Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1882Btlr/Mmmh
Stock Number:
039903-MU
Citation ID:
RRID:MMRRC_039903-MU
Other Names:
R1882 (G1), C57BL/6J-MtgxR1882Btlr
Major Collection:

Strain Information

Btrc
Name: beta-transducin repeat containing protein
Synonyms: SCF b-TRCP, beta-TrCP, Slimb, Beta-Trcp1, Fbw1a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12234
VEGA: 19
HGNC: HGNC:1144
Homologene: 39330
Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Lrig3
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9030421L11Rik, 9130004I02Rik, 9430095K15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: 5033407O22Rik, 4833414K03Rik, Ltpr7, CHAK1, CHAK, TRP-PLIK, 2310022G15Rik, LTRPC7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Tpx2
Name: TPX2, microtubule-associated
Synonyms: REPP86, DIL2, p100, 2610005B21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72119
HGNC: HGNC:1249
Homologene: 8107
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 72,274,977 bp
  • T to A, chromosome 2 at 85,689,606 bp
  • A to C, chromosome 2 at 126,812,777 bp
  • A to G, chromosome 2 at 152,869,691 bp
  • A to G, chromosome 3 at 30,616,813 bp
  • G to A, chromosome 3 at 94,519,109 bp
  • A to G, chromosome 3 at 104,868,047 bp
  • T to C, chromosome 3 at 106,128,474 bp
  • A to T, chromosome 4 at 24,743,916 bp
  • A to G, chromosome 4 at 41,009,240 bp
  • A to G, chromosome 4 at 85,100,835 bp
  • A to T, chromosome 4 at 141,784,766 bp
  • A to T, chromosome 4 at 144,376,915 bp
  • A to T, chromosome 4 at 151,050,909 bp
  • A to G, chromosome 4 at 155,656,062 bp
  • T to C, chromosome 5 at 24,368,820 bp
  • T to A, chromosome 5 at 37,531,687 bp
  • T to C, chromosome 5 at 65,423,596 bp
  • A to G, chromosome 6 at 58,265,978 bp
  • G to A, chromosome 6 at 113,492,205 bp
  • C to A, chromosome 6 at 141,993,637 bp
  • T to C, chromosome 7 at 10,382,677 bp
  • T to C, chromosome 7 at 23,660,226 bp
  • A to T, chromosome 7 at 30,522,809 bp
  • G to T, chromosome 7 at 100,998,851 bp
  • T to C, chromosome 8 at 27,128,549 bp
  • T to C, chromosome 8 at 39,611,619 bp
  • T to C, chromosome 8 at 46,556,190 bp
  • G to T, chromosome 8 at 95,040,315 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • A to G, chromosome 9 at 86,565,690 bp
  • T to C, chromosome 10 at 76,222,468 bp
  • T to C, chromosome 10 at 103,395,064 bp
  • G to A, chromosome 10 at 126,009,825 bp
  • C to T, chromosome 11 at 6,217,473 bp
  • A to G, chromosome 11 at 49,340,712 bp
  • C to T, chromosome 11 at 79,501,719 bp
  • A to G, chromosome 11 at 116,000,432 bp
  • T to A, chromosome 12 at 11,456,250 bp
  • T to C, chromosome 12 at 40,445,746 bp
  • A to G, chromosome 13 at 60,935,541 bp
  • A to T, chromosome 14 at 21,734,975 bp
  • C to T, chromosome 14 at 57,697,354 bp
  • A to T, chromosome 14 at 70,978,369 bp
  • C to A, chromosome 15 at 53,075,792 bp
  • C to A, chromosome 15 at 76,624,150 bp
  • A to G, chromosome 16 at 18,249,894 bp
  • T to C, chromosome 17 at 18,244,214 bp
  • C to T, chromosome 17 at 34,147,860 bp
  • T to C, chromosome 17 at 37,850,948 bp
  • T to C, chromosome 17 at 66,379,320 bp
  • C to A, chromosome 18 at 33,879,041 bp
  • T to C, chromosome 18 at 36,021,097 bp
  • T to C, chromosome 18 at 38,202,842 bp
  • A to G, chromosome 18 at 71,262,959 bp
  • A to G, chromosome 19 at 10,638,156 bp
  • T to C, chromosome 19 at 11,855,471 bp
  • T to C, chromosome 19 at 43,798,506 bp
  • G to A, chromosome 19 at 45,527,400 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1882 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039903-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.