Strain Name:
C57BL/6J-MtgxR1808Btlr/Mmmh
Stock Number:
039837-MU
Citation ID:
RRID:MMRRC_039837-MU
Other Names:
R1808 (G1), C57BL/6J-MtgxR1808Btlr
Major Collection:

Strain Information

Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Ubxn2a
Name: UBX domain protein 2A
Synonyms: Ubxd4, 6330407P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217379
Homologene: 17076
Ucp2
Name: uncoupling protein 2 (mitochondrial, proton carrier)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22228
Homologene: 2516
Itga5
Name: integrin alpha 5 (fibronectin receptor alpha)
Synonyms: Fnra, Cd49e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16402
VEGA: 15
HGNC: HGNC:6141
Homologene: 20508
Pdss1
Name: prenyl (solanesyl) diphosphate synthase, subunit 1
Synonyms: Tprt, 2610203G20Rik, mSPS1, 2700031G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56075
Homologene: 5353
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, D130023A07Rik, Tnrc6, 3110054G10Rik, 2010321I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233833
Homologene: 41399
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: A330064G03Rik, HELIC2, U5-200KD, Ascc3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320632
Homologene: 5859
Rfx1
Name: regulatory factor X, 1 (influences HLA class II expression)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19724
HGNC: HGNC:9982
Homologene: 2189
Mms19
Name: MMS19 cytosolic iron-sulfur assembly component
Synonyms: Mms19l, Mms19, 2610042O15Rik, C86341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72199
Homologene: 41480
Cbl
Name: Casitas B-lineage lymphoma
Synonyms: Cbl-2, 4732447J05Rik, c-Cbl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12402
HGNC: HGNC:1541
Homologene: 3802
Tshr
Name: thyroid stimulating hormone receptor
Synonyms: pet, hyt, hypothroid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 22095
Homologene: 315
Dtna
Name: dystrobrevin alpha
Synonyms: alpha-dystrobrevin, adbn, Dtn, 2210407P21Rik, 87K protein, a-DB-1, A0
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13527
VEGA: 18
HGNC: HGNC:3057
Homologene: 20362
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, D8Ertd790e, kidney, anemia and testis
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Arhgap42
Name: Rho GTPase activating protein 42
Synonyms: 9030420J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71544
Homologene: 28446
Ccdc34
Name: coiled-coil domain containing 34
Synonyms: 2810027O19Rik, 4930522P10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68201
Homologene: 12245
2310011J03Rik
Name: RIKEN cDNA 2310011J03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 66374
Homologene: 11959
Galnt5
Name: polypeptide N-acetylgalactosaminyltransferase 5
Synonyms: ppGaNTase-T5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241391
HGNC: HGNC:4127
Homologene: 8733
Ccdc3
Name: coiled-coil domain containing 3
Synonyms: 2310045O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74186
Homologene: 12870
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, C330002D13Rik, 2310042E16Rik, Coh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Npc1
Name: NPC intracellular cholesterol transporter 1
Synonyms: D18Ertd139e, A430089E03Rik, lcsd, C85354, nmf164, D18Ertd723e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 18145
HGNC: HGNC:7897
Homologene: 228
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: Pdgfr, CD140b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Tnc
Name: tenascin C
Synonyms: TN-C, tenascin-C, TN, hexabrachion, C130033P17Rik, cytotactin, Hxb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Grik4
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: 6330551K01Rik, GluRgamma1, KA1, KA-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110637
HGNC: HGNC:4582
Homologene: 81829
Osbp
Name: oxysterol binding protein
Synonyms: 1110018F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76303
VEGA: 19
HGNC: HGNC:8503
Homologene: 97668
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Dnahc8, P1-Loop, Hst6.7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Ctsc
Name: cathepsin C
Synonyms: dipeptidylpeptidase 1, DPPI, DPP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13032
HGNC: HGNC:2528
Homologene: 1373
Kirrel
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Neph1, Kirrel1, 6720469N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170643
Homologene: 10089
Paf1
Name: Paf1, RNA polymerase II complex component
Synonyms: 5730511K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 54624
Homologene: 5441
Pink1
Name: PTEN induced putative kinase 1
Synonyms: brpk, 1190006F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68943
Homologene: 32672
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Bud13
Name: BUD13 homolog
Synonyms: D030060M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 215051
Homologene: 13102
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: C330002I19Rik, 3110039L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Kcp
Name: kielin/chordin-like protein
Synonyms: KCP, Crim2, LOC333088
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 333088
Homologene: 87817
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MYHC-IIX, MyHC-IId/x, Myhs-f2, myosin heavy chain 2X, IId, Myhs-f, A530084A17Rik, Myhsf2, IId/x
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Atp2a1
Name: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Synonyms: SERCA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11937
HGNC: HGNC:811
Homologene: 7635
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 192187
Homologene: 9035
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: BC048546, Ovos2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232400
Homologene: 45969
Or4k36
Name: olfactory receptor family 4 subfamily K member 36
Synonyms: MOR248-1, Olfr1280, GA_x6K02T2Q125-72366920-72367837
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258910
Homologene: 121540
Antkmt
Name: adenine nucleotide translocase lysine methyltransferase
Synonyms: Fam173a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 214917
VEGA: 17
Homologene: 11398
4933424B01Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: AK220484, mKIAA4095
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381157
Homologene: 73393
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 338349
Homologene: 9805
C2
Name: complement component 2 (within H-2S)
Synonyms: classical-complement pathway C3/C5 convertase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12263
HGNC: HGNC:1248
Homologene: 45
Tmem106c
Name: transmembrane protein 106C
Synonyms: D15Ertd405e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 380967
VEGA: 15
Homologene: 11440
Ctsf
Name: cathepsin F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56464
VEGA: 19
HGNC: HGNC:2531
Homologene: 31194
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 215384
Homologene: 68369
Pkn3
Name: protein kinase N3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 263803
Homologene: 50980
Urgcp
Name: upregulator of cell proliferation
Synonyms: 2010005J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72046
Homologene: 69243
Sh3tc1
Name: SH3 domain and tetratricopeptide repeats 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231147
Homologene: 10360
Or5p79
Name: olfactory receptor family 5 subfamily P member 79
Synonyms: MOR204-7, Olfr507, GA_x6K02T2PBJ9-10951546-10952496
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258738
Homologene: 27249
Vmn1r168
Name: vomeronasal 1 receptor 168
Synonyms: Gm10659
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100043101
Homologene: 122945
Dgki
Name: diacylglycerol kinase, iota
Synonyms: C130010K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320127
HGNC: HGNC:2855
Homologene: 37956
Naga
Name: N-acetyl galactosaminidase, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17939
VEGA: 15
HGNC: HGNC:7631
Homologene: 221
Irgm1
Name: immunity-related GTPase family M member 1
Synonyms: Iigp3, Irgm, LRG-47, Ifi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15944
Homologene: 134089
Rpe
Name: ribulose-5-phosphate-3-epimerase
Synonyms: 5730518J08Rik, 2810429B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66646
Homologene: 12005
Vezt
Name: vezatin, adherens junctions transmembrane protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215008
Homologene: 9739
Or3a1b
Name: olfactory receptor family 3 subfamily A member 1B
Synonyms: GA_x6K02T2P1NL-4278037-4278984, Olfr401, MOR255-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258701
HGNC: HGNC:8282
Homologene: 73922
Slc10a2
Name: solute carrier family 10, member 2
Synonyms: 9130221J18Rik, ASBT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20494
Homologene: 390
Sprtn
Name: SprT-like N-terminal domain
Synonyms: LOC244666, Gm505
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244666
Homologene: 32764
1700001J03Rik
Name: RIKEN cDNA 1700001J03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69282
Homologene: 86127
Gm14183
Name: predicted gene 14183
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Rbms3
Name: RNA binding motif, single stranded interacting protein
Synonyms: 8430436O14Rik, 6720477E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 207181
Homologene: 49388
Dcxr
Name: dicarbonyl L-xylulose reductase
Synonyms: 1810027P18Rik, 0610038K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67880
Homologene: 22964
Arf3
Name: ADP-ribosylation factor 3
Synonyms: 5430400P17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11842
HGNC: HGNC:654
Homologene: 68195
Hrh3
Name: histamine receptor H3
Synonyms: Eae8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99296
HGNC: HGNC:5184
Homologene: 5232
Spaca3
Name: sperm acrosome associated 3
Synonyms: SLLP1, 1700025M08Rik, ALLP17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 75622
Homologene: 18365
Or14j6
Name: olfactory receptor family 14 subfamily J member 6
Synonyms: Olfr127, MOR218-7, GA_x6K02T2PSCP-2354126-2355093
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258374
Homologene: 134080
Pm20d1
Name: peptidase M20 domain containing 1
Synonyms: 4732466D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 212933
Homologene: 65049
Sap30l
Name: SAP30-like
Synonyms: L55, 2310079P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 50724
Homologene: 11632
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 66,715,197 bp
  • G to A, chromosome 1 at 131,802,427 bp
  • T to A, chromosome 2 at 5,138,085 bp
  • G to T, chromosome 2 at 22,906,834 bp
  • C to T, chromosome 2 at 30,079,651 bp
  • T to A, chromosome 2 at 58,026,125 bp
  • C to A, chromosome 2 at 76,725,354 bp
  • T to A, chromosome 2 at 110,044,256 bp
  • T to C, chromosome 2 at 111,315,998 bp
  • A to T, chromosome 2 at 127,219,027 bp
  • G to A, chromosome 2 at 127,219,028 bp
  • G to A, chromosome 2 at 180,099,784 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • A to G, chromosome 4 at 63,999,931 bp
  • A to G, chromosome 4 at 85,096,763 bp
  • A to T, chromosome 4 at 138,317,319 bp
  • T to C, chromosome 5 at 35,705,924 bp
  • G to T, chromosome 5 at 146,184,881 bp
  • T to C, chromosome 6 at 29,505,655 bp
  • T to C, chromosome 6 at 37,149,574 bp
  • A to C, chromosome 6 at 128,543,299 bp
  • A to G, chromosome 6 at 146,554,197 bp
  • G to T, chromosome 7 at 23,540,759 bp
  • T to A, chromosome 7 at 28,085,090 bp
  • T to C, chromosome 7 at 28,396,822 bp
  • A to T, chromosome 7 at 45,336,778 bp
  • A to C, chromosome 7 at 88,299,542 bp
  • T to C, chromosome 7 at 100,498,814 bp
  • A to C, chromosome 7 at 108,622,610 bp
  • CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT, chromosome 7 at 123,162,446 bp
  • A to G, chromosome 7 at 126,453,401 bp
  • T to C, chromosome 8 at 5,104,856 bp
  • A to G, chromosome 8 at 61,016,230 bp
  • A to C, chromosome 8 at 84,095,048 bp
  • C to A, chromosome 8 at 124,903,031 bp
  • T to C, chromosome 9 at 9,180,050 bp
  • T to C, chromosome 9 at 42,629,026 bp
  • C to A, chromosome 9 at 44,164,229 bp
  • T to A, chromosome 9 at 46,288,407 bp
  • T to C, chromosome 9 at 116,822,826 bp
  • A to G, chromosome 10 at 80,320,181 bp
  • A to T, chromosome 10 at 93,990,164 bp
  • C to A, chromosome 11 at 5,717,242 bp
  • A to T, chromosome 11 at 48,866,432 bp
  • G to T, chromosome 11 at 57,809,945 bp
  • G to T, chromosome 11 at 67,211,474 bp
  • C to A, chromosome 11 at 74,121,431 bp
  • T to A, chromosome 11 at 80,867,685 bp
  • A to T, chromosome 11 at 99,705,048 bp
  • A to T, chromosome 11 at 120,725,612 bp
  • A to T, chromosome 12 at 4,885,839 bp
  • A to G, chromosome 12 at 25,003,009 bp
  • T to C, chromosome 12 at 91,537,316 bp
  • C to G, chromosome 12 at 113,544,714 bp
  • T to A, chromosome 14 at 31,141,144 bp
  • A to G, chromosome 14 at 67,038,963 bp
  • T to C, chromosome 15 at 35,792,059 bp
  • A to G, chromosome 15 at 82,336,952 bp
  • G to A, chromosome 15 at 97,968,667 bp
  • T to C, chromosome 15 at 98,741,073 bp
  • T to C, chromosome 15 at 98,866,686 bp
  • C to T, chromosome 15 at 103,350,399 bp
  • T to C, chromosome 17 at 25,790,782 bp
  • T to C, chromosome 17 at 30,684,186 bp
  • G to A, chromosome 17 at 34,864,532 bp
  • T to A, chromosome 17 at 37,903,770 bp
  • G to A, chromosome 18 at 10,542,143 bp
  • T to C, chromosome 18 at 12,194,092 bp
  • T to C, chromosome 18 at 23,569,640 bp
  • T to C, chromosome 18 at 61,068,102 bp
  • C to T, chromosome 19 at 4,856,534 bp
  • T to C, chromosome 19 at 11,970,778 bp
  • A to G, chromosome 19 at 41,966,259 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1808 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039837-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.