Strain Name:
C57BL/6J-MtgxR1838Btlr/Mmmh
Stock Number:
039865-MU
Citation ID:
RRID:MMRRC_039865-MU
Other Names:
R1838 (G1), C57BL/6J-MtgxR1838Btlr
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Khc, D10Bwg0738e, Kif5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MyHC-I, Myhcb, Myhc-b, beta-MHC, betaMHC, B-MHC, MYH-beta/slow
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Strn
Name: striatin, calmodulin binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268980
Homologene: 2380
Fam131a
Name: family with sequence similarity 131, member A
Synonyms: 2900046G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 78408
Homologene: 82234
Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: Gukmi1, WWP3, AIP3, BAP1, Baiap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Exoc6b
Name: exocyst complex component 6B
Synonyms: Sec15l2, G430127E12Rik, Sec15b, 4930569O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75914
Homologene: 44781
Lypd1
Name: Ly6/Plaur domain containing 1
Synonyms: C530008O16Rik, 2700050C12Rik, Lynx2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72585
Homologene: 16937
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Zfp523
Name: zinc finger protein 523
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224656
Homologene: 2569
Rps6kb1
Name: ribosomal protein S6 kinase, polypeptide 1
Synonyms: p70s6k, p70S6K1, S6K1, p70/85s6k, 2610318I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72508
Homologene: 81703
Golga4
Name: golgin A4
Synonyms: golgin-245, Olp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 54214
HGNC: HGNC:4427
Homologene: 68224
Reps1
Name: RalBP1 associated Eps domain containing protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19707
Homologene: 7515
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: 2510028H02Rik, Hnrpll, 2810036L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72692
Homologene: 26701
Med15
Name: mediator complex subunit 15
Synonyms: A230074L19Rik, Pcqap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 94112
VEGA: 16
Smpd4
Name: sphingomyelin phosphodiesterase 4
Synonyms: neutral membrane (neutral sphingomyelinase-3), 4122402O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 77626
Homologene: 9813
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329877
Homologene: 23057
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Ipo7
Name: importin 7
Synonyms: RanBP7, A330055O14Rik, Imp7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233726
HGNC: HGNC:9852
Homologene: 4659
Prr11
Name: proline rich 11
Synonyms: B930067F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 270906
Homologene: 10123
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: Duplin, 5830451P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67772
Homologene: 72405
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: Emv66, par, 2310036I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Pgm3
Name: phosphoglucomutase 3
Synonyms: 2810473H05Rik, Pgm-3, GlcNAc-P mutase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 109785
HGNC: HGNC:8907
Homologene: 9205
Ctr9
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Sh2bp1, Tsp, Tsbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22083
Homologene: 40668
Cic
Name: capicua transcriptional repressor
Synonyms: 1200010B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71722
Homologene: 87637
Adgrb2
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230775
HGNC: HGNC:944
Homologene: 1288
Uba6
Name: ubiquitin-like modifier activating enzyme 6
Synonyms: 5730469D23Rik, Ube1l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231380
Homologene: 10080
Sp3
Name: trans-acting transcription factor 3
Synonyms: D130027J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20687
Homologene: 7952
Helq
Name: helicase, POLQ-like
Synonyms: D430018E21Rik, Hel308
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 191578
Homologene: 14667
Gsdma3
Name: gasdermin A3
Synonyms: Rco2, Gsdm1l, Bsk, Gsdm3, Rim3, Dfl, Fgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 450219
Prune2
Name: prune homolog 2
Synonyms: A230083H22Rik, Olfaxin, 6330414G02Rik, A330102H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Adamts12
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239337
VEGA: 15
Homologene: 12808
Cdhr5
Name: cadherin-related family member 5
Synonyms: Mucdhl, Mupcdh, 1810074H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72040
HGNC: HGNC:7521
Homologene: 69345
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Rabgef1
Name: RAB guanine nucleotide exchange factor (GEF) 1
Synonyms: Ras negative regulator Rabex-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56715
Homologene: 8720
Cdc123
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98828
Homologene: 4394
Zfp958
Name: zinc finger protein 958
Synonyms: BC003267
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 233987
Homologene: 129582
Glt1d1
Name: glycosyltransferase 1 domain containing 1
Synonyms: 5730455A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319804
Homologene: 16965
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: alpha1A, Ccha1a, SCA6, Cacnl1a4, nmf352, smrl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Grk1
Name: G protein-coupled receptor kinase 1
Synonyms: Rhok, RK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 24013
Homologene: 2197
Tmco5
Name: transmembrane and coiled-coil domains 5
Synonyms: 1700095F04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67356
Homologene: 41661
Adamtsl3
Name: ADAMTS-like 3
Synonyms: 9230119C12Rik, punctin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269959
Homologene: 18912
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ms4a10
Name: membrane-spanning 4-domains, subfamily A, member 10
Synonyms: 2010001N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 69826
Homologene: 11355
Wdr95
Name: WD40 repeat domain 95
Synonyms: 4930434E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381693
Homologene: 124480
Abca4
Name: ATP-binding cassette, sub-family A (ABC1), member 4
Synonyms: D430003I15Rik, RmP, Abc10, Rim protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Lamc3
Name: laminin gamma 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 23928
HGNC: HGNC:6494
Homologene: 21222
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: Acvrinp1, Magi-2, S-SCAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 50791
Homologene: 8189
Zfp646
Name: zinc finger protein 646
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233905
Homologene: 8802
Mroh4
Name: maestro heat-like repeat family member 4
Synonyms: 1700016M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69439
Homologene: 72545
Btnl6
Name: butyrophilin-like 6
Synonyms: Gm6519, NG13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 624681
Homologene: 106849
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Hsf5
Name: heat shock transcription factor family member 5
Synonyms: LOC327992
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327992
Homologene: 52701
Gm4934
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56552
Homologene: 135915
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4, Naip-rs4A, Birc1f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Slc16a7
Name: solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms: 9030411M13Rik, 4921534N07Rik, MCT2, D630004K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20503
Homologene: 20990
Tnxb
Name: tenascin XB
Synonyms: TN-MHC, Tnx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 81877
Homologene: 49589
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Gm7455, Col6a5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 665033
Homologene: 122792
4933424B01Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Zfp712
Name: zinc finger protein 712
Synonyms: mszf31, mszf89, 4921504N20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 78251
VEGA: 13
Homologene: 136296
Map3k13
Name: mitogen-activated protein kinase kinase kinase 13
Synonyms: C130026N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 71751
VEGA: 16
HGNC: HGNC:6852
Homologene: 37958
Slc34a2
Name: solute carrier family 34 (sodium phosphate), member 2
Synonyms: Npt2b, NaPi-2b, D5Ertd227e, type IIb Na/Picotransporter
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20531
Homologene: 2297
Il6ra
Name: interleukin 6 receptor, alpha
Synonyms: IL-6 receptor alpha chain, CD126, Il6r, IL-6R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 16194
HGNC: HGNC:6019
Homologene: 474
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: flamingo, Adgrc3, Fmi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Kcna2
Name: potassium voltage-gated channel, shaker-related subfamily, member 2
Synonyms: Kca1-2, Akr6a4, Mk-2, Kv1.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 16490
HGNC: HGNC:6220
Homologene: 21034
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105841
Homologene: 28254
Ccdc178
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70950
VEGA: 18
Homologene: 12373
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Klhdc7a
Name: kelch domain containing 7A
Synonyms: B230308G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242721
Homologene: 17567
Adam28
Name: a disintegrin and metallopeptidase domain 28
Synonyms: D430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13522
VEGA: 14
HGNC: HGNC:206
Homologene: 40705
Ccdc83
Name: coiled-coil domain containing 83
Synonyms: 4930549K11Rik, 4930554C01Rik, 4932423M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75338
Homologene: 32709
Loxl3
Name: lysyl oxidase-like 3
Synonyms: Lor2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16950
Homologene: 56591
Ube4a
Name: ubiquitination factor E4A
Synonyms: 4732444G18Rik, UFD2b, 9930123J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 140630
Homologene: 3517
Cdkn2aip
Name: CDKN2A interacting protein
Synonyms: CARF, 4921511I16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 70925
Homologene: 9752
Or10s1
Name: olfactory receptor family 10 subfamily S member 1
Synonyms: GA_x6K02T2PVTD-33772307-33773260, MOR223-4, Olfr982
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258853
VEGA: 9
Homologene: 17415
Or2p2
Name: olfactory receptor family 2 subfamily P member 2
Synonyms: GA_x6K02T2QHY8-12181473-12182423, MOR256-14, Olfr1370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 258528
Homologene: 105231
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Cyp3a13
Name: cytochrome P450, family 3, subfamily a, polypeptide 13
Synonyms: steroid inducible, IIIAm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13113
Homologene: 133564
Dnajb13
Name: DnaJ heat shock protein family (Hsp40) member B13
Synonyms: 1700014P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69387
Homologene: 70141
BB014433
Name: expressed sequence BB014433
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 434285
Flt4
Name: FMS-like tyrosine kinase 4
Synonyms: VEGFR3, VEGFR-3, Flt-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14257
HGNC: HGNC:3767
Homologene: 7321
Zfp974
Name: zinc finger protein 974
Synonyms: 1700049G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73430
Ctnna2
Name: catenin (cadherin associated protein), alpha 2
Synonyms: Catna2, Catna, alpha N-catenin, alpha(N)-catenin, chp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Pcdhb3
Name: protocadherin beta 3
Synonyms: PcdhbC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93874
HGNC: HGNC:8688
Homologene: 115665
Or8g2
Name: olfactory receptor family 8 subfamily G member 2
Synonyms: Olfr229, GA_x6K02T02EEW-227-373, GA_x6K02T2PVTD-33608180-33608971, Olfr973, MOR171-14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258606
VEGA: 9
Homologene: 115513
Tpi1
Name: triosephosphate isomerase 1
Synonyms: Tpi-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21991
Homologene: 128432
Ldlrad2
Name: low density lipoprotein receptor class A domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 435811
VEGA: 4
Homologene: 54811
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384724
Homologene: 76639
Prl2b1
Name: prolactin family 2, subfamily b, member 1
Synonyms: Prlpk, 2310047B08Rik, PLP-K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 66392
HGNC: HGNC:9445
Homologene: 11963
Ighe
Name: Immunoglobulin heavy constant epsilon
Synonyms: Gm900, LOC380792
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380792
HGNC: HGNC:5522
Lrwd1
Name: leucine-rich repeats and WD repeat domain containing 1
Synonyms: 1200011O22Rik, Orca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71735
Homologene: 17678
A630073D07Rik
Name: RIKEN cDNA A630073D07 gene
Synonyms: LOC381819
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381819
Atp13a2
Name: ATPase type 13A2
Synonyms: 1110012E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74772
Homologene: 56940
Zbtb39
Name: zinc finger and BTB domain containing 39
Synonyms: 7030401O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 320080
VEGA: 10
Homologene: 8890
Klhdc3
Name: kelch domain containing 3
Synonyms: Peas, 1300011D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71765
VEGA: 17
Homologene: 14290
Pdpr
Name: pyruvate dehydrogenase phosphatase regulatory subunit
Synonyms: 4930402E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 319518
Homologene: 9948
Ralyl
Name: RALY RNA binding protein-like
Synonyms: 0710005M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76897
Homologene: 18366
Gzma
Name: granzyme A
Synonyms: Hanukah factor, Ctla-3, Hf, TSP-1, serine esterase 1, SE1, TSP1, H factor, Ctla3, BLT esterase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14938
VEGA: 13
HGNC: HGNC:4708
Homologene: 21237
Krtap4-9
Name: keratin associated protein 4-9
Synonyms: OTTMUSG00000002198
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 665998
Lrfn1
Name: leucine rich repeat and fibronectin type III domain containing 1
Synonyms: SALM2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 80749
Homologene: 12729
Rit1
Name: Ras-like without CAAX 1
Synonyms: Rit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19769
Homologene: 56003
Or4a79
Name: olfactory receptor family 4 subfamily A member 79
Synonyms: MOR231-22_p, GA_x6K02T2Q125-51162884-51161940, Olfr1252
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 404331
Homologene: 128094
Smad9
Name: SMAD family member 9
Synonyms: MADH6, SMAD8A, SMAD8B, Madh9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 55994
HGNC: HGNC:6774
Homologene: 21198
Naa80
Name: N(alpha)-acetyltransferase 80, NatH catalytic subunit
Synonyms: Nat6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56441
Homologene: 36325
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 25,084,270 bp
  • T to C, chromosome 1 at 46,116,177 bp
  • C to A, chromosome 1 at 46,277,105 bp
  • A to C, chromosome 1 at 53,192,098 bp
  • A to T, chromosome 1 at 125,873,371 bp
  • A to T, chromosome 2 at 5,794,891 bp
  • T to C, chromosome 2 at 31,925,582 bp
  • A to G, chromosome 2 at 72,938,176 bp
  • T to C, chromosome 2 at 76,727,192 bp
  • A to T, chromosome 2 at 89,721,709 bp
  • A to T, chromosome 2 at 116,880,879 bp
  • A to G, chromosome 3 at 14,143,412 bp
  • CTTT to CTT, chromosome 3 at 54,789,179 bp
  • C to G, chromosome 3 at 88,729,170 bp
  • T to C, chromosome 3 at 89,890,272 bp
  • A to T, chromosome 3 at 107,104,512 bp
  • G to A, chromosome 3 at 122,128,305 bp
  • A to G, chromosome 4 at 86,825,178 bp
  • A to T, chromosome 4 at 130,010,231 bp
  • A to T, chromosome 4 at 137,572,170 bp
  • G to T, chromosome 4 at 139,967,070 bp
  • T to A, chromosome 4 at 140,994,332 bp
  • A to T, chromosome 5 at 20,465,827 bp
  • A to T, chromosome 5 at 53,058,436 bp
  • G to T, chromosome 5 at 86,124,300 bp
  • A to T, chromosome 5 at 100,771,879 bp
  • A to G, chromosome 5 at 125,029,018 bp
  • G to A, chromosome 5 at 127,678,129 bp
  • A to G, chromosome 5 at 130,213,021 bp
  • A to G, chromosome 5 at 136,132,388 bp
  • A to T, chromosome 5 at 137,911,632 bp
  • A to G, chromosome 5 at 149,599,366 bp
  • T to C, chromosome 6 at 77,845,542 bp
  • T to C, chromosome 6 at 83,050,455 bp
  • T to A, chromosome 6 at 84,853,678 bp
  • A to G, chromosome 6 at 93,757,648 bp
  • C to T, chromosome 6 at 124,024,771 bp
  • T to C, chromosome 6 at 124,814,152 bp
  • T to C, chromosome 6 at 132,626,727 bp
  • C to T, chromosome 6 at 146,566,611 bp
  • T to C, chromosome 7 at 25,289,590 bp
  • G to T, chromosome 7 at 27,158,416 bp
  • G to A, chromosome 7 at 27,910,356 bp
  • A to T, chromosome 7 at 28,459,768 bp
  • G to T, chromosome 7 at 82,493,373 bp
  • T to C, chromosome 7 at 90,240,351 bp
  • T to A, chromosome 7 at 100,510,864 bp
  • T to A, chromosome 7 at 110,042,109 bp
  • G to T, chromosome 7 at 111,052,303 bp
  • T to A, chromosome 7 at 127,879,739 bp
  • C to T, chromosome 7 at 141,272,603 bp
  • A to G, chromosome 8 at 4,628,590 bp
  • T to C, chromosome 8 at 13,416,155 bp
  • C to G, chromosome 8 at 15,042,629 bp
  • G to T, chromosome 8 at 47,712,882 bp
  • A to G, chromosome 8 at 84,633,646 bp
  • C to A, chromosome 8 at 111,134,734 bp
  • A to T, chromosome 9 at 39,909,841 bp
  • A to T, chromosome 9 at 40,074,309 bp
  • A to G, chromosome 9 at 44,933,294 bp
  • A to G, chromosome 9 at 57,137,337 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • TGCCGCCGCC to TGCCGCCGCCGCC, chromosome 9 at 65,651,680 bp
  • A to T, chromosome 9 at 75,273,553 bp
  • C to T, chromosome 9 at 86,569,233 bp
  • G to A, chromosome 9 at 105,864,833 bp
  • G to A, chromosome 9 at 107,583,017 bp
  • A to G, chromosome 9 at 108,829,906 bp
  • T to G, chromosome 9 at 118,534,594 bp
  • T to C, chromosome 10 at 18,115,705 bp
  • C to T, chromosome 10 at 125,231,198 bp
  • G to A, chromosome 10 at 127,236,815 bp
  • T to C, chromosome 10 at 127,742,700 bp
  • G to A, chromosome 11 at 49,625,477 bp
  • A to T, chromosome 11 at 86,506,785 bp
  • A to T, chromosome 11 at 87,099,366 bp
  • A to G, chromosome 11 at 87,636,055 bp
  • C to T, chromosome 11 at 98,629,858 bp
  • A to G, chromosome 11 at 99,785,396 bp
  • T to A, chromosome 12 at 113,271,850 bp
  • A to T, chromosome 13 at 21,072,425 bp
  • A to G, chromosome 13 at 27,388,566 bp
  • G to A, chromosome 13 at 59,715,857 bp
  • G to A, chromosome 13 at 59,717,465 bp
  • A to C, chromosome 13 at 67,042,047 bp
  • T to C, chromosome 13 at 100,316,136 bp
  • T to A, chromosome 13 at 113,095,984 bp
  • T to C, chromosome 14 at 52,204,883 bp
  • T to C, chromosome 14 at 54,973,180 bp
  • T to C, chromosome 14 at 68,639,210 bp
  • A to G, chromosome 15 at 11,311,658 bp
  • T to C, chromosome 15 at 73,565,100 bp
  • A to T, chromosome 15 at 74,616,113 bp
  • G to A, chromosome 16 at 17,642,302 bp
  • T to C, chromosome 16 at 17,653,562 bp
  • T to C, chromosome 16 at 20,699,456 bp
  • T to C, chromosome 16 at 21,914,189 bp
  • T to A, chromosome 17 at 28,194,993 bp
  • T to A, chromosome 17 at 34,515,542 bp
  • A to T, chromosome 17 at 34,678,910 bp
  • A to G, chromosome 17 at 46,677,097 bp
  • A to T, chromosome 17 at 78,663,120 bp
  • T to C, chromosome 17 at 80,038,623 bp
  • A to G, chromosome 18 at 22,067,638 bp
  • A to G, chromosome 18 at 37,301,317 bp
  • A to T, chromosome 18 at 67,414,172 bp
  • C to T, chromosome 19 at 5,717,691 bp
  • T to A, chromosome 19 at 10,964,047 bp
  • T to A, chromosome 19 at 17,199,878 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1838 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039865-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.