Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1838Btlr/Mmmh
Stock Number:
039865-MU
Citation ID:
RRID:MMRRC_039865-MU
Other Names:
R1838 (G1), C57BL/6J-MtgxR1838Btlr
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Strn
Name: striatin, calmodulin binding protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268980
Homologene: 2380
Fam131a
Name: family with sequence similarity 131, member A
Synonyms: 2900046G09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78408
Homologene: 82234
Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Exoc6b
Name: exocyst complex component 6B
Synonyms: 4930569O18Rik, G430127E12Rik, Sec15b, Sec15l2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75914
Homologene: 44781
Lypd1
Name: Ly6/Plaur domain containing 1
Synonyms: C530008O16Rik, 2700050C12Rik, Lynx2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72585
Homologene: 16937
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 25,084,270 bp
  • T to C, chromosome 1 at 46,116,177 bp
  • C to A, chromosome 1 at 46,277,105 bp
  • A to C, chromosome 1 at 53,192,098 bp
  • A to T, chromosome 1 at 125,873,371 bp
  • A to T, chromosome 2 at 5,794,891 bp
  • T to C, chromosome 2 at 31,925,582 bp
  • A to G, chromosome 2 at 72,938,176 bp
  • T to C, chromosome 2 at 76,727,192 bp
  • A to T, chromosome 2 at 89,721,709 bp
  • A to T, chromosome 2 at 116,880,879 bp
  • A to G, chromosome 3 at 14,143,412 bp
  • CTTT to CTT, chromosome 3 at 54,789,179 bp
  • C to G, chromosome 3 at 88,729,170 bp
  • T to C, chromosome 3 at 89,890,272 bp
  • A to T, chromosome 3 at 107,104,512 bp
  • G to A, chromosome 3 at 122,128,305 bp
  • A to G, chromosome 4 at 86,825,178 bp
  • A to T, chromosome 4 at 130,010,231 bp
  • A to T, chromosome 4 at 137,572,170 bp
  • G to T, chromosome 4 at 139,967,070 bp
  • T to A, chromosome 4 at 140,994,332 bp
  • A to T, chromosome 5 at 20,465,827 bp
  • A to T, chromosome 5 at 53,058,436 bp
  • G to T, chromosome 5 at 86,124,300 bp
  • A to T, chromosome 5 at 100,771,879 bp
  • A to G, chromosome 5 at 125,029,018 bp
  • G to A, chromosome 5 at 127,678,129 bp
  • A to G, chromosome 5 at 130,213,021 bp
  • A to G, chromosome 5 at 136,132,388 bp
  • A to T, chromosome 5 at 137,911,632 bp
  • A to G, chromosome 5 at 149,599,366 bp
  • T to C, chromosome 6 at 77,845,542 bp
  • T to C, chromosome 6 at 83,050,455 bp
  • T to A, chromosome 6 at 84,853,678 bp
  • A to G, chromosome 6 at 93,757,648 bp
  • C to T, chromosome 6 at 124,024,771 bp
  • T to C, chromosome 6 at 124,814,152 bp
  • T to C, chromosome 6 at 132,626,727 bp
  • C to T, chromosome 6 at 146,566,611 bp
  • T to C, chromosome 7 at 25,289,590 bp
  • G to T, chromosome 7 at 27,158,416 bp
  • G to A, chromosome 7 at 27,910,356 bp
  • A to T, chromosome 7 at 28,459,768 bp
  • G to T, chromosome 7 at 82,493,373 bp
  • T to C, chromosome 7 at 90,240,351 bp
  • T to A, chromosome 7 at 100,510,864 bp
  • T to A, chromosome 7 at 110,042,109 bp
  • G to T, chromosome 7 at 111,052,303 bp
  • T to A, chromosome 7 at 127,879,739 bp
  • C to T, chromosome 7 at 141,272,603 bp
  • A to G, chromosome 8 at 4,628,590 bp
  • T to C, chromosome 8 at 13,416,155 bp
  • C to G, chromosome 8 at 15,042,629 bp
  • G to T, chromosome 8 at 47,712,882 bp
  • A to G, chromosome 8 at 84,633,646 bp
  • C to A, chromosome 8 at 111,134,734 bp
  • A to T, chromosome 9 at 39,909,841 bp
  • A to T, chromosome 9 at 40,074,309 bp
  • A to G, chromosome 9 at 44,933,294 bp
  • A to G, chromosome 9 at 57,137,337 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • TGCCGCCGCC to TGCCGCCGCCGCC, chromosome 9 at 65,651,680 bp
  • A to T, chromosome 9 at 75,273,553 bp
  • C to T, chromosome 9 at 86,569,233 bp
  • G to A, chromosome 9 at 105,864,833 bp
  • G to A, chromosome 9 at 107,583,017 bp
  • A to G, chromosome 9 at 108,829,906 bp
  • T to G, chromosome 9 at 118,534,594 bp
  • T to C, chromosome 10 at 18,115,705 bp
  • C to T, chromosome 10 at 125,231,198 bp
  • G to A, chromosome 10 at 127,236,815 bp
  • T to C, chromosome 10 at 127,742,700 bp
  • G to A, chromosome 11 at 49,625,477 bp
  • A to T, chromosome 11 at 86,506,785 bp
  • A to T, chromosome 11 at 87,099,366 bp
  • A to G, chromosome 11 at 87,636,055 bp
  • C to T, chromosome 11 at 98,629,858 bp
  • A to G, chromosome 11 at 99,785,396 bp
  • T to A, chromosome 12 at 113,271,850 bp
  • A to T, chromosome 13 at 21,072,425 bp
  • A to G, chromosome 13 at 27,388,566 bp
  • G to A, chromosome 13 at 59,715,857 bp
  • G to A, chromosome 13 at 59,717,465 bp
  • A to C, chromosome 13 at 67,042,047 bp
  • T to C, chromosome 13 at 100,316,136 bp
  • T to A, chromosome 13 at 113,095,984 bp
  • T to C, chromosome 14 at 52,204,883 bp
  • T to C, chromosome 14 at 54,973,180 bp
  • T to C, chromosome 14 at 68,639,210 bp
  • A to G, chromosome 15 at 11,311,658 bp
  • T to C, chromosome 15 at 73,565,100 bp
  • A to T, chromosome 15 at 74,616,113 bp
  • G to A, chromosome 16 at 17,642,302 bp
  • T to C, chromosome 16 at 17,653,562 bp
  • T to C, chromosome 16 at 20,699,456 bp
  • T to C, chromosome 16 at 21,914,189 bp
  • T to A, chromosome 17 at 28,194,993 bp
  • T to A, chromosome 17 at 34,515,542 bp
  • A to T, chromosome 17 at 34,678,910 bp
  • A to G, chromosome 17 at 46,677,097 bp
  • A to T, chromosome 17 at 78,663,120 bp
  • T to C, chromosome 17 at 80,038,623 bp
  • A to G, chromosome 18 at 22,067,638 bp
  • A to G, chromosome 18 at 37,301,317 bp
  • A to T, chromosome 18 at 67,414,172 bp
  • C to T, chromosome 19 at 5,717,691 bp
  • T to A, chromosome 19 at 10,964,047 bp
  • T to A, chromosome 19 at 17,199,878 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1838 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039865-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.