Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1876Btlr/Mmmh
Stock Number:
039898-MU
Citation ID:
RRID:MMRRC_039898-MU
Other Names:
R1876 (G1), C57BL/6J-MtgxR1876Btlr
Major Collection:

Strain Information

Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Pepd
Name: peptidase D
Synonyms: Pep-4, peptidase D, Pep4, dal
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18624
HGNC: HGNC:8840
Homologene: 239
Strn4
Name: striatin, calmodulin binding protein 4
Synonyms: ZIN, zinedin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 97387
Homologene: 8378
Aasdh
Name: aminoadipate-semialdehyde dehydrogenase
Synonyms: A230062G08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231326
Homologene: 71711
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 45,342,235 bp
  • A to G, chromosome 1 at 75,484,923 bp
  • T to A, chromosome 1 at 188,678,289 bp
  • G to A, chromosome 2 at 25,040,973 bp
  • A to T, chromosome 2 at 26,408,157 bp
  • A to G, chromosome 2 at 32,630,270 bp
  • A to T, chromosome 2 at 36,937,763 bp
  • A to C, chromosome 2 at 37,355,696 bp
  • A to G, chromosome 2 at 132,534,753 bp
  • A to G, chromosome 3 at 29,993,658 bp
  • C to A, chromosome 3 at 83,069,068 bp
  • T to A, chromosome 3 at 84,593,935 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • C to T, chromosome 4 at 62,149,426 bp
  • T to C, chromosome 4 at 75,981,940 bp
  • T to C, chromosome 4 at 96,217,419 bp
  • T to C, chromosome 4 at 118,541,904 bp
  • T to A, chromosome 4 at 135,779,400 bp
  • A to G, chromosome 4 at 138,315,702 bp
  • C to T, chromosome 5 at 3,595,259 bp
  • T to A, chromosome 5 at 3,961,809 bp
  • T to A, chromosome 5 at 64,955,420 bp
  • C to A, chromosome 5 at 76,877,549 bp
  • T to A, chromosome 5 at 103,968,767 bp
  • A to G, chromosome 6 at 112,775,566 bp
  • A to G, chromosome 6 at 125,338,838 bp
  • T to A, chromosome 7 at 16,838,282 bp
  • G to A, chromosome 7 at 34,208,236 bp
  • T to C, chromosome 7 at 35,021,684 bp
  • T to A, chromosome 7 at 45,352,207 bp
  • A to T, chromosome 7 at 84,946,297 bp
  • A to G, chromosome 7 at 112,054,920 bp
  • A to C, chromosome 7 at 120,433,385 bp
  • CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT, chromosome 7 at 123,162,446 bp
  • A to G, chromosome 7 at 128,752,851 bp
  • A to G, chromosome 7 at 130,623,745 bp
  • T to C, chromosome 7 at 135,678,317 bp
  • A to T, chromosome 8 at 23,179,470 bp
  • T to C, chromosome 8 at 94,780,420 bp
  • G to A, chromosome 9 at 5,303,663 bp
  • T to C, chromosome 9 at 51,117,189 bp
  • T to C, chromosome 9 at 60,587,777 bp
  • G to A, chromosome 9 at 69,415,575 bp
  • A to G, chromosome 9 at 76,246,345 bp
  • G to T, chromosome 9 at 79,678,281 bp
  • T to A, chromosome 9 at 87,055,814 bp
  • T to C, chromosome 10 at 18,597,356 bp
  • A to G, chromosome 10 at 19,004,934 bp
  • A to T, chromosome 10 at 30,698,126 bp
  • T to A, chromosome 10 at 32,890,439 bp
  • A to T, chromosome 10 at 53,919,172 bp
  • T to C, chromosome 10 at 61,200,372 bp
  • T to A, chromosome 10 at 75,936,332 bp
  • G to A, chromosome 10 at 76,318,091 bp
  • G to T, chromosome 10 at 76,581,569 bp
  • T to G, chromosome 10 at 80,530,078 bp
  • A to G, chromosome 10 at 94,866,941 bp
  • A to G, chromosome 11 at 50,304,359 bp
  • T to G, chromosome 11 at 53,284,156 bp
  • A to T, chromosome 11 at 69,031,564 bp
  • A to T, chromosome 11 at 77,015,164 bp
  • T to G, chromosome 12 at 88,084,040 bp
  • G to A, chromosome 12 at 108,827,711 bp
  • A to G, chromosome 13 at 118,789,159 bp
  • T to C, chromosome 14 at 31,173,637 bp
  • A to G, chromosome 14 at 50,140,172 bp
  • A to G, chromosome 14 at 66,158,392 bp
  • T to C, chromosome 15 at 12,257,630 bp
  • T to G, chromosome 15 at 58,106,868 bp
  • G to A, chromosome 16 at 14,269,103 bp
  • A to G, chromosome 16 at 18,872,474 bp
  • A to T, chromosome 16 at 62,903,518 bp
  • T to A, chromosome 17 at 21,286,638 bp
  • G to A, chromosome 17 at 25,742,934 bp
  • T to C, chromosome 17 at 56,576,909 bp
  • T to C, chromosome 18 at 37,974,609 bp
  • A to T, chromosome 19 at 3,471,971 bp
  • T to C, chromosome 19 at 10,900,225 bp
  • T to C, chromosome 19 at 38,780,623 bp
  • T to C, chromosome 19 at 61,083,225 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1876 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039898-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.