Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1808Btlr/Mmmh
Stock Number:
039837-MU
Citation ID:
RRID:MMRRC_039837-MU
Other Names:
R1808 (G1), C57BL/6J-MtgxR1808Btlr
Major Collection:

Strain Information

Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Ubxn2a
Name: UBX domain protein 2A
Synonyms: 6330407P03Rik, Ubxd4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217379
Homologene: 17076
Ucp2
Name: uncoupling protein 2 (mitochondrial, proton carrier)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22228
Homologene: 2516
Itga5
Name: integrin alpha 5 (fibronectin receptor alpha)
Synonyms: Fnra, Cd49e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16402
VEGA: 15
HGNC: HGNC:6141
Homologene: 20508
Pdss1
Name: prenyl (solanesyl) diphosphate synthase, subunit 1
Synonyms: 2610203G20Rik, 2700031G06Rik, Tprt, mSPS1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56075
Homologene: 5353
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320632
Homologene: 5859
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 66,715,197 bp
  • G to A, chromosome 1 at 131,802,427 bp
  • T to A, chromosome 2 at 5,138,085 bp
  • G to T, chromosome 2 at 22,906,834 bp
  • C to T, chromosome 2 at 30,079,651 bp
  • T to A, chromosome 2 at 58,026,125 bp
  • C to A, chromosome 2 at 76,725,354 bp
  • T to A, chromosome 2 at 110,044,256 bp
  • T to C, chromosome 2 at 111,315,998 bp
  • A to T, chromosome 2 at 127,219,027 bp
  • G to A, chromosome 2 at 127,219,028 bp
  • G to A, chromosome 2 at 180,099,784 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • A to G, chromosome 4 at 63,999,931 bp
  • A to G, chromosome 4 at 85,096,763 bp
  • A to T, chromosome 4 at 138,317,319 bp
  • T to C, chromosome 5 at 35,705,924 bp
  • G to T, chromosome 5 at 146,184,881 bp
  • T to C, chromosome 6 at 29,505,655 bp
  • T to C, chromosome 6 at 37,149,574 bp
  • A to C, chromosome 6 at 128,543,299 bp
  • A to G, chromosome 6 at 146,554,197 bp
  • G to T, chromosome 7 at 23,540,759 bp
  • T to A, chromosome 7 at 28,085,090 bp
  • T to C, chromosome 7 at 28,396,822 bp
  • A to T, chromosome 7 at 45,336,778 bp
  • A to C, chromosome 7 at 88,299,542 bp
  • T to C, chromosome 7 at 100,498,814 bp
  • A to C, chromosome 7 at 108,622,610 bp
  • CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT, chromosome 7 at 123,162,446 bp
  • A to G, chromosome 7 at 126,453,401 bp
  • T to C, chromosome 8 at 5,104,856 bp
  • A to G, chromosome 8 at 61,016,230 bp
  • A to C, chromosome 8 at 84,095,048 bp
  • C to A, chromosome 8 at 124,903,031 bp
  • T to C, chromosome 9 at 9,180,050 bp
  • T to C, chromosome 9 at 42,629,026 bp
  • C to A, chromosome 9 at 44,164,229 bp
  • T to A, chromosome 9 at 46,288,407 bp
  • T to C, chromosome 9 at 116,822,826 bp
  • A to G, chromosome 10 at 80,320,181 bp
  • A to T, chromosome 10 at 93,990,164 bp
  • C to A, chromosome 11 at 5,717,242 bp
  • A to T, chromosome 11 at 48,866,432 bp
  • G to T, chromosome 11 at 57,809,945 bp
  • G to T, chromosome 11 at 67,211,474 bp
  • C to A, chromosome 11 at 74,121,431 bp
  • T to A, chromosome 11 at 80,867,685 bp
  • A to T, chromosome 11 at 99,705,048 bp
  • A to T, chromosome 11 at 120,725,612 bp
  • A to T, chromosome 12 at 4,885,839 bp
  • A to G, chromosome 12 at 25,003,009 bp
  • T to C, chromosome 12 at 91,537,316 bp
  • C to G, chromosome 12 at 113,544,714 bp
  • T to A, chromosome 14 at 31,141,144 bp
  • A to G, chromosome 14 at 67,038,963 bp
  • T to C, chromosome 15 at 35,792,059 bp
  • A to G, chromosome 15 at 82,336,952 bp
  • G to A, chromosome 15 at 97,968,667 bp
  • T to C, chromosome 15 at 98,741,073 bp
  • T to C, chromosome 15 at 98,866,686 bp
  • C to T, chromosome 15 at 103,350,399 bp
  • T to C, chromosome 17 at 25,790,782 bp
  • T to C, chromosome 17 at 30,684,186 bp
  • G to A, chromosome 17 at 34,864,532 bp
  • T to A, chromosome 17 at 37,903,770 bp
  • G to A, chromosome 18 at 10,542,143 bp
  • T to C, chromosome 18 at 12,194,092 bp
  • T to C, chromosome 18 at 23,569,640 bp
  • T to C, chromosome 18 at 61,068,102 bp
  • C to T, chromosome 19 at 4,856,534 bp
  • T to C, chromosome 19 at 11,970,778 bp
  • A to G, chromosome 19 at 41,966,259 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1808 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039837-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.