Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1864Btlr/Mmmh
Stock Number:
039887-MU
Citation ID:
RRID:MMRRC_039887-MU
Other Names:
R1864 (G1), C57BL/6J-MtgxR1864Btlr
Major Collection:

Strain Information

Mitf
Name: melanogenesis associated transcription factor
Synonyms: mi, wh, BCC2, bHLHe32, Gsfbcc2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17342
HGNC: HGNC:7105
Homologene: 4892
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Ubn2
Name: ubinuclein 2
Synonyms: 6030408G03Rik, 2900060J04Rik, D130059P03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320538
Homologene: 45564
Cdk17
Name: cyclin dependent kinase 17
Synonyms: 6430598J10Rik, Pctk2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237459
VEGA: 10
HGNC: HGNC:8750
Homologene: 55666
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,327,612 bp
  • T to A, chromosome 1 at 40,524,787 bp
  • A to G, chromosome 1 at 43,960,225 bp
  • G to A, chromosome 1 at 75,493,109 bp
  • TCACCACCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCACCACCAC, chromosome 1 at 87,127,767 bp
  • A to G, chromosome 1 at 120,068,222 bp
  • A to G, chromosome 1 at 158,969,524 bp
  • T to C, chromosome 2 at 20,861,204 bp
  • T to C, chromosome 2 at 32,385,422 bp
  • T to C, chromosome 2 at 34,774,541 bp
  • A to G, chromosome 2 at 49,947,447 bp
  • G to T, chromosome 2 at 52,212,760 bp
  • G to A, chromosome 2 at 60,428,711 bp
  • T to A, chromosome 2 at 90,002,481 bp
  • T to A, chromosome 2 at 110,011,397 bp
  • C to T, chromosome 2 at 111,335,707 bp
  • A to T, chromosome 2 at 112,730,328 bp
  • T to C, chromosome 2 at 121,075,218 bp
  • T to C, chromosome 2 at 125,639,367 bp
  • T to C, chromosome 2 at 127,539,787 bp
  • A to T, chromosome 2 at 130,654,295 bp
  • A to T, chromosome 2 at 158,203,185 bp
  • C to A, chromosome 2 at 164,770,023 bp
  • A to G, chromosome 3 at 9,474,491 bp
  • T to A, chromosome 3 at 20,019,959 bp
  • A to T, chromosome 3 at 38,454,461 bp
  • A to G, chromosome 3 at 82,011,987 bp
  • A to G, chromosome 3 at 96,727,837 bp
  • G to T, chromosome 3 at 158,036,501 bp
  • C to A, chromosome 4 at 43,421,719 bp
  • T to A, chromosome 4 at 43,641,258 bp
  • T to A, chromosome 4 at 58,849,942 bp
  • T to C, chromosome 4 at 106,636,806 bp
  • T to A, chromosome 4 at 112,625,909 bp
  • T to A, chromosome 4 at 126,150,936 bp
  • T to C, chromosome 4 at 130,751,525 bp
  • T to C, chromosome 4 at 141,392,802 bp
  • A to T, chromosome 4 at 145,622,428 bp
  • GCTCT to GCTCTCT, chromosome 4 at 156,166,519 bp
  • A to T, chromosome 5 at 23,433,110 bp
  • A to G, chromosome 5 at 30,918,590 bp
  • T to C, chromosome 5 at 52,184,701 bp
  • A to G, chromosome 5 at 142,717,754 bp
  • T to C, chromosome 5 at 145,994,929 bp
  • A to T, chromosome 6 at 14,718,405 bp
  • G to A, chromosome 6 at 29,908,355 bp
  • A to G, chromosome 6 at 38,109,552 bp
  • T to A, chromosome 6 at 38,440,490 bp
  • T to A, chromosome 6 at 38,718,935 bp
  • T to A, chromosome 6 at 42,305,541 bp
  • A to T, chromosome 6 at 98,010,422 bp
  • A to T, chromosome 6 at 111,080,423 bp
  • A to T, chromosome 6 at 115,969,441 bp
  • T to A, chromosome 6 at 142,570,240 bp
  • T to C, chromosome 6 at 147,592,225 bp
  • A to G, chromosome 7 at 19,201,878 bp
  • A to G, chromosome 7 at 19,398,041 bp
  • G to A, chromosome 7 at 46,219,392 bp
  • A to C, chromosome 7 at 47,310,161 bp
  • A to G, chromosome 7 at 64,268,016 bp
  • A to T, chromosome 7 at 75,124,080 bp
  • ATGGCG to ATGGCGACGGTGGCG, chromosome 7 at 97,579,904 bp
  • T to C, chromosome 7 at 98,052,256 bp
  • T to C, chromosome 7 at 99,448,999 bp
  • T to C, chromosome 7 at 106,713,823 bp
  • T to C, chromosome 7 at 114,842,178 bp
  • A to T, chromosome 7 at 119,463,255 bp
  • A to G, chromosome 7 at 127,843,652 bp
  • A to T, chromosome 7 at 133,737,296 bp
  • A to C, chromosome 7 at 135,146,507 bp
  • A to G, chromosome 7 at 141,070,533 bp
  • G to A, chromosome 8 at 33,288,864 bp
  • C to A, chromosome 8 at 68,329,315 bp
  • C to A, chromosome 8 at 69,881,323 bp
  • T to C, chromosome 8 at 108,800,698 bp
  • G to T, chromosome 9 at 7,819,517 bp
  • T to A, chromosome 9 at 37,855,264 bp
  • T to G, chromosome 9 at 40,074,785 bp
  • A to G, chromosome 9 at 44,417,721 bp
  • A to T, chromosome 9 at 66,794,113 bp
  • A to T, chromosome 9 at 79,627,103 bp
  • T to C, chromosome 9 at 105,912,447 bp
  • A to T, chromosome 9 at 107,655,953 bp
  • T to C, chromosome 9 at 108,571,041 bp
  • A to T, chromosome 9 at 119,669,946 bp
  • T to C, chromosome 10 at 76,604,048 bp
  • C to T, chromosome 10 at 80,313,648 bp
  • C to A, chromosome 10 at 88,971,391 bp
  • T to C, chromosome 10 at 93,226,105 bp
  • T to C, chromosome 11 at 5,283,373 bp
  • T to A, chromosome 11 at 34,207,531 bp
  • A to G, chromosome 11 at 62,381,419 bp
  • A to T, chromosome 11 at 69,652,277 bp
  • A to C, chromosome 11 at 72,989,091 bp
  • G to T, chromosome 11 at 75,437,483 bp
  • A to G, chromosome 11 at 77,692,298 bp
  • G to T, chromosome 11 at 82,046,552 bp
  • T to C, chromosome 11 at 83,769,230 bp
  • T to A, chromosome 11 at 102,886,011 bp
  • T to A, chromosome 11 at 104,643,571 bp
  • C to G, chromosome 12 at 75,469,567 bp
  • C to A, chromosome 12 at 103,767,997 bp
  • T to A, chromosome 13 at 43,380,490 bp
  • G to T, chromosome 13 at 45,542,625 bp
  • T to C, chromosome 13 at 49,530,145 bp
  • T to C, chromosome 13 at 56,632,881 bp
  • A to G, chromosome 13 at 59,450,202 bp
  • A to G, chromosome 13 at 61,201,579 bp
  • G to A, chromosome 13 at 76,385,148 bp
  • A to T, chromosome 13 at 97,994,132 bp
  • T to A, chromosome 14 at 23,803,162 bp
  • G to C, chromosome 14 at 50,947,973 bp
  • C to A, chromosome 14 at 54,366,706 bp
  • T to C, chromosome 14 at 55,023,219 bp
  • A to G, chromosome 15 at 76,233,609 bp
  • A to T, chromosome 16 at 17,367,525 bp
  • A to G, chromosome 16 at 32,756,251 bp
  • A to T, chromosome 16 at 45,143,708 bp
  • C to T, chromosome 16 at 45,250,374 bp
  • T to C, chromosome 16 at 48,592,530 bp
  • A to G, chromosome 16 at 59,315,015 bp
  • A to T, chromosome 17 at 34,113,835 bp
  • A to G, chromosome 17 at 86,115,304 bp
  • T to A, chromosome 18 at 3,123,040 bp
  • A to G, chromosome 18 at 36,766,004 bp
  • T to A, chromosome 18 at 42,053,981 bp
  • A to G, chromosome 18 at 54,897,911 bp
  • G to A, chromosome 18 at 61,071,717 bp
  • T to A, chromosome 18 at 77,975,031 bp
  • T to C, chromosome 19 at 20,379,689 bp
  • T to C, chromosome 19 at 37,986,705 bp
  • T to C, chromosome 19 at 44,493,590 bp
  • T to C, chromosome X at 74,240,263 bp
  • A to G, chromosome X at 96,529,486 bp
  • G to A, chromosome X at 129,960,127 bp
  • A to G, chromosome X at 134,427,115 bp
  • G to A, chromosome X at 160,482,351 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1864 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039887-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.