Strain Name:
C57BL/6J-MtgxR1807Btlr/Mmmh
Stock Number:
039836-MU
Citation ID:
RRID:MMRRC_039836-MU
Other Names:
R1807 (G1), C57BL/6J-MtgxR1807Btlr
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Epha4
Name: Eph receptor A4
Synonyms: Hek8, Cek8, Sek, Sek1, rb, 2900005C20Rik, Tyro1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13838
HGNC: HGNC:3388
Homologene: 20933
Drd2
Name: dopamine receptor D2
Synonyms: Drd-2, D2 receptor, D2R
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Sparcl1
Name: SPARC-like 1
Synonyms: hevin, mast9, Sc1, Ecm2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13602
Homologene: 3438
Ctbp2
Name: C-terminal binding protein 2
Synonyms: Ribeye, D7Ertd45e, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
2310061I04Rik
Name: RIKEN cDNA 2310061I04 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69662
Homologene: 17027
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: 2810017C20Rik, E130319N12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: 3110054G10Rik, Tnrc6, 2010321I05Rik, CAGH26, D130023A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Rexo1
Name: REX1, RNA exonuclease 1
Synonyms: 2610511M11Rik, Tceb3bp1, Rex1, 1700021P10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66932
Homologene: 41391
Stag1
Name: STAG1 cohesin complex component
Synonyms: SA-1, Scc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20842
Homologene: 21191
Msr1
Name: macrophage scavenger receptor 1
Synonyms: Scara1, MSR-A, MRS-A, SR-AI, SR-AII, Scvr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20288
HGNC: HGNC:7376
Homologene: 12822
Ccdc6
Name: coiled-coil domain containing 6
Synonyms: 2810012H18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76551
Homologene: 34786
Zfp35
Name: zinc finger protein 35
Synonyms: Zfp-35
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22694
Homologene: 133081
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Srf
Name: serum response factor
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20807
VEGA: 17
Homologene: 31135
Chst3
Name: carbohydrate sulfotransferase 3
Synonyms: C6ST-1, GST-0, C6ST
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 53374
HGNC: HGNC:1971
Homologene: 3156
Rph3a
Name: rabphilin 3A
Synonyms: Doc2 family, 2900002P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19894
Homologene: 7921
Pard6b
Name: par-6 family cell polarity regulator beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58220
Homologene: 23302
Sema6a
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonyms: sema, VIa, Semaq, Sema6A-1, A730020P05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20358
Homologene: 32426
Recql5
Name: RecQ protein-like 5
Synonyms: Recq5b, Recql5b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170472
HGNC: HGNC:9950
Homologene: 31232
Cdk12
Name: cyclin dependent kinase 12
Synonyms: D11Ertd752e, 1810022J16Rik, Crkrs, Crk7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69131
Homologene: 128632
Eipr1
Name: EARP complex and GARP complex interacting protein 1
Synonyms: D12Ertd604e, Tssc1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380752
VEGA: 12
Homologene: 2481
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Kirrel, 6720469N11Rik, Kirrel1, Neph1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170643
Homologene: 10089
Tsc1
Name: TSC complex subunit 1
Synonyms: tuberous sclerosis 1, hamartin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64930
Homologene: 314
Prkaa1
Name: protein kinase, AMP-activated, alpha 1 catalytic subunit
Synonyms: C130083N04Rik, AMPKalpha1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105787
VEGA: 15
HGNC: HGNC:9376
Homologene: 49590
Tmem130
Name: transmembrane protein 130
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243339
Homologene: 17680
Nr2e1
Name: nuclear receptor subfamily 2, group E, member 1
Synonyms: Tlx, tailless, Nr2e1, Mtll
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21907
HGNC: HGNC:7973
Homologene: 37750
Rnf26rt
Name: ring finger protein 26, retrotransposed
Synonyms: Gm9008
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 668155
Adar
Name: adenosine deaminase, RNA-specific
Synonyms: Adar1p110, mZaADAR, ADAR1, Adar1p150
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56417
HGNC: HGNC:225
Homologene: 9281
Nphp3
Name: nephronophthisis 3 (adolescent)
Synonyms: nephrocystin 3, pcy, 3632410F03Rik, D330020E01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74025
HGNC: HGNC:7907
Homologene: 32697
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, neurojugin, catenin (cadherin associated protein), delta 2, Catnd2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Fat2
Name: FAT atypical cadherin 2
Synonyms: mKIAA0811, Fath2, LOC245827, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Fam135b
Name: family with sequence similarity 135, member B
Synonyms: 1700010C24Rik, A830008O07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70363
VEGA: 15
Homologene: 66605
Hsf5
Name: heat shock transcription factor family member 5
Synonyms: LOC327992
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327992
Homologene: 52701
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Atg9b
Name: autophagy related 9B
Synonyms: eONE, Nos3as, LOC213948, Apg9l2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213948
Homologene: 72638
Arsa
Name: arylsulfatase A
Synonyms: As-2, AS-A, As2, ASA
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11883
HGNC: HGNC:713
Homologene: 20138
Sobp
Name: sine oculis binding protein
Synonyms: 5330439J01Rik, 2900009C16Rik, jc, Jxc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109205
Homologene: 41216
Synpo2
Name: synaptopodin 2
Synonyms: 9530006G20Rik, 2310068J10Rik, myopodin, Myo, 1110069I04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 118449
Homologene: 15400
Nfic
Name: nuclear factor I/C
Synonyms: 1110019L22Rik, nuclear factor 1-C2, 1500041O16Rik, NF1-C
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18029
HGNC: HGNC:7786
Homologene: 4088
Me1
Name: malic enzyme 1, NADP(+)-dependent, cytosolic
Synonyms: Mdh-1, Mod-1, D9Ertd267e, Mod1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17436
HGNC: HGNC:6983
Homologene: 134785
Edn1
Name: endothelin 1
Synonyms: ET-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13614
VEGA: 13
HGNC: HGNC:3176
Homologene: 1476
Bcl3
Name: B cell leukemia/lymphoma 3
Synonyms: Bcl-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12051
HGNC: HGNC:998
Homologene: 81738
Cyria
Name: CYFIP related Rac1 interactor A
Synonyms: 2410157M17Rik, Fam49a, D12Ertd553e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76820
VEGA: 12
Homologene: 12657
Tmem143
Name: transmembrane protein 143
Synonyms: 2310076O21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70209
Homologene: 10105
Kif21b
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16565
Homologene: 56868
A3galt2
Name: alpha 1,3-galactosyltransferase 2
Synonyms: LOC215493, iGb3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 215493
Homologene: 16326
Erbb2
Name: erb-b2 receptor tyrosine kinase 2
Synonyms: Neu oncogene, ErbB-2, l11Jus8, c-neu, HER2, Neu, HER-2, c-erbB2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13866
HGNC: HGNC:3430
Homologene: 3273
4933430I17Rik
Name: RIKEN cDNA 4933430I17 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214106
Homologene: 51897
Dytn
Name: dystrotelin
Synonyms: LOC241073
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241073
Homologene: 104042
Cilp2
Name: cartilage intermediate layer protein 2
Synonyms: 1110031K21Rik, CLIP-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68709
Homologene: 17713
Klra5
Name: killer cell lectin-like receptor, subfamily A, member 5
Synonyms: Ly49e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16636
Homologene: 110821
Yju2b
Name: YJU2 splicing factor homolog B
Synonyms: Ccdc130, 4930527D15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67736
Homologene: 12183
D7Ertd443e
Name: DNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms: Fats, 4933400E14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71007
Homologene: 18998
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Smpdl3a
Name: sphingomyelin phosphodiesterase, acid-like 3A
Synonyms: ASM3A, ASML3A, 0610010C24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57319
Homologene: 4886
Lmtk3
Name: lemur tyrosine kinase 3
Synonyms: Aatyk3, AATYK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381983
Homologene: 79449
Or5t9
Name: olfactory receptor family 5 subfamily T member 9
Synonyms: MOR179-7, GA_x6K02T2Q125-48321457-48322449, Olfr1094
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258362
Homologene: 133609
Skint11
Name: selection and upkeep of intraepithelial T cells 11
Synonyms: A630098G03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230623
Homologene: 136292
Nt5el
Name: 5' nucleotidase, ecto-like
Synonyms: 4933425L06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66763
Homologene: 12028
Aldh1b1
Name: aldehyde dehydrogenase 1 family, member B1
Synonyms: 2700007F14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72535
HGNC: HGNC:407
Homologene: 115470
Trem1
Name: triggering receptor expressed on myeloid cells 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58217
Homologene: 10243
Dcst1
Name: DC-STAMP domain containing 1
Synonyms: A330106H01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77772
Homologene: 14981
Tlr12
Name: toll-like receptor 12
Synonyms: Tlr11, LOC384059
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384059
Homologene: 135964
Gm7713
Name: predicted gene 7713
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 665613
Spns3
Name: SPNS lysolipid transporter 3, sphingosine-1-phosphate (putative)
Synonyms: 9830002I17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77577
Homologene: 45648
Kcnk12
Name: potassium channel, subfamily K, member 12
Synonyms: mntk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210741
VEGA: 17
HGNC: HGNC:6274
Homologene: 11107
Depp1
Name: DEPP1 autophagy regulator
Synonyms: 8430408G22Rik, Depp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213393
Homologene: 48491
Akr1cl
Name: aldo-keto reductase family 1, member C-like
Synonyms: 4921521F21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70861
Homologene: 133861
Txndc9
Name: thioredoxin domain containing 9
Synonyms: ATP binding protein associated with cell differentiation, Apacd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98258
Homologene: 4225
Or52e19b
Name: olfactory receptor family 52 subfamily E member 19B
Synonyms: MOR32-2, MOR32-14_i, Olfr604, Olfr603, GA_x6K02T2PBJ9-6096387-6095449, GA_x6K02T2PBJ9-6092550-6092362
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259073
Homologene: 121535
Rapgefl1
Name: Rap guanine nucleotide exchange factor (GEF)-like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268480
Homologene: 41126
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 12,840,511 bp
  • T to A, chromosome 1 at 12,840,512 bp
  • A to T, chromosome 1 at 37,994,015 bp
  • G to A, chromosome 1 at 63,664,758 bp
  • T to C, chromosome 1 at 65,021,947 bp
  • G to A, chromosome 1 at 77,374,904 bp
  • T to A, chromosome 1 at 136,147,793 bp
  • A to G, chromosome 2 at 28,686,113 bp
  • T to A, chromosome 2 at 86,829,101 bp
  • A to G, chromosome 2 at 130,982,772 bp
  • T to C, chromosome 2 at 168,087,412 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • T to A, chromosome 3 at 89,353,541 bp
  • T to C, chromosome 3 at 89,734,865 bp
  • T to C, chromosome 3 at 123,080,257 bp
  • A to G, chromosome 4 at 45,802,873 bp
  • T to A, chromosome 4 at 62,542,756 bp
  • A to G, chromosome 4 at 63,331,349 bp
  • A to T, chromosome 4 at 113,479,795 bp
  • A to T, chromosome 4 at 114,194,696 bp
  • A to G, chromosome 4 at 116,310,741 bp
  • A to T, chromosome 4 at 128,617,436 bp
  • A to G, chromosome 4 at 128,767,601 bp
  • C to A, chromosome 5 at 24,387,057 bp
  • T to A, chromosome 5 at 104,085,761 bp
  • T to C, chromosome 5 at 120,945,393 bp
  • T to A, chromosome 5 at 144,755,364 bp
  • T to A, chromosome 6 at 70,572,702 bp
  • A to G, chromosome 6 at 76,497,414 bp
  • G to A, chromosome 6 at 116,651,722 bp
  • A to T, chromosome 6 at 129,899,420 bp
  • C to T, chromosome 7 at 19,820,034 bp
  • C to T, chromosome 7 at 45,793,278 bp
  • C to A, chromosome 7 at 45,897,613 bp
  • T to A, chromosome 7 at 103,383,583 bp
  • CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT, chromosome 7 at 123,162,446 bp
  • T to C, chromosome 7 at 133,014,408 bp
  • T to A, chromosome 7 at 134,293,305 bp
  • T to A, chromosome 7 at 138,395,097 bp
  • T to A, chromosome 8 at 39,619,907 bp
  • C to A, chromosome 8 at 69,882,194 bp
  • C to T, chromosome 8 at 84,260,307 bp
  • C to T, chromosome 9 at 49,405,067 bp
  • T to C, chromosome 9 at 80,143,635 bp
  • T to A, chromosome 9 at 86,650,879 bp
  • T to G, chromosome 9 at 100,908,666 bp
  • G to A, chromosome 9 at 104,020,741 bp
  • T to A, chromosome 10 at 42,582,909 bp
  • T to G, chromosome 10 at 43,160,826 bp
  • C to A, chromosome 10 at 57,801,022 bp
  • T to A, chromosome 10 at 60,186,308 bp
  • T to A, chromosome 10 at 70,175,159 bp
  • A to T, chromosome 10 at 80,542,579 bp
  • T to C, chromosome 10 at 81,404,985 bp
  • A to G, chromosome 11 at 9,291,755 bp
  • T to C, chromosome 11 at 55,289,259 bp
  • C to T, chromosome 11 at 72,538,340 bp
  • C to T, chromosome 11 at 87,657,342 bp
  • T to C, chromosome 11 at 98,210,377 bp
  • T to C, chromosome 11 at 98,428,854 bp
  • T to C, chromosome 11 at 98,845,989 bp
  • T to C, chromosome 11 at 115,895,115 bp
  • G to A, chromosome 12 at 12,361,504 bp
  • G to T, chromosome 12 at 28,766,839 bp
  • A to T, chromosome 12 at 51,627,203 bp
  • A to G, chromosome 13 at 42,306,794 bp
  • A to T, chromosome 13 at 105,082,236 bp
  • C to T, chromosome 14 at 7,934,645 bp
  • T to A, chromosome 15 at 5,143,954 bp
  • T to C, chromosome 15 at 30,619,871 bp
  • T to C, chromosome 15 at 59,994,471 bp
  • G to A, chromosome 15 at 71,463,912 bp
  • T to C, chromosome 15 at 89,475,322 bp
  • C to T, chromosome 17 at 35,895,069 bp
  • A to G, chromosome 17 at 46,553,759 bp
  • G to T, chromosome 17 at 48,241,635 bp
  • C to A, chromosome 17 at 87,746,040 bp
  • T to A, chromosome 18 at 24,003,929 bp
  • A to G, chromosome 18 at 47,276,424 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1807 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039836-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.