Strain Name:
Stock Number:
Citation ID:
Other Names:
R1838 (G1), C57BL/6J-MtgxR1838Btlr
Major Collection:

Strain Information

Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
Homologene: 55861
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, MYH-beta/slow, beta-MHC, B-MHC, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
Homologene: 68044
Name: striatin, calmodulin binding protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268980
Homologene: 2380
Name: family with sequence similarity 131, member A
Synonyms: 2900046G09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78408
Homologene: 82234
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
Homologene: 31257
Name: exocyst complex component 6B
Synonyms: 4930569O18Rik, G430127E12Rik, Sec15b, Sec15l2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75914
Homologene: 44781
Name: Ly6/Plaur domain containing 1
Synonyms: C530008O16Rik, 2700050C12Rik, Lynx2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72585
Homologene: 16937
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
Homologene: 49895
Name: zinc finger protein 523
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224656
Homologene: 2569
Name: ribosomal protein S6 kinase, polypeptide 1
Synonyms: p70/85s6k, p70s6k, S6K1, 2610318I15Rik, p70S6K1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72508
Homologene: 81703
Name: golgin A4
Synonyms: golgin-245, Olp-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54214
Homologene: 68224
Name: RalBP1 associated Eps domain containing protein
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19707
Homologene: 7515
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: 2510028H02Rik, 2810036L13Rik, Hnrpll
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72692
Homologene: 26701
Name: mediator complex subunit 15
Synonyms: A230074L19Rik, Pcqap
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94112
VEGA: 16
Name: sphingomyelin phosphodiesterase 4
Synonyms: neutral membrane (neutral sphingomyelinase-3), 4122402O22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77626
Homologene: 9813
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20602
Homologene: 31370
Name: importin 7
Synonyms: RanBP7, Imp7, A330055O14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233726
Homologene: 4659
Name: proline rich 11
Synonyms: B930067F20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 270906
Homologene: 10123
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67772
Homologene: 72405
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, par, Emv66
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69597
VEGA: 18
Homologene: 4947
Name: phosphoglucomutase 3
Synonyms: Pgm-3, GlcNAc-P mutase, 2810473H05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109785
Homologene: 9205
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Tsp, Tsbp, Sh2bp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22083
Homologene: 40668
Name: capicua transcriptional repressor
Synonyms: 1200010B10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71722
Homologene: 87637
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230775
Homologene: 1288
Name: ubiquitin-like modifier activating enzyme 6
Synonyms: 5730469D23Rik, Ube1l2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231380
Homologene: 10080
Name: trans-acting transcription factor 3
Synonyms: D130027J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20687
Homologene: 7952
Name: helicase, POLQ-like
Synonyms: D430018E21Rik, Hel308
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 191578
Homologene: 14667
Name: gasdermin A3
Synonyms: Rco2, Fgn, Dfl, Bsk, Rim3, Gsdm1l, Gsdm3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 450219
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Name: ADAM metallopeptidase with thrombospondin type 1 motif 12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239337
VEGA: 15
Homologene: 12808
Name: cadherin-related family member 5
Synonyms: 1810074H01Rik, Mucdhl, Mupcdh
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72040
Homologene: 69345
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227099
Homologene: 449
Name: RAB guanine nucleotide exchange factor (GEF) 1
Synonyms: Ras negative regulator Rabex-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56715
Homologene: 8720
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98828
Homologene: 4394
Name: zinc finger protein 958
Synonyms: BC003267
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 233987
Homologene: 129582
Name: glycosyltransferase 1 domain containing 1
Synonyms: 5730455A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319804
Homologene: 16965
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
Homologene: 56383
Name: G protein-coupled receptor kinase 1
Synonyms: RK, Rhok
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24013
Homologene: 2197
Name: transmembrane and coiled-coil domains 5
Synonyms: 1700095F04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67356
Homologene: 41661
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269959
Homologene: 18912
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: membrane-spanning 4-domains, subfamily A, member 10
Synonyms: 2010001N17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69826
Homologene: 11355
Name: WD40 repeat domain 95
Synonyms: 4930434E21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381693
Homologene: 124480
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
Homologene: 298
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210933
Homologene: 1289
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Magi-2, Acvrinp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Name: zinc finger protein 646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233905
Homologene: 8802
Name: maestro heat-like repeat family member 4
Synonyms: 1700016M24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69439
Homologene: 72545
Name: butyrophilin-like 6
Synonyms: NG13, Gm6519
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 624681
Homologene: 106849
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
Homologene: 4887
Name: heat shock transcription factor family member 5
Synonyms: LOC327992
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327992
Homologene: 52701
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56552
Homologene: 135915
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
Homologene: 113589
Name: solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms: MCT2, 4921534N07Rik, D630004K10Rik, 9030411M13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20503
Homologene: 20990
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Name: zinc finger protein 712
Synonyms: 4921504N20Rik, mszf31, mszf89
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78251
VEGA: 13
Homologene: 136296
Name: mitogen-activated protein kinase kinase kinase 13
Synonyms: C130026N12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71751
VEGA: 16
Homologene: 37958
Name: solute carrier family 34 (sodium phosphate), member 2
Synonyms: type IIb Na/Picotransporter, Npt2b, NaPi-2b, D5Ertd227e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20531
Homologene: 2297
Name: interleukin 6 receptor, alpha
Synonyms: IL-6 receptor alpha chain, CD126, Il6r, IL-6R
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16194
Homologene: 474
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
Homologene: 1077
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Name: potassium voltage-gated channel, shaker-related subfamily, member 2
Synonyms: Kv1.2, Kca1-2, Mk-2, Akr6a4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16490
Homologene: 21034
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70950
VEGA: 18
Homologene: 12373
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208943
Homologene: 135711
Name: kelch domain containing 7A
Synonyms: B230308G19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242721
Homologene: 17567
Name: a disintegrin and metallopeptidase domain 28
Synonyms: Dtgn1, MDC-L, D430033C21Rik, C130072N01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13522
VEGA: 14
Homologene: 40705
Name: coiled-coil domain containing 83
Synonyms: 4930549K11Rik, 4930554C01Rik, 4932423M01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75338
Homologene: 32709
Name: lysyl oxidase-like 3
Synonyms: Lor2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16950
Homologene: 56591
Name: ubiquitination factor E4A
Synonyms: UFD2b, 9930123J21Rik, 4732444G18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 140630
Homologene: 3517
Name: CDKN2A interacting protein
Synonyms: CARF, 4921511I16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70925
Homologene: 9752
Name: olfactory receptor family 10 subfamily S member 1
Synonyms: GA_x6K02T2PVTD-33772307-33773260, MOR223-4, Olfr982
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258853
Homologene: 17415
Name: olfactory receptor family 2 subfamily P member 2
Synonyms: GA_x6K02T2QHY8-12181473-12182423, MOR256-14, Olfr1370
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258528
Homologene: 105231
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Name: cytochrome P450, family 3, subfamily a, polypeptide 13
Synonyms: IIIAm2, steroid inducible
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13113
Homologene: 133564
Name: DnaJ heat shock protein family (Hsp40) member B13
Synonyms: 1700014P03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69387
Homologene: 70141
Name: expressed sequence BB014433
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434285
Name: FMS-like tyrosine kinase 4
Synonyms: VEGFR3, VEGFR-3, Flt-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14257
Homologene: 7321
Name: zinc finger protein 974
Synonyms: 1700049G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73430
Name: catenin alpha 2
Synonyms: alpha(N)-catenin, alpha N-catenin, Catna, chp, Catna2, catenin (cadherin associated protein), alpha 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12386
Homologene: 68394
Name: protocadherin beta 3
Synonyms: PcdhbC
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93874
Homologene: 115665
Name: olfactory receptor family 8 subfamily G member 2
Synonyms: GA_x6K02T02EEW-227-373, GA_x6K02T2PVTD-33608180-33608971, MOR171-14, Olfr973, Olfr229
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258606
Homologene: 115513
Name: triosephosphate isomerase 1
Synonyms: Tpi-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21991
Homologene: 128432
Name: low density lipoprotein receptor class A domain containing 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435811
Homologene: 54811
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Name: prolactin family 2, subfamily b, member 1
Synonyms: PLP-K, 2310047B08Rik, Prlpk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66392
Homologene: 11963
Name: Immunoglobulin heavy constant epsilon
Synonyms: LOC380792, Gm900
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380792
Name: leucine-rich repeats and WD repeat domain containing 1
Synonyms: 1200011O22Rik, Orca
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71735
Homologene: 17678
Name: RIKEN cDNA A630073D07 gene
Synonyms: LOC381819
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381819
Name: ATPase type 13A2
Synonyms: 1110012E06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74772
Homologene: 56940
Name: zinc finger and BTB domain containing 39
Synonyms: 7030401O21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320080
VEGA: 10
Homologene: 8890
Name: kelch domain containing 3
Synonyms: 1300011D16Rik, Peas
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71765
VEGA: 17
Homologene: 14290
Name: pyruvate dehydrogenase phosphatase regulatory subunit
Synonyms: 4930402E16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319518
Homologene: 9948
Name: RALY RNA binding protein-like
Synonyms: 0710005M24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76897
Homologene: 18366
Name: granzyme A
Synonyms: serine esterase 1, TSP1, BLT esterase, Hanukah factor, Ctla-3, Hf, Ctla3, H factor, SE1, TSP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14938
VEGA: 13
Homologene: 21237
Name: keratin associated protein 4-9
Synonyms: OTTMUSG00000002198
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 665998
Name: leucine rich repeat and fibronectin type III domain containing 1
Synonyms: SALM2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80749
Homologene: 12729
Name: Ras-like without CAAX 1
Synonyms: Rit
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19769
Homologene: 56003
Name: olfactory receptor family 4 subfamily A member 79
Synonyms: GA_x6K02T2Q125-51162884-51161940, MOR231-22_p, Olfr1252
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404331
Homologene: 128094
Name: SMAD family member 9
Synonyms: Madh9, SMAD8B, SMAD8A, MADH6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55994
Homologene: 21198
Name: N(alpha)-acetyltransferase 80, NatH catalytic subunit
Synonyms: Nat6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56441
Homologene: 36325
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 25,084,270 bp
  • T to C, chromosome 1 at 46,116,177 bp
  • C to A, chromosome 1 at 46,277,105 bp
  • A to C, chromosome 1 at 53,192,098 bp
  • A to T, chromosome 1 at 125,873,371 bp
  • A to T, chromosome 2 at 5,794,891 bp
  • T to C, chromosome 2 at 31,925,582 bp
  • A to G, chromosome 2 at 72,938,176 bp
  • T to C, chromosome 2 at 76,727,192 bp
  • A to T, chromosome 2 at 89,721,709 bp
  • A to T, chromosome 2 at 116,880,879 bp
  • A to G, chromosome 3 at 14,143,412 bp
  • CTTT to CTT, chromosome 3 at 54,789,179 bp
  • C to G, chromosome 3 at 88,729,170 bp
  • T to C, chromosome 3 at 89,890,272 bp
  • A to T, chromosome 3 at 107,104,512 bp
  • G to A, chromosome 3 at 122,128,305 bp
  • A to G, chromosome 4 at 86,825,178 bp
  • A to T, chromosome 4 at 130,010,231 bp
  • A to T, chromosome 4 at 137,572,170 bp
  • G to T, chromosome 4 at 139,967,070 bp
  • T to A, chromosome 4 at 140,994,332 bp
  • A to T, chromosome 5 at 20,465,827 bp
  • A to T, chromosome 5 at 53,058,436 bp
  • G to T, chromosome 5 at 86,124,300 bp
  • A to T, chromosome 5 at 100,771,879 bp
  • A to G, chromosome 5 at 125,029,018 bp
  • G to A, chromosome 5 at 127,678,129 bp
  • A to G, chromosome 5 at 130,213,021 bp
  • A to G, chromosome 5 at 136,132,388 bp
  • A to T, chromosome 5 at 137,911,632 bp
  • A to G, chromosome 5 at 149,599,366 bp
  • T to C, chromosome 6 at 77,845,542 bp
  • T to C, chromosome 6 at 83,050,455 bp
  • T to A, chromosome 6 at 84,853,678 bp
  • A to G, chromosome 6 at 93,757,648 bp
  • C to T, chromosome 6 at 124,024,771 bp
  • T to C, chromosome 6 at 124,814,152 bp
  • T to C, chromosome 6 at 132,626,727 bp
  • C to T, chromosome 6 at 146,566,611 bp
  • T to C, chromosome 7 at 25,289,590 bp
  • G to T, chromosome 7 at 27,158,416 bp
  • G to A, chromosome 7 at 27,910,356 bp
  • A to T, chromosome 7 at 28,459,768 bp
  • G to T, chromosome 7 at 82,493,373 bp
  • T to C, chromosome 7 at 90,240,351 bp
  • T to A, chromosome 7 at 100,510,864 bp
  • T to A, chromosome 7 at 110,042,109 bp
  • G to T, chromosome 7 at 111,052,303 bp
  • T to A, chromosome 7 at 127,879,739 bp
  • C to T, chromosome 7 at 141,272,603 bp
  • A to G, chromosome 8 at 4,628,590 bp
  • T to C, chromosome 8 at 13,416,155 bp
  • C to G, chromosome 8 at 15,042,629 bp
  • G to T, chromosome 8 at 47,712,882 bp
  • A to G, chromosome 8 at 84,633,646 bp
  • C to A, chromosome 8 at 111,134,734 bp
  • A to T, chromosome 9 at 39,909,841 bp
  • A to T, chromosome 9 at 40,074,309 bp
  • A to G, chromosome 9 at 44,933,294 bp
  • A to G, chromosome 9 at 57,137,337 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • TGCCGCCGCC to TGCCGCCGCCGCC, chromosome 9 at 65,651,680 bp
  • A to T, chromosome 9 at 75,273,553 bp
  • C to T, chromosome 9 at 86,569,233 bp
  • G to A, chromosome 9 at 105,864,833 bp
  • G to A, chromosome 9 at 107,583,017 bp
  • A to G, chromosome 9 at 108,829,906 bp
  • T to G, chromosome 9 at 118,534,594 bp
  • T to C, chromosome 10 at 18,115,705 bp
  • C to T, chromosome 10 at 125,231,198 bp
  • G to A, chromosome 10 at 127,236,815 bp
  • T to C, chromosome 10 at 127,742,700 bp
  • G to A, chromosome 11 at 49,625,477 bp
  • A to T, chromosome 11 at 86,506,785 bp
  • A to T, chromosome 11 at 87,099,366 bp
  • A to G, chromosome 11 at 87,636,055 bp
  • C to T, chromosome 11 at 98,629,858 bp
  • A to G, chromosome 11 at 99,785,396 bp
  • T to A, chromosome 12 at 113,271,850 bp
  • A to T, chromosome 13 at 21,072,425 bp
  • A to G, chromosome 13 at 27,388,566 bp
  • G to A, chromosome 13 at 59,715,857 bp
  • G to A, chromosome 13 at 59,717,465 bp
  • A to C, chromosome 13 at 67,042,047 bp
  • T to C, chromosome 13 at 100,316,136 bp
  • T to A, chromosome 13 at 113,095,984 bp
  • T to C, chromosome 14 at 52,204,883 bp
  • T to C, chromosome 14 at 54,973,180 bp
  • T to C, chromosome 14 at 68,639,210 bp
  • A to G, chromosome 15 at 11,311,658 bp
  • T to C, chromosome 15 at 73,565,100 bp
  • A to T, chromosome 15 at 74,616,113 bp
  • G to A, chromosome 16 at 17,642,302 bp
  • T to C, chromosome 16 at 17,653,562 bp
  • T to C, chromosome 16 at 20,699,456 bp
  • T to C, chromosome 16 at 21,914,189 bp
  • T to A, chromosome 17 at 28,194,993 bp
  • T to A, chromosome 17 at 34,515,542 bp
  • A to T, chromosome 17 at 34,678,910 bp
  • A to G, chromosome 17 at 46,677,097 bp
  • A to T, chromosome 17 at 78,663,120 bp
  • T to C, chromosome 17 at 80,038,623 bp
  • A to G, chromosome 18 at 22,067,638 bp
  • A to G, chromosome 18 at 37,301,317 bp
  • A to T, chromosome 18 at 67,414,172 bp
  • C to T, chromosome 19 at 5,717,691 bp
  • T to A, chromosome 19 at 10,964,047 bp
  • T to A, chromosome 19 at 17,199,878 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1838 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039865-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.