to C, chromosome 7 at 127,595,948 bp
  • G to T, chromosome 7 at 133,678,882 bp
  • A to C, chromosome 7 at 137,200,521 bp
  • A to G, chromosome 7 at 141,863,780 bp
  • G to A, chromosome 7 at 142,211,938 bp
  • C to A, chromosome 8 at 14,727,809 bp
  • A to T, chromosome 8 at 128,988,766 bp
  • A to G, chromosome 9 at 38,930,650 bp
  • T to C, chromosome 9 at 45,242,958 bp
  • T to A, chromosome 9 at 86,783,417 bp
  • T to C, chromosome 9 at 89,152,060 bp
  • T to A, chromosome 9 at 89,603,099 bp
  • A to G, chromosome 9 at 100,951,596 bp
  • C to T, chromosome 9 at 107,976,425 bp
  • A to C, chromosome 10 at 13,171,268 bp
  • A to G, chromosome 11 at 6,338,565 bp
  • A to G, chromosome 11 at 78,273,469 bp
  • T to C, chromosome 11 at 100,515,905 bp
  • T to C, chromosome 12 at 24,708,612 bp
  • A to G, chromosome 12 at 80,339,829 bp
  • T to A, chromosome 12 at 104,118,416 bp
  • T to A, chromosome 13 at 59,642,389 bp
  • A to T, chromosome 14 at 50,083,902 bp
  • A to T, chromosome 14 at 54,857,141 bp
  • A to T, chromosome 14 at 55,629,456 bp
  • G to T, chromosome 14 at 70,616,060 bp
  • A to G, chromosome 15 at 5,178,778 bp
  • A to T, chromosome 15 at 35,917,137 bp
  • C to T, chromosome 15 at 39,437,043 bp
  • T to A, chromosome 15 at 74,529,540 bp
  • A to T, chromosome 15 at 85,127,790 bp
  • T to A, chromosome 17 at 30,708,407 bp
  • T to A, chromosome 17 at 30,930,713 bp
  • T to C, chromosome 17 at 35,263,552 bp
  • T to C, chromosome 17 at 46,961,486 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to G, chromosome 18 at 5,213,689 bp
  • C to T, chromosome 18 at 12,223,088 bp
  • T to A, chromosome 18 at 50,090,661 bp
  • A to T, chromosome 18 at 50,177,984 bp
  • A to T, chromosome 18 at 63,865,440 bp
  • A to T, chromosome 19 at 8,773,634 bp
  • G to T, chromosome 19 at 12,618,420 bp
  • T to A, chromosome 19 at 55,210,309 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1804 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039834-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.