Strain Name:
C57BL/6J-MtgxR1864Btlr/Mmmh
Stock Number:
039887-MU
Citation ID:
RRID:MMRRC_039887-MU
Other Names:
R1864 (G1), C57BL/6J-MtgxR1864Btlr
Major Collection:

Gene Information

Mitf
Name: melanogenesis associated transcription factor
Synonyms: BCC2, Gsfbcc2, wh, bHLHe32, mi
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 17342
HGNC: HGNC:7105
Homologene: 4892
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: A230020K14Rik, 5730405M06Rik, Rxrip13, N-CoR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Ubn2
Name: ubinuclein 2
Synonyms: D130059P03Rik, 6030408G03Rik, 2900060J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 320538
Homologene: 45564
Cdk17
Name: cyclin-dependent kinase 17
Synonyms: Pctk2, 6430598J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237459
VEGA: 10
HGNC: HGNC:8750
Homologene: 55666
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 22427
Homologene: 6659
Pum1
Name: pumilio RNA-binding family member 1
Synonyms: Pumm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 80912
Homologene: 22830
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, b2b3190Clo, Dock180, 9130006G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Birc2
Name: baculoviral IAP repeat-containing 2
Synonyms: MIAP1, cIAP1, HIAP1, mcIAP1, Api1, MIHB, IAP1, cIAP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 11797
HGNC: HGNC:590
Homologene: 900
Clcnka
Name: chloride channel, voltage-sensitive Ka
Synonyms: CLC-K1, Clcnk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 12733
Homologene: 65
Srsf11
Name: serine/arginine-rich splicing factor 11
Synonyms: 2610019N13Rik, 0610009J05Rik, Sfrs11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 69207
Homologene: 36164
Ahcyl2
Name: S-adenosylhomocysteine hydrolase-like 2
Synonyms: 4631427C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 74340
Homologene: 69337
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 170753
Homologene: 64370
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Kcnj8
Name: potassium inwardly-rectifying channel, subfamily J, member 8
Synonyms: Kir6.1, slmbr, gnite, sltr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 16523
HGNC: HGNC:6269
Homologene: 3654
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: ARHGAP10, 5530401C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 71435
Homologene: 10822
Ccdc91
Name: coiled-coil domain containing 91
Synonyms: 1700086G08Rik, 1810060J02Rik, p56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 67015
Homologene: 10131
Agrn
Name: agrin
Synonyms: Agrin, NMF380, nmf380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Ppp2r5e
Name: protein phosphatase 2, regulatory subunit B', epsilon
Synonyms: B56beta, protein phosphatase 2A subunit beta, 4633401M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 26932
VEGA: 12
HGNC: HGNC:9313
Homologene: 55962
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, Sci, A230102L03Rik, Atbf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Fxr2
Name: fragile X mental retardation, autosomal homolog 2
Synonyms: Fxr2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 23879
HGNC: HGNC:4024
Homologene: 21014
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Diaph2
Name: diaphanous related formin 2
Synonyms: Diap2, mDia3, E430022I22Rik, Dia3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 54004
HGNC: HGNC:2877
Homologene: 138404
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22019
Homologene: 2471
Dhx15
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 15
Synonyms: Ddx15, HRH2, DBP1, mDEAH9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 13204
HGNC: HGNC:2738
Homologene: 1040
Brd2
Name: bromodomain containing 2
Synonyms: Ring3, D17H6S113E, Frg-1, Rnf3, Fsrg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 14312
HGNC: HGNC:1103
Homologene: 74540
Srbd1
Name: S1 RNA binding domain 1
Synonyms: D530025C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 78586
VEGA: 17
Homologene: 9994
Nufip2
Name: nuclear fragile X mental retardation protein interacting protein 2
Synonyms: 9530056D24Rik, 1110001M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 68564
Homologene: 10808
Lgr4
Name: leucine-rich repeat-containing G protein-coupled receptor 4
Synonyms: A930009A08Rik, A330106J01Rik, Gpr48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 107515
Homologene: 10226
Rsf1
Name: remodeling and spacing factor 1
Synonyms: XAP8, p325, 4832420A03Rik, C030033M12Rik, Hbxap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233532
Homologene: 41142
Hspa5
Name: heat shock protein 5
Synonyms: Sez7, Bip, D2Wsu17e, D2Wsu141e, Hsce70, XAP-1 antigen, 78kDa, baffled, Grp78, mBiP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14828
HGNC: HGNC:5238
Homologene: 3908
Ngdn
Name: neuroguidin, EIF4E binding protein
Synonyms: Ngd, neuroguidin, 1500001L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 68966
VEGA: 14
Homologene: 44286
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230249
Homologene: 6056
Foxi1
Name: forkhead box I1
Synonyms: Fkh10, Hfh3, HFH-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14233
HGNC: HGNC:3815
Homologene: 8140
Hipk2
Name: homeodomain interacting protein kinase 2
Synonyms: Stank, B230339E18Rik, 1110014O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 15258
Homologene: 68766
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: Tg(SMN2)89Ahmb, SMN2, 6330570A01Rik, mGlu7a receptor, E130018M02Rik, Gpr1g, mGluR7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Btla
Name: B and T lymphocyte associated
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 208154
Homologene: 52233
Itgb3
Name: integrin beta 3
Synonyms: platelet glycoprotein IIIa (GP3A), CD61
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16416
HGNC: HGNC:6156
Homologene: 55444
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 20264
VEGA: 9
Homologene: 21300
Dhx32
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 32
Synonyms: Ddx32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 101437
Homologene: 56798
Epg5
Name: ectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms: 5430411K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 100502841
VEGA: 18
Homologene: 14575
Ube2c
Name: ubiquitin-conjugating enzyme E2C
Synonyms: 1110015A16Rik, D2Ertd695e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 68612
Homologene: 5096
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: Pdgfr, CD140b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Gdpd5
Name: glycerophosphodiester phosphodiesterase domain containing 5
Synonyms: Gde2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233552
Homologene: 32741
Flna
Name: filamin, alpha
Synonyms: Dilp2, filamin-1, F730004A14Rik, actin-binding protein 280, Fln1, ABP-280, GENA 379
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 192176
HGNC: HGNC:3754
Homologene: 1119
Morc1
Name: microrchidia 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 17450
VEGA: 16
HGNC: HGNC:7198
Homologene: 7843
Stx4a
Name: syntaxin 4A (placental)
Synonyms: Syn4, Syn-4, Stx4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20909
Homologene: 105435
Rnf115
Name: ring finger protein 115
Synonyms: Rabring7, 2610028E05Rik, Zfp364
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 67845
Homologene: 69167
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 72205
Homologene: 8125
Heatr6
Name: HEAT repeat containing 6
Synonyms: 2700008B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217026
Homologene: 11116
Ddrgk1
Name: DDRGK domain containing 1
Synonyms: 2600009E05Rik, 1110001I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 77006
Homologene: 11400
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 407821
Homologene: 46592
Prom2
Name: prominin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 192212
Homologene: 44536
Wnt8b
Name: wingless-type MMTV integration site family, member 8B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 22423
VEGA: 19
Homologene: 2550
Atp2a3
Name: ATPase, Ca++ transporting, ubiquitous
Synonyms: Serca3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 53313
HGNC: HGNC:813
Homologene: 69131
Gm13212
Name: predicted gene 13212
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 433801
Homologene: 133076
Agtpbp1
Name: ATP/GTP binding protein 1
Synonyms: 5730402G09Rik, 2310001G17Rik, Ccp1, 4930445M19Rik, 2900054O13Rik, Nna1, 1700020N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 67269
Homologene: 9067
Sv2b
Name: synaptic vesicle glycoprotein 2 b
Synonyms: A830038F04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 64176
Homologene: 32236
Pnp
Name: purine-nucleoside phosphorylase
Synonyms: Pnp1, Pnp, Np, Np-2, Np-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 18950
HGNC: HGNC:7892
Homologene: 227
Umod
Name: uromodulin
Synonyms: Tamm-Horsfall glycoprotein, uromucoid, Urehd1, urehr4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 22242
Homologene: 2522
Myo7a
Name: myosin VIIA
Synonyms: USH1B, Hdb, Myo7, polka, nmf371
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Arhgef28
Name: Rho guanine nucleotide exchange factor (GEF) 28
Synonyms: RhoGEF, p190RhoGEF, Rgnef, 9230110L08Rik, D13Bwg1089e, RIP2, Rho specific exchange factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 110596
VEGA: 13
Homologene: 8078
Myof
Name: myoferlin
Synonyms: E030042N20Rik, Fer1l3, 2310051D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226101
VEGA: 19
HGNC: HGNC:3656
Homologene: 40882
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: SMCC1, Clc-1, NMF355, Clc1, nmf355
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Hps3
Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms: Hermansky-Pudlak syndrome 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12807
Homologene: 13019
Insc
Name: INSC spindle orientation adaptor protein
Synonyms: 3830422K02Rik, Inscuteable
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233752
Homologene: 78662
Ano4
Name: anoctamin 4
Synonyms: A330096O15Rik, Tmem16d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 320091
Homologene: 66599
Rusc2
Name: RUN and SH3 domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100213
Homologene: 18967
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Ppp1r3a
Name: protein phosphatase 1, regulatory subunit 3A
Synonyms: GM, RGL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 140491
HGNC: HGNC:9291
Homologene: 48124
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Ccdc84
Name: coiled-coil domain containing 84
Synonyms: LOC382073, D630044F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 382073
VEGA: 9
Homologene: 13886
Tgm5
Name: transglutaminase 5
Synonyms: TGx, 2310007C07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 74176
Homologene: 20899
Zfp608
Name: zinc finger protein 608
Synonyms: 4932417D18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 269023
VEGA: 18
Homologene: 18485
Tgfbi
Name: transforming growth factor, beta induced
Synonyms: Beta-ig, bIG-h3, 68kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 21810
VEGA: 13
Homologene: 37294
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, LTRPC1, melastatin, 4732499L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20192
Homologene: 68151
Ttc22
Name: tetratricopeptide repeat domain 22
Synonyms: 4732467L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230576
Homologene: 89253
Ankrd50
Name: ankyrin repeat domain 50
Synonyms: E430012K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99696
Homologene: 129859
Ecm2
Name: extracellular matrix protein 2, female organ and adipocyte specific
Synonyms: tenonectin, 9030618O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 407800
VEGA: 13
HGNC: HGNC:3154
Homologene: 1064
Dalrd3
Name: DALR anticodon binding domain containing 3
Synonyms: 6330580J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 67789
Homologene: 32388
Parp10
Name: poly (ADP-ribose) polymerase family, member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 671535
Homologene: 53133
Skint2
Name: selection and upkeep of intraepithelial T cells 2
Synonyms: B7S3, OTTMUSG00000008540
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 329919
HGNC: null
Homologene: 136741
Anxa1
Name: annexin A1
Synonyms: Lpc1, Anx-1, Lpc-1, C430014K04Rik, Anx-A1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 16952
HGNC: HGNC:533
Homologene: 563
Npr2
Name: natriuretic peptide receptor 2
Synonyms: guanylyl cyclase-B, cn, pwe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: 5730414M22Rik, BKCa, Slo, BK channel alpha subunit, MaxiK, Slo1, mSlo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Sh2d4a
Name: SH2 domain containing 4A
Synonyms: 2210402M20Rik, SH2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 72281
Homologene: 11117
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Gm7455, Col6a5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 665033
Homologene: 122792
Ush1c
Name: USH1 protein network component harmonin
Synonyms: harmonin, 2010016F01Rik, Usher syndrome 1C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 72088
Homologene: 77476
Cts6
Name: cathepsin 6
Synonyms: 1600022N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 58518
HGNC: null
Homologene: 75165
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: M-type receptor, Pla2g1br, PLA2-I receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
D630003M21Rik
Name: RIKEN cDNA D630003M21 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228846
Homologene: 18598
Gmpr
Name: guanosine monophosphate reductase
Synonyms: 2310004P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 66355
HGNC: HGNC:4376
Homologene: 5009
Serpina1d
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1D
Synonyms: Spi1-4, PI4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20703
HGNC: HGNC:8941
Homologene: 20103
Serpinf2
Name: serine (or cysteine) peptidase inhibitor, clade F, member 2
Synonyms: Pli, alpha 2 antiplasmin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 18816
HGNC: HGNC:9075
Homologene: 719
Slc29a4
Name: solute carrier family 29 (nucleoside transporters), member 4
Synonyms: ENT4, mPMAT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243328
Homologene: 71345
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Col6a2
Name: collagen, type VI, alpha 2
Synonyms: Col6a-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 12834
HGNC: HGNC:2212
Homologene: 1392
Mctp1
Name: multiple C2 domains, transmembrane 1
Synonyms: 2810465F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 78771
Homologene: 75211
Sh3rf2
Name: SH3 domain containing ring finger 2
Synonyms: RNF158, 9130023G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 269016
Homologene: 17618
Emilin1
Name: elastin microfibril interfacer 1
Synonyms: gp115, EMILIN-1, 5830419M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100952
Homologene: 5117
Klc3
Name: kinesin light chain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232943
Homologene: 14899
Shc4
Name: SHC (Src homology 2 domain containing) family, member 4
Synonyms: LOC271849, 9930029B02Rik, 6230417E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 271849
Homologene: 19567
Oxa1l
Name: oxidase assembly 1-like
Synonyms: 1810020M02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 69089
HGNC: HGNC:8526
Homologene: 31281
AC163020.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
Olfr204
Name: olfactory receptor 204
Synonyms: GA_x54KRFPKG5P-55529713-55528796, MOR182-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 258994
HGNC: null
Homologene: 79425
Olfr982
Name: olfactory receptor 982
Synonyms: GA_x6K02T2PVTD-33772307-33773260, MOR223-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258853
VEGA: 9
Homologene: 17415
Apc2
Name: adenomatosis polyposis coli 2
Synonyms: APCL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 23805
Homologene: 4299
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98733
Homologene: null
Lcn2
Name: lipocalin 2
Synonyms: NRL, neu-related lipocalin, 24p3, NGAL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16819
HGNC: HGNC:6526
Homologene: 4064
Cilp2
Name: cartilage intermediate layer protein 2
Synonyms: 1110031K21Rik, CLIP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 68709
Homologene: 17713
Cyp3a25
Name: cytochrome P450, family 3, subfamily a, polypeptide 25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 56388
HGNC: null
Homologene: 135775
Ccl7
Name: chemokine (C-C motif) ligand 7
Synonyms: mcp3, marc, MCP-3, Scya7, fic
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 20306
Homologene: 133974
Dnd1
Name: DND microRNA-mediated repression inhibitor 1
Synonyms: RBMS4, Ter
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 213236
Homologene: 65262
Akp3
Name: alkaline phosphatase 3, intestine, not Mn requiring
Synonyms: IAP, Akp-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11648
Homologene: 134333
Aph1b
Name: aph1 homolog B, gamma secretase subunit
Synonyms: 2310057K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 208117
Homologene: 12844
Asic5
Name: acid-sensing (proton-gated) ion channel family member 5
Synonyms: brain-liver-intestine amiloride-sensitive sodium channel, Accn5, BLINaC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 58170
Homologene: 41171
Olfr695
Name: olfactory receptor 695
Synonyms: GA_x6K02T2PBJ9-9092181-9091234, MOR283-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258591
HGNC: null
Homologene: 133597
B4galnt4
Name: beta-1,4-N-acetyl-galactosaminyl transferase 4
Synonyms: LOC381951
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 330671
Homologene: 27982
Slc38a3
Name: solute carrier family 38, member 3
Synonyms: Snat3, 0610012J02Rik, D9Ucla2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 76257
Homologene: 4983
Heph
Name: hephaestin
Synonyms: Cpl, sla, C130006F04Rik, sex linked anemia
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 15203
HGNC: HGNC:4866
Homologene: 32094
Sirt5
Name: sirtuin 5
Synonyms: 0610012J09Rik, 1500032M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 68346
VEGA: 13
Homologene: 40825
Olfr1282
Name: olfactory receptor 1282
Synonyms: MOR248-2, Olfr1557, GA_x6K02T2Q125-72387537-72386620, MOR248-16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258909
HGNC: null
Homologene: 73992
Sh3d21
Name: SH3 domain containing 21
Synonyms: 1700029G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 66938
Homologene: 12057
Olfr877
Name: olfactory receptor 877
Synonyms: MOR161-5, GA_x6K02T2PVTD-31540342-31541277
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258412
HGNC: null
Homologene: 121556
Lypd6b
Name: LY6/PLAUR domain containing 6B
Synonyms: 2310010M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 71897
Homologene: 12419
Drp2
Name: dystrophin related protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 13497
HGNC: HGNC:3032
Homologene: 55620
Olfr1262
Name: olfactory receptor 1262
Synonyms: MOR234-1, GA_x6K02T2Q125-51434523-51435437
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258976
HGNC: null
Homologene: 74064
Vmn1r238
Name: vomeronasal 1 receptor, 238
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 100312476
HGNC: null
Homologene: 128342
1600012P17Rik
Name: RIKEN cDNA 1600012P17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: null
HGNC: null
Homologene: null
Slc35a5
Name: solute carrier family 35, member A5
Synonyms: D16Ertd450e, D730043G07Rik, 1010001J06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 74102
Homologene: 9930
Fam187a
Name: family with sequence similarity 187, member A
Synonyms: 4933439F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 66784
Homologene: 128440
Tmem37
Name: transmembrane protein 37
Synonyms: Pr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 170706
Homologene: 10447
5031425E22Rik
Name: RIKEN cDNA 5031425E22 gene
Synonyms: BC050254
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 102635844
HGNC: null
Homologene: null
Tmem213
Name: transmembrane protein 213
Synonyms: D630002J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 77522
Homologene: 28553
Adgrg2
Name: adhesion G protein-coupled receptor G2
Synonyms: Gpr64, Me6, B830041D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 237175
HGNC: HGNC:4516
Homologene: 4208
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,327,612 bp
  • T to A, chromosome 1 at 40,524,787 bp
  • A to G, chromosome 1 at 43,960,225 bp
  • G to A, chromosome 1 at 75,493,109 bp
  • TCACCACCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCACCACCAC, chromosome 1 at 87,127,767 bp
  • A to G, chromosome 1 at 120,068,222 bp
  • A to G, chromosome 1 at 158,969,524 bp
  • T to C, chromosome 2 at 20,861,204 bp
  • T to C, chromosome 2 at 32,385,422 bp
  • T to C, chromosome 2 at 34,774,541 bp
  • A to G, chromosome 2 at 49,947,447 bp
  • G to T, chromosome 2 at 52,212,760 bp
  • G to A, chromosome 2 at 60,428,711 bp
  • T to A, chromosome 2 at 90,002,481 bp
  • T to A, chromosome 2 at 110,011,397 bp
  • C to T, chromosome 2 at 111,335,707 bp
  • A to T, chromosome 2 at 112,730,328 bp
  • T to C, chromosome 2 at 121,075,218 bp
  • T to C, chromosome 2 at 125,639,367 bp
  • T to C, chromosome 2 at 127,539,787 bp
  • A to T, chromosome 2 at 130,654,295 bp
  • A to T, chromosome 2 at 158,203,185 bp
  • C to A, chromosome 2 at 164,770,023 bp
  • A to G, chromosome 3 at 9,474,491 bp
  • T to A, chromosome 3 at 20,019,959 bp
  • A to T, chromosome 3 at 38,454,461 bp
  • A to G, chromosome 3 at 82,011,987 bp
  • A to G, chromosome 3 at 96,727,837 bp
  • G to T, chromosome 3 at 158,036,501 bp
  • C to A, chromosome 4 at 43,421,719 bp
  • T to A, chromosome 4 at 43,641,258 bp
  • T to A, chromosome 4 at 58,849,942 bp
  • T to C, chromosome 4 at 106,636,806 bp
  • T to A, chromosome 4 at 112,625,909 bp
  • T to A, chromosome 4 at 126,150,936 bp
  • T to C, chromosome 4 at 130,751,525 bp
  • T to C, chromosome 4 at 141,392,802 bp
  • A to T, chromosome 4 at 145,622,428 bp
  • GCTCT to GCTCTCT, chromosome 4 at 156,166,519 bp
  • A to T, chromosome 5 at 23,433,110 bp
  • A to G, chromosome 5 at 30,918,590 bp
  • T to C, chromosome 5 at 52,184,701 bp
  • A to G, chromosome 5 at 142,717,754 bp
  • T to C, chromosome 5 at 145,994,929 bp
  • A to T, chromosome 6 at 14,718,405 bp
  • G to A, chromosome 6 at 29,908,355 bp
  • A to G, chromosome 6 at 38,109,552 bp
  • T to A, chromosome 6 at 38,440,490 bp
  • T to A, chromosome 6 at 38,718,935 bp
  • T to A, chromosome 6 at 42,305,541 bp
  • A to T, chromosome 6 at 98,010,422 bp
  • A to T, chromosome 6 at 111,080,423 bp
  • A to T, chromosome 6 at 115,969,441 bp
  • T to A, chromosome 6 at 142,570,240 bp
  • T to C, chromosome 6 at 147,592,225 bp
  • A to G, chromosome 7 at 19,201,878 bp
  • A to G, chromosome 7 at 19,398,041 bp
  • G to A, chromosome 7 at 46,219,392 bp
  • A to C, chromosome 7 at 47,310,161 bp
  • A to G, chromosome 7 at 64,268,016 bp
  • A to T, chromosome 7 at 75,124,080 bp
  • ATGGCG to ATGGCGACGGTGGCG, chromosome 7 at 97,579,904 bp
  • T to C, chromosome 7 at 98,052,256 bp
  • T to C, chromosome 7 at 99,448,999 bp
  • T to C, chromosome 7 at 106,713,823 bp
  • T to C, chromosome 7 at 114,842,178 bp
  • A to T, chromosome 7 at 119,463,255 bp
  • A to G, chromosome 7 at 127,843,652 bp
  • A to T, chromosome 7 at 133,737,296 bp
  • A to C, chromosome 7 at 135,146,507 bp
  • A to G, chromosome 7 at 141,070,533 bp
  • G to A, chromosome 8 at 33,288,864 bp
  • C to A, chromosome 8 at 68,329,315 bp
  • C to A, chromosome 8 at 69,881,323 bp
  • T to C, chromosome 8 at 108,800,698 bp
  • G to T, chromosome 9 at 7,819,517 bp
  • T to A, chromosome 9 at 37,855,264 bp
  • T to G, chromosome 9 at 40,074,785 bp
  • A to G, chromosome 9 at 44,417,721 bp
  • A to T, chromosome 9 at 66,794,113 bp
  • A to T, chromosome 9 at 79,627,103 bp
  • T to C, chromosome 9 at 105,912,447 bp
  • A to T, chromosome 9 at 107,655,953 bp
  • T to C, chromosome 9 at 108,571,041 bp
  • A to T, chromosome 9 at 119,669,946 bp
  • T to C, chromosome 10 at 76,604,048 bp
  • C to T, chromosome 10 at 80,313,648 bp
  • C to A, chromosome 10 at 88,971,391 bp
  • T to C, chromosome 10 at 93,226,105 bp
  • T to C, chromosome 11 at 5,283,373 bp
  • T to A, chromosome 11 at 34,207,531 bp
  • A to G, chromosome 11 at 62,381,419 bp
  • A to T, chromosome 11 at 69,652,277 bp
  • A to C, chromosome 11 at 72,989,091 bp
  • G to T, chromosome 11 at 75,437,483 bp
  • A to G, chromosome 11 at 77,692,298 bp
  • G to T, chromosome 11 at 82,046,552 bp
  • T to C, chromosome 11 at 83,769,230 bp
  • T to A, chromosome 11 at 102,886,011 bp
  • T to A, chromosome 11 at 104,643,571 bp
  • C to G, chromosome 12 at 75,469,567 bp
  • C to A, chromosome 12 at 103,767,997 bp
  • T to A, chromosome 13 at 43,380,490 bp
  • G to T, chromosome 13 at 45,542,625 bp
  • T to C, chromosome 13 at 49,530,145 bp
  • T to C, chromosome 13 at 56,632,881 bp
  • A to G, chromosome 13 at 59,450,202 bp
  • A to G, chromosome 13 at 61,201,579 bp
  • G to A, chromosome 13 at 76,385,148 bp
  • A to T, chromosome 13 at 97,994,132 bp
  • T to A, chromosome 14 at 23,803,162 bp
  • G to C, chromosome 14 at 50,947,973 bp
  • C to A, chromosome 14 at 54,366,706 bp
  • T to C, chromosome 14 at 55,023,219 bp
  • A to G, chromosome 15 at 76,233,609 bp
  • A to T, chromosome 16 at 17,367,525 bp
  • A to G, chromosome 16 at 32,756,251 bp
  • A to T, chromosome 16 at 45,143,708 bp
  • C to T, chromosome 16 at 45,250,374 bp
  • T to C, chromosome 16 at 48,592,530 bp
  • A to G, chromosome 16 at 59,315,015 bp
  • A to T, chromosome 17 at 34,113,835 bp
  • A to G, chromosome 17 at 86,115,304 bp
  • T to A, chromosome 18 at 3,123,040 bp
  • A to G, chromosome 18 at 36,766,004 bp
  • T to A, chromosome 18 at 42,053,981 bp
  • A to G, chromosome 18 at 54,897,911 bp
  • G to A, chromosome 18 at 61,071,717 bp
  • T to A, chromosome 18 at 77,975,031 bp
  • T to C, chromosome 19 at 20,379,689 bp
  • T to C, chromosome 19 at 37,986,705 bp
  • T to C, chromosome 19 at 44,493,590 bp
  • T to C, chromosome X at 74,240,263 bp
  • A to G, chromosome X at 96,529,486 bp
  • G to A, chromosome X at 129,960,127 bp
  • A to G, chromosome X at 134,427,115 bp
  • G to A, chromosome X at 160,482,351 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1864 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039887-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.