Strain Name:
C57BL/6J-MtgxR1807Btlr/Mmmh
Stock Number:
039836-MU
Citation ID:
RRID:MMRRC_039836-MU
Other Names:
R1807 (G1), C57BL/6J-MtgxR1807Btlr
Major Collection:

Gene Information

Gene Symbol: Atrn [MGI:1341628] (Mus musculus (mouse))
Name: attractin
Synonyms: Mgca
Chromosome: 2
Alteration at locus: Chemically Induced
Gene Symbol: Epha4 [MGI:98277] (Mus musculus (mouse))
Name: Eph receptor A4
Synonyms: Cek8, Tyro1, Hek8, rb, Sek, 2900005C20Rik, Sek1
Chromosome: 1
Alteration at locus: Chemically Induced
Gene Symbol: Drd2 [MGI:94924] (Mus musculus (mouse))
Name: dopamine receptor D2
Synonyms: D2 receptor, D2R, Drd-2
Chromosome: 9
Alteration at locus: Chemically Induced
Gene Symbol: Sparcl1 [MGI:108110] (Mus musculus (mouse))
Name: SPARC-like 1
Synonyms: mast9, Ecm2, hevin, Sc1
Chromosome: 5
Alteration at locus: Chemically Induced
Gene Symbol: Ctbp2 [MGI:1201686] (Mus musculus (mouse))
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Gtrgeo6, Ribeye
Chromosome: 7
Alteration at locus: Chemically Induced
Gene Symbol: 2310061I04Rik [MGI:1916912] (Mus musculus (mouse))
Name: RIKEN cDNA 2310061I04 gene
Chromosome: 17
Alteration at locus: Chemically Induced
Gene Symbol: Mast2 [MGI:894676] (Mus musculus (mouse))
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Chromosome: 4
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 12,840,511 bp
  • T to A, chromosome 1 at 12,840,512 bp
  • A to T, chromosome 1 at 37,994,015 bp
  • G to A, chromosome 1 at 63,664,758 bp
  • T to C, chromosome 1 at 65,021,947 bp
  • G to A, chromosome 1 at 77,374,904 bp
  • T to A, chromosome 1 at 136,147,793 bp
  • A to G, chromosome 2 at 28,686,113 bp
  • T to A, chromosome 2 at 86,829,101 bp
  • A to G, chromosome 2 at 130,982,772 bp
  • T to C, chromosome 2 at 168,087,412 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • T to A, chromosome 3 at 89,353,541 bp
  • T to C, chromosome 3 at 89,734,865 bp
  • T to C, chromosome 3 at 123,080,257 bp
  • A to G, chromosome 4 at 45,802,873 bp
  • T to A, chromosome 4 at 62,542,756 bp
  • A to G, chromosome 4 at 63,331,349 bp
  • A to T, chromosome 4 at 113,479,795 bp
  • A to T, chromosome 4 at 114,194,696 bp
  • A to G, chromosome 4 at 116,310,741 bp
  • A to T, chromosome 4 at 128,617,436 bp
  • A to G, chromosome 4 at 128,767,601 bp
  • C to A, chromosome 5 at 24,387,057 bp
  • T to A, chromosome 5 at 104,085,761 bp
  • T to C, chromosome 5 at 120,945,393 bp
  • T to A, chromosome 5 at 144,755,364 bp
  • T to A, chromosome 6 at 70,572,702 bp
  • A to G, chromosome 6 at 76,497,414 bp
  • G to A, chromosome 6 at 116,651,722 bp
  • A to T, chromosome 6 at 129,899,420 bp
  • C to T, chromosome 7 at 19,820,034 bp
  • C to T, chromosome 7 at 45,793,278 bp
  • C to A, chromosome 7 at 45,897,613 bp
  • T to A, chromosome 7 at 103,383,583 bp
  • CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT, chromosome 7 at 123,162,446 bp
  • T to C, chromosome 7 at 133,014,408 bp
  • T to A, chromosome 7 at 134,293,305 bp
  • T to A, chromosome 7 at 138,395,097 bp
  • T to A, chromosome 8 at 39,619,907 bp
  • C to A, chromosome 8 at 69,882,194 bp
  • C to T, chromosome 8 at 84,260,307 bp
  • C to T, chromosome 9 at 49,405,067 bp
  • T to C, chromosome 9 at 80,143,635 bp
  • T to A, chromosome 9 at 86,650,879 bp
  • T to G, chromosome 9 at 100,908,666 bp
  • G to A, chromosome 9 at 104,020,741 bp
  • T to A, chromosome 10 at 42,582,909 bp
  • T to G, chromosome 10 at 43,160,826 bp
  • C to A, chromosome 10 at 57,801,022 bp
  • T to A, chromosome 10 at 60,186,308 bp
  • T to A, chromosome 10 at 70,175,159 bp
  • A to T, chromosome 10 at 80,542,579 bp
  • T to C, chromosome 10 at 81,404,985 bp
  • A to G, chromosome 11 at 9,291,755 bp
  • T to C, chromosome 11 at 55,289,259 bp
  • C to T, chromosome 11 at 72,538,340 bp
  • C to T, chromosome 11 at 87,657,342 bp
  • T to C, chromosome 11 at 98,210,377 bp
  • T to C, chromosome 11 at 98,428,854 bp
  • T to C, chromosome 11 at 98,845,989 bp
  • T to C, chromosome 11 at 115,895,115 bp
  • G to A, chromosome 12 at 12,361,504 bp
  • G to T, chromosome 12 at 28,766,839 bp
  • A to T, chromosome 12 at 51,627,203 bp
  • A to G, chromosome 13 at 42,306,794 bp
  • A to T, chromosome 13 at 105,082,236 bp
  • C to T, chromosome 14 at 7,934,645 bp
  • T to A, chromosome 15 at 5,143,954 bp
  • T to C, chromosome 15 at 30,619,871 bp
  • T to C, chromosome 15 at 59,994,471 bp
  • G to A, chromosome 15 at 71,463,912 bp
  • T to C, chromosome 15 at 89,475,322 bp
  • C to T, chromosome 17 at 35,895,069 bp
  • A to G, chromosome 17 at 46,553,759 bp
  • G to T, chromosome 17 at 48,241,635 bp
  • C to A, chromosome 17 at 87,746,040 bp
  • T to A, chromosome 18 at 24,003,929 bp
  • A to G, chromosome 18 at 47,276,424 bp
Genotype Determination
ES Cell Line
N/A
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
MeSH Terms
    Strain Development
    C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
    Suggested Control Mice
    Wild-type littermates or C57BL/6J mice
    Donor
    Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
    Primary Reference
    MUTAGENETIX record for R1807 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
    Coat Color
    Black
    MMRRC Breeding System
    Random intra-strain mating
    Breeding Scheme(s)
    When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
    Overall Breeding Performance
    Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
    Average litter size
    Undetermined
    Recommended wean age
    3 weeks

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
    039836-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

    Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

    1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.