Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1833Btlr/Mmmh
Stock Number:
039860-MU
Citation ID:
RRID:MMRRC_039860-MU
Other Names:
R1833 (G1), C57BL/6J-MtgxR1833Btlr
Major Collection:

Strain Information

Msx2
Name: msh homeobox 2
Synonyms: Hox8.1, Hox8, Hox-8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17702
HGNC: HGNC:7392
Homologene: 1837
Foxa3
Name: forkhead box A3
Synonyms: Tcf-3g, Hnf3g, Hnf-3g, Tcf3g
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15377
HGNC: HGNC:5023
Homologene: 3308
Gpx1
Name: glutathione peroxidase 1
Synonyms: CGPx, cellular GPx, GSHPx-1, Gpx, GPx-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14775
HGNC: HGNC:4553
Homologene: 20155
Nptn
Name: neuroplastin
Synonyms: Sdfr1, NP65
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20320
Homologene: 105617
Zranb2
Name: zinc finger, RAN-binding domain containing 2
Synonyms: Znf265, Zis, Zfp265
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53861
Smarcc1
Name: SWI/SNF related BAF chromatin remodeling complex subunit C1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 5730409A01Rik, 1810061H24Rik, SAP130, RSE1, D8Ertd633e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101943
Homologene: 6579
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to C, chromosome 1 at 10,204,890 bp
  • G to A, chromosome 1 at 38,813,276 bp
  • T to C, chromosome 1 at 63,164,940 bp
  • T to C, chromosome 1 at 65,161,114 bp
  • T to A, chromosome 1 at 93,576,364 bp
  • C to T, chromosome 1 at 155,791,045 bp
  • T to G, chromosome 1 at 164,262,184 bp
  • T to C, chromosome 1 at 170,874,453 bp
  • T to A, chromosome 1 at 182,429,016 bp
  • T to A, chromosome 2 at 34,776,053 bp
  • A to G, chromosome 2 at 41,282,027 bp
  • A to G, chromosome 2 at 59,936,762 bp
  • T to A, chromosome 2 at 89,930,301 bp
  • T to G, chromosome 2 at 132,831,689 bp
  • T to A, chromosome 2 at 150,848,418 bp
  • T to A, chromosome 2 at 157,195,555 bp
  • T to C, chromosome 2 at 177,315,790 bp
  • A to G, chromosome 3 at 41,727,111 bp
  • TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG to TGGAGGCAGGAGCACGGGAGGCAG, chromosome 3 at 94,436,042 bp
  • C to T, chromosome 3 at 103,818,793 bp
  • T to A, chromosome 3 at 124,556,860 bp
  • C to T, chromosome 3 at 142,821,647 bp
  • T to A, chromosome 3 at 157,536,750 bp
  • T to A, chromosome 4 at 32,720,761 bp
  • A to G, chromosome 4 at 99,273,126 bp
  • TCC to TC, chromosome 4 at 133,308,742 bp
  • G to T, chromosome 5 at 19,227,457 bp
  • A to G, chromosome 5 at 34,905,748 bp
  • C to T, chromosome 5 at 105,891,169 bp
  • A to G, chromosome 5 at 113,234,569 bp
  • A to G, chromosome 5 at 121,502,937 bp
  • A to G, chromosome 5 at 139,716,753 bp
  • T to C, chromosome 5 at 144,208,608 bp
  • A to T, chromosome 6 at 38,297,946 bp
  • T to C, chromosome 6 at 40,654,718 bp
  • A to G, chromosome 6 at 41,303,431 bp
  • A to T, chromosome 6 at 82,918,559 bp
  • A to G, chromosome 6 at 119,743,429 bp
  • G to A, chromosome 6 at 123,839,684 bp
  • A to G, chromosome 6 at 125,642,037 bp
  • T to C, chromosome 7 at 6,238,966 bp
  • T to C, chromosome 7 at 10,656,588 bp
  • A to T, chromosome 7 at 10,725,936 bp
  • A to G, chromosome 7 at 19,014,574 bp
  • G to T, chromosome 7 at 19,717,708 bp
  • T to C, chromosome 7 at 28,971,427 bp
  • G to A, chromosome 7 at 34,208,236 bp
  • C to T, chromosome 7 at 42,661,839 bp
  • T to C, chromosome 7 at 115,777,093 bp
  • A to G, chromosome 7 at 128,249,498 bp
  • A to G, chromosome 8 at 94,635,488 bp
  • A to G, chromosome 8 at 95,242,355 bp
  • A to G, chromosome 8 at 105,020,373 bp
  • T to A, chromosome 8 at 105,085,639 bp
  • T to A, chromosome 8 at 110,817,566 bp
  • T to C, chromosome 9 at 15,076,928 bp
  • T to G, chromosome 9 at 35,188,703 bp
  • T to A, chromosome 9 at 58,651,045 bp
  • C to T, chromosome 9 at 75,249,902 bp
  • A to T, chromosome 9 at 108,339,356 bp
  • T to A, chromosome 9 at 110,153,811 bp
  • T to A, chromosome 9 at 123,964,089 bp
  • A to C, chromosome 10 at 62,459,046 bp
  • A to G, chromosome 10 at 70,015,636 bp
  • A to G, chromosome 11 at 51,091,466 bp
  • C to T, chromosome 11 at 58,288,388 bp
  • A to G, chromosome 11 at 69,354,123 bp
  • G to T, chromosome 11 at 73,117,162 bp
  • A to C, chromosome 11 at 73,126,962 bp
  • G to A, chromosome 11 at 85,583,949 bp
  • A to T, chromosome 12 at 11,248,351 bp
  • C to T, chromosome 12 at 71,075,466 bp
  • G to A, chromosome 12 at 78,715,506 bp
  • A to T, chromosome 12 at 79,286,258 bp
  • T to C, chromosome 12 at 88,178,448 bp
  • C to T, chromosome 13 at 9,151,199 bp
  • A to T, chromosome 13 at 53,468,185 bp
  • A to T, chromosome 13 at 59,465,983 bp
  • A to T, chromosome 14 at 14,842,789 bp
  • T to A, chromosome 14 at 26,606,954 bp
  • T to G, chromosome 14 at 60,872,063 bp
  • T to A, chromosome 15 at 98,226,965 bp
  • T to C, chromosome 16 at 23,012,052 bp
  • G to A, chromosome 17 at 25,145,557 bp
  • T to C, chromosome 17 at 32,524,210 bp
  • C to A, chromosome 17 at 35,439,699 bp
  • A to G, chromosome 17 at 35,885,619 bp
  • T to C, chromosome 17 at 36,367,495 bp
  • T to G, chromosome 17 at 55,939,271 bp
  • T to A, chromosome 19 at 4,619,104 bp
  • T to C, chromosome 19 at 17,395,362 bp
  • T to C, chromosome 19 at 41,584,948 bp
  • C to T, chromosome 19 at 56,541,500 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1833 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039860-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.