Strain Name:
C57BL/6J-MtgxR1833Btlr/Mmmh
Stock Number:
039860-MU
Citation ID:
RRID:MMRRC_039860-MU
Other Names:
R1833 (G1), C57BL/6J-MtgxR1833Btlr
Major Collection:

Strain Information

Msx2
Name: msh homeobox 2
Synonyms: Hox8.1, Hox8, Hox-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17702
HGNC: HGNC:7392
Homologene: 1837
Foxa3
Name: forkhead box A3
Synonyms: Tcf-3g, Hnf3g, Hnf-3g, Tcf3g
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15377
HGNC: HGNC:5023
Homologene: 3308
Gpx1
Name: glutathione peroxidase 1
Synonyms: CGPx, cellular GPx, GSHPx-1, Gpx, GPx-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14775
HGNC: HGNC:4553
Homologene: 20155
Nptn
Name: neuroplastin
Synonyms: Sdfr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20320
Homologene: 105617
Zranb2
Name: zinc finger, RAN-binding domain containing 2
Synonyms: Znf265, Zis, Zfp265
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 53861
Smarcc1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20588
Homologene: 68296
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 5730409A01Rik, 1810061H24Rik, SAP130, RSE1, D8Ertd633e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 101943
Homologene: 6579
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Larp4b
Name: La ribonucleoprotein 4B
Synonyms: D13Wsu64e, Larp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 217980
Homologene: 18195
Gpi1
Name: glucose-6-phosphate isomerase 1
Synonyms: Org, Gpi-1t, Gpi-1, Gpi-1s, Gpi-1r, Gpi1-t, Gpi1-s, Gpi1-r, MF, maturation factor, NK, AMF, autocrine motility factor, neuroleukin, NK/GPI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14751
HGNC: HGNC:4458
Homologene: 145
Dusp12
Name: dual specificity phosphatase 12
Synonyms: VH1, mVH1, 1190004O14Rik, ESTM36, LMW-DSP4, T-DSP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 80915
HGNC: HGNC:3067
Homologene: 5238
Clcn7
Name: chloride channel, voltage-sensitive 7
Synonyms: ClC-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26373
HGNC: HGNC:2025
Homologene: 56546
Arfgef1
Name: ADP ribosylation factor guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 211673
Homologene: 4687
Vps26a
Name: VPS26 retromer complex component A
Synonyms: HB58, H beta 58, Vps26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 30930
VEGA: 10
Homologene: 68420
Hspa5
Name: heat shock protein 5
Synonyms: Hsce70, Bip, Grp78, D2Wsu141e, D2Wsu17e, Sez7, 78kDa, mBiP, XAP-1 antigen, baffled
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14828
HGNC: HGNC:5238
Homologene: 3908
Bcas3
Name: BCAS3 microtubule associated cell migration factor
Synonyms: K20D4, 1500019F07Rik, 2610028P08Rik, rudhira, breast carcinoma amplified sequence 3, Phaf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192197
Homologene: 9778
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100019
Homologene: 39689
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Arid4a
Name: AT-rich interaction domain 4A
Synonyms: A630067N03Rik, Rbbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238247
HGNC: HGNC:9885
Homologene: 11303
Tirap
Name: toll-interleukin 1 receptor (TIR) domain-containing adaptor protein
Synonyms: wyatt, MyD88-adapter-like, Mal, C130027E04Rik, Mal
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 117149
Homologene: 14285
Slc19a2
Name: solute carrier family 19 (thiamine transporter), member 2
Synonyms: TRMA, THTR1, DDA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116914
Homologene: 38258
Rspry1
Name: ring finger and SPRY domain containing 1
Synonyms: 4930470D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67610
Homologene: 12164
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 209456
Homologene: 3959
Eif3k
Name: eukaryotic translation initiation factor 3, subunit K
Synonyms: eIF3K, 1200009C21Rik, Eif3s12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73830
Homologene: 8292
Dhx16
Name: DEAH-box helicase 16
Synonyms: 2410006N22Rik, DBP2, Ddx16, DEAH (Asp-Glu-Ala-His) box polypeptide 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 69192
HGNC: HGNC:2739
Homologene: 2658
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: RAB6IP2B, RAB6IP2A, 5033405M01Rik, B430107L16Rik, 9630025C19Rik, Rab6ip2, Elks1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 111173
Homologene: 14229
Pcx
Name: pyruvate carboxylase
Synonyms: Pc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18563
VEGA: 19
HGNC: HGNC:8636
Homologene: 5422
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Nectin2
Name: nectin cell adhesion molecule 2
Synonyms: MPH, nectin-2, Cd112, Pvs, Pvrl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19294
HGNC: HGNC:9707
Homologene: 86092
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Dennd6a
Name: DENN domain containing 6A
Synonyms: A630054L15Rik, Fam116a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 211922
Homologene: 13503
Ndufs1
Name: NADH:ubiquinone oxidoreductase core subunit S1
Synonyms: 9930026A05Rik, 5830412M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227197
HGNC: HGNC:7707
Homologene: 3670
Wdtc1
Name: WD and tetratricopeptide repeats 1
Synonyms: LOC230796, adp, adipose
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230796
Homologene: 8997
Zfp975
Name: zinc finger protein 975
Synonyms: Gm5595
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434179
Homologene: 134004
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: Cngb1, Cngb1b, BC016201
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Agtpbp1
Name: ATP/GTP binding protein 1
Synonyms: Nna1, 2900054O13Rik, 4930445M19Rik, 1700020N17Rik, 5730402G09Rik, 2310001G17Rik, Ccp1, atms
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67269
Homologene: 9067
Ccr1
Name: C-C motif chemokine receptor 1
Synonyms: Cmkbr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12768
VEGA: 9
HGNC: HGNC:1602
Homologene: 20344
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Sox6
Name: SRY (sex determining region Y)-box 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20679
Homologene: 22631
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 674895
Homologene: 130947
Hephl1
Name: hephaestin-like 1
Synonyms: LOC244698, Zp, zyklopen, thd, cw
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244698
Homologene: 9112
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 50791
Homologene: 8189
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Gen1
Name: GEN1, Holliday junction 5' flap endonuclease
Synonyms: 5830483C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 209334
VEGA: 12
Homologene: 35313
Kng2
Name: kininogen 2
Synonyms: Kininogen-II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 385643
HGNC: HGNC:6383
Homologene: 88343
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22371
Homologene: 466
Ap4b1
Name: adaptor-related protein complex AP-4, beta 1
Synonyms: AP-4 beta-4, 1810038H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67489
HGNC: HGNC:572
Homologene: 38203
Sclt1
Name: sodium channel and clathrin linker 1
Synonyms: 4931421F20Rik, 2610207F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67161
Homologene: 27031
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227377
Homologene: 8877
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210045
Homologene: 65242
Sema4f
Name: sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
Synonyms: Sema W
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20355
Homologene: 3147
Vmn2r25
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545874
Homologene: 135915
Zc3hav1l
Name: zinc finger CCCH-type, antiviral 1-like
Synonyms: B130055L09Rik, E430016P22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 209032
Homologene: 15425
Or4c10
Name: olfactory receptor family 4 subfamily C member 10
Synonyms: GA_x6K02T2Q125-51361752-51362687, MOR232-3, Olfr1258
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258980
Homologene: 82299
Dclre1a
Name: DNA cross-link repair 1A
Synonyms: mSNM1, SNM1, 2810043H12Rik, SMN1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 55947
Homologene: 8920
Gm14412
Name: predicted gene 14412
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 102640477
Homologene: 134324
Tgfb1i1
Name: transforming growth factor beta 1 induced transcript 1
Synonyms: TSC-5, hic-5, ARA55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21804
Homologene: 7572
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70381
Homologene: 9120
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Ces2h
Name: carboxylesterase 2H
Synonyms: Gm5744
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 436059
HGNC: HGNC:1864
Homologene: 128645
Oaz3
Name: ornithine decarboxylase antizyme 3
Synonyms: ornithine decarboxylase antizyme in testis, Oaz-t, AZ-3, antizyme 3, AZ3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 53814
HGNC: HGNC:8097
Homologene: 9410
Ces3b
Name: carboxylesterase 3B
Synonyms: ES31L, Gm4738
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13909
HGNC: HGNC:1865
Homologene: 84407
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: Id-1, Idh-1, E030024J03Rik, IDPc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
Zfp326
Name: zinc finger protein 326
Synonyms: ZAN75, 5730470H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54367
Homologene: 10297
Mcm8
Name: minichromosome maintenance 8 homologous recombination repair factor
Synonyms: 5730432L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66634
Homologene: 12001
Gm2042
Name: predicted gene 2042
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100039087
Homologene: 103830
Zfp119b
Name: zinc finger protein 119b
Synonyms: BC031441
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240120
Abhd12
Name: abhydrolase domain containing 12
Synonyms: 6330583M11Rik, 1500011G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76192
Homologene: 22910
Cyp4f17
Name: cytochrome P450, family 4, subfamily f, polypeptide 17
Synonyms: EG208285
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 208285
VEGA: 17
Homologene: 129713
Zscan5b
Name: zinc finger and SCAN domain containing 5B
Synonyms: Zfg1, Zfp371
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 170734
Homologene: 129555
Lhfpl7
Name: LHFPL tetraspan subfamily member 7
Synonyms: LOC333048, Tmem211
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 333048
Homologene: 52993
9230009I02Rik
Name: RIKEN cDNA 9230009I02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 619293
Try4
Name: trypsin 4
Synonyms: Td, 0910001B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22074
Homologene: 106639
Gm10305
Name: predicted gene 10305
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Mipep
Name: mitochondrial intermediate peptidase
Synonyms: 5730405E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 70478
VEGA: 14
HGNC: HGNC:7104
Homologene: 4337
Gm340
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
4930438A08Rik
Name: RIKEN cDNA 4930438A08 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 73988
Homologene: 104884
H2-Q7
Name: histocompatibility 2, Q region locus 7
Synonyms: H-2Q7, Qa-7, Qa7, Ped
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15018
Homologene: 128352
Garin2
Name: golgi associated RAB2 interactor 2
Synonyms: 4930516C23Rik, 4921509E07Rik, Fam71d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 70897
Homologene: 49887
Or10ad1b
Name: olfactory receptor family 10 subfamily AD member 1B
Synonyms: GA_x6K02T2NBG7-5528233-5529186, MOR286-2, EG629524, Olfr286
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 629524
Homologene: 134078
H2-M10.3
Name: histocompatibility 2, M region locus 10.3
Synonyms: 5.3H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 110696
Homologene: 117973
Lonrf2
Name: LON peptidase N-terminal domain and ring finger 2
Synonyms: 2900060P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381338
Homologene: 18871
Gm6900
Name: predicted gene 6900
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 628596
Rfk
Name: riboflavin kinase
Synonyms: ATP:riboflavin 5'-phosphotransferase, flavokinase, 0610038L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54391
Homologene: 115690
Micall2
Name: MICAL-like 2
Synonyms: Jrab, MICAL-L2, A930021H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231830
Homologene: 85155
1700003H04Rik
Name: RIKEN cDNA 1700003H04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 384775
Adam1b
Name: a disintegrin and metallopeptidase domain 1b
Synonyms: Ftna, PH-30 alpha, fertilin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 280667
Homologene: 136485
Qsox1
Name: quiescin Q6 sulfhydryl oxidase 1
Synonyms: 1300003H02Rik, Qscn6, QSOX, b2b2673Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 104009
HGNC: HGNC:9756
Homologene: 37690
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to C, chromosome 1 at 10,204,890 bp
  • G to A, chromosome 1 at 38,813,276 bp
  • T to C, chromosome 1 at 63,164,940 bp
  • T to C, chromosome 1 at 65,161,114 bp
  • T to A, chromosome 1 at 93,576,364 bp
  • C to T, chromosome 1 at 155,791,045 bp
  • T to G, chromosome 1 at 164,262,184 bp
  • T to C, chromosome 1 at 170,874,453 bp
  • T to A, chromosome 1 at 182,429,016 bp
  • T to A, chromosome 2 at 34,776,053 bp
  • A to G, chromosome 2 at 41,282,027 bp
  • A to G, chromosome 2 at 59,936,762 bp
  • T to A, chromosome 2 at 89,930,301 bp
  • T to G, chromosome 2 at 132,831,689 bp
  • T to A, chromosome 2 at 150,848,418 bp
  • T to A, chromosome 2 at 157,195,555 bp
  • T to C, chromosome 2 at 177,315,790 bp
  • A to G, chromosome 3 at 41,727,111 bp
  • TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG to TGGAGGCAGGAGCACGGGAGGCAG, chromosome 3 at 94,436,042 bp
  • C to T, chromosome 3 at 103,818,793 bp
  • T to A, chromosome 3 at 124,556,860 bp
  • C to T, chromosome 3 at 142,821,647 bp
  • T to A, chromosome 3 at 157,536,750 bp
  • T to A, chromosome 4 at 32,720,761 bp
  • A to G, chromosome 4 at 99,273,126 bp
  • TCC to TC, chromosome 4 at 133,308,742 bp
  • G to T, chromosome 5 at 19,227,457 bp
  • A to G, chromosome 5 at 34,905,748 bp
  • C to T, chromosome 5 at 105,891,169 bp
  • A to G, chromosome 5 at 113,234,569 bp
  • A to G, chromosome 5 at 121,502,937 bp
  • A to G, chromosome 5 at 139,716,753 bp
  • T to C, chromosome 5 at 144,208,608 bp
  • A to T, chromosome 6 at 38,297,946 bp
  • T to C, chromosome 6 at 40,654,718 bp
  • A to G, chromosome 6 at 41,303,431 bp
  • A to T, chromosome 6 at 82,918,559 bp
  • A to G, chromosome 6 at 119,743,429 bp
  • G to A, chromosome 6 at 123,839,684 bp
  • A to G, chromosome 6 at 125,642,037 bp
  • T to C, chromosome 7 at 6,238,966 bp
  • T to C, chromosome 7 at 10,656,588 bp
  • A to T, chromosome 7 at 10,725,936 bp
  • A to G, chromosome 7 at 19,014,574 bp
  • G to T, chromosome 7 at 19,717,708 bp
  • T to C, chromosome 7 at 28,971,427 bp
  • G to A, chromosome 7 at 34,208,236 bp
  • C to T, chromosome 7 at 42,661,839 bp
  • T to C, chromosome 7 at 115,777,093 bp
  • A to G, chromosome 7 at 128,249,498 bp
  • A to G, chromosome 8 at 94,635,488 bp
  • A to G, chromosome 8 at 95,242,355 bp
  • A to G, chromosome 8 at 105,020,373 bp
  • T to A, chromosome 8 at 105,085,639 bp
  • T to A, chromosome 8 at 110,817,566 bp
  • T to C, chromosome 9 at 15,076,928 bp
  • T to G, chromosome 9 at 35,188,703 bp
  • T to A, chromosome 9 at 58,651,045 bp
  • C to T, chromosome 9 at 75,249,902 bp
  • A to T, chromosome 9 at 108,339,356 bp
  • T to A, chromosome 9 at 110,153,811 bp
  • T to A, chromosome 9 at 123,964,089 bp
  • A to C, chromosome 10 at 62,459,046 bp
  • A to G, chromosome 10 at 70,015,636 bp
  • A to G, chromosome 11 at 51,091,466 bp
  • C to T, chromosome 11 at 58,288,388 bp
  • A to G, chromosome 11 at 69,354,123 bp
  • G to T, chromosome 11 at 73,117,162 bp
  • A to C, chromosome 11 at 73,126,962 bp
  • G to A, chromosome 11 at 85,583,949 bp
  • A to T, chromosome 12 at 11,248,351 bp
  • C to T, chromosome 12 at 71,075,466 bp
  • G to A, chromosome 12 at 78,715,506 bp
  • A to T, chromosome 12 at 79,286,258 bp
  • T to C, chromosome 12 at 88,178,448 bp
  • C to T, chromosome 13 at 9,151,199 bp
  • A to T, chromosome 13 at 53,468,185 bp
  • A to T, chromosome 13 at 59,465,983 bp
  • A to T, chromosome 14 at 14,842,789 bp
  • T to A, chromosome 14 at 26,606,954 bp
  • T to G, chromosome 14 at 60,872,063 bp
  • T to A, chromosome 15 at 98,226,965 bp
  • T to C, chromosome 16 at 23,012,052 bp
  • G to A, chromosome 17 at 25,145,557 bp
  • T to C, chromosome 17 at 32,524,210 bp
  • C to A, chromosome 17 at 35,439,699 bp
  • A to G, chromosome 17 at 35,885,619 bp
  • T to C, chromosome 17 at 36,367,495 bp
  • T to G, chromosome 17 at 55,939,271 bp
  • T to A, chromosome 19 at 4,619,104 bp
  • T to C, chromosome 19 at 17,395,362 bp
  • T to C, chromosome 19 at 41,584,948 bp
  • C to T, chromosome 19 at 56,541,500 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1833 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039860-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.