Strain Name:
Stock Number:
Citation ID:
Other Names:
R1882 (G1), C57BL/6J-MtgxR1882Btlr
Major Collection:

Strain Information

Name: beta-transducin repeat containing protein
Synonyms: beta-TrCP, Fbw1a, Beta-Trcp1, SCF b-TRCP, Slimb
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12234
VEGA: 19
Homologene: 39330
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
Homologene: 30957
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9430095K15Rik, 9030421L11Rik, 9130004I02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
Homologene: 49895
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: Ltpr7, 2310022G15Rik, LTRPC7, 5033407O22Rik, TRP-PLIK, CHAK, CHAK1, 4833414K03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Name: TPX2, microtubule-associated
Synonyms: 2610005B21Rik, REPP86, p100, DIL2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72119
Homologene: 8107
Name: nuclear transcription factor, X-box binding 1
Synonyms: 1300017N15Rik, TEG-42, 3000003M19Rik, Tex42
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74164
Homologene: 1875
Name: myoneurin
Synonyms: 2810011C24Rik, SBBIZ1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80732
Homologene: 10253
Name: macrophage scavenger receptor 1
Synonyms: SR-AII, MRS-A, Scara1, Scvr, SR-AI, MSR-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20288
Homologene: 12822
Name: suppression of tumorigenicity 7-like
Synonyms: St7r
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229681
Homologene: 14910
Name: phosphoglucomutase 3
Synonyms: 2810473H05Rik, GlcNAc-P mutase, Pgm-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109785
Homologene: 9205
Name: mindbomb E3 ubiquitin protein ligase 2
Synonyms: 2210008I11Rik, Zzank1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76580
Homologene: 16062
Name: protein arginine N-methyltransferase 2
Synonyms: Hrmt1l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15468
Homologene: 55587
Name: DCC netrin 1 receptor
Synonyms: C030036D22Rik, deleted in colorectal carcinoma, Igdcc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13176
Homologene: 21081
Name: zinc finger protein 277
Synonyms: NIRF4, 2410017E24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 246196
VEGA: 12
Homologene: 11087
Name: BRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms: BRFU, TFIIIB50, 2700059M06Rik, 5730512K07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66653
Homologene: 10127
Name: Rho GTPase activating protein 33
Synonyms: Snx26, Tcgap, NOMA-GAP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233071
Homologene: 76448
Name: cysteine-rich with EGF-like domains 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171508
Homologene: 32265
Name: vesicle-associated membrane protein 3
Synonyms: D130027G05Rik, VAMP-3, ceb, cellubrevin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22319
Homologene: 3511
Name: DnaJ heat shock protein family (Hsp40) member C16
Synonyms: 4732437J24Rik, 2900037O03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214063
Homologene: 45414
Name: serine/threonine kinase 32B
Synonyms: Stk32, YANK2, STKG6, 2510009F08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64293
Homologene: 48654
Name: sorting nexin family member 27
Synonyms: 5730552M22Rik, ESTM47
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76742
Homologene: 12797
Name: glial cell line derived neurotrophic factor family receptor alpha 2
Synonyms: GFR alpha 2, GFR alpha-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14586
VEGA: 14
Homologene: 1145
Name: TRM2 tRNA methyltransferase 2A
Synonyms: Htf9c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15547
Homologene: 7374
Name: nitric oxide synthase 3, endothelial cell
Synonyms: 2310065A03Rik, ecNOS, Nos-3, eNOS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18127
Homologene: 504
Name: vomeronasal 1 receptor 28
Synonyms: V1rc25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171198
Homologene: 138094
Name: chitinase, acidic 1
Synonyms: Chia, 2200003E03Rik, YNL, AMCase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 81600
Homologene: 75168
Name: solute carrier organic anion transporter family, member 1a8
Synonyms: Gm6614
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 625716
Homologene: 87075
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192897
Homologene: 179
Name: von Willebrand factor C and EGF domains
Synonyms: 1300015B04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71768
VEGA: 19
Homologene: 17651
Name: kelch-like 32
Synonyms: LOC384000, D4Ertd389e, 6430524H05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212390
Homologene: 14173
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Name: adhesion G protein-coupled receptor G3
Synonyms: Pb99, A030001G24Rik, Gpr97
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54672
Homologene: 18129
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Name: NLR family, pyrin domain containing 4D
Synonyms: Nalp-beta, Nalp4d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384752
Name: oligodendrocyte myelin glycoprotein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18377
Homologene: 36099
Name: NPC1 like intracellular cholesterol transporter 1
Synonyms: 9130221N23Rik, Niemann-Pick disease, type C1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237636
Homologene: 56585
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Name: olfactory receptor family 2 subfamily Y member 17
Synonyms: GA_x6K02T2QP88-6094111-6093176, MOR256-2, Olfr1390
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259068
Name: neuregulin 2
Synonyms: NTAK, Don1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100042150
Homologene: 75024
Name: RAD51 associated protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209550
VEGA: 12
Homologene: 85245
Name: ATP-binding cassette, sub-family member 2
Synonyms: Mrp2, multidrug resistance protein 2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
Homologene: 68052
Name: PRAME like 15
Synonyms: Pramef20, Gm13125, EG627009
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 627009
Homologene: 133194
Name: centromere protein U
Synonyms: Mlf1ip, 1700029A22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71876
Homologene: 11629
Name: vomeronasal 1 receptor 172
Synonyms: V1rd9, V3R9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81010
Homologene: 79577
Name: olfactory receptor family 8 subfamily K member 16
Synonyms: Olfr1008, MOR187-3, GA_x6K02T2Q125-47170431-47171372
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258866
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75599
Homologene: 12613
Name: olfactory receptor family 14 subfamily J member 5
Synonyms: Olfr126, GA_x6K02T2PSCP-2307164-2308123, MOR218-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258892
Homologene: 134080
Name: purinergic receptor P2Y, G-protein coupled 2
Synonyms: P2Y2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18442
Homologene: 1927
Name: olfactory receptor family 10 subfamily V member 9
Synonyms: GA_x6K02T2RE5P-2207258-2206302, Olfr1418, MOR266-5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258227
Homologene: 79372
Name: large tumor suppressor 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50523
Homologene: 56678
Name: histocompatibility 2, class II, locus Mb2
Synonyms: H2-M beta2, H-2Mb2, H2-Mb2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15000
Homologene: 68231
Name: dual specificity phosphatase 13B
Synonyms: LOC382853, LMW-DSP6, Dusp13, TMDP, TS-DSP6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27389
Homologene: 121602
Name: vacuolar protein sorting 28
Synonyms: D730005C08Rik, 1110014J03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66914
VEGA: 15
Homologene: 69205
Name: peroxisomal trans-2-enoyl-CoA reductase
Synonyms: 2400003B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 111175
Homologene: 69255
Name: UDP-glucose dehydrogenase
Synonyms: Udpgdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22235
Homologene: 2520
Name: cytotoxic T lymphocyte-associated protein 2 alpha
Synonyms: Ctla-2a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13024
VEGA: 13
Homologene: 130627
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 72,274,977 bp
  • T to A, chromosome 2 at 85,689,606 bp
  • A to C, chromosome 2 at 126,812,777 bp
  • A to G, chromosome 2 at 152,869,691 bp
  • A to G, chromosome 3 at 30,616,813 bp
  • G to A, chromosome 3 at 94,519,109 bp
  • A to G, chromosome 3 at 104,868,047 bp
  • T to C, chromosome 3 at 106,128,474 bp
  • A to T, chromosome 4 at 24,743,916 bp
  • A to G, chromosome 4 at 41,009,240 bp
  • A to G, chromosome 4 at 85,100,835 bp
  • A to T, chromosome 4 at 141,784,766 bp
  • A to T, chromosome 4 at 144,376,915 bp
  • A to T, chromosome 4 at 151,050,909 bp
  • A to G, chromosome 4 at 155,656,062 bp
  • T to C, chromosome 5 at 24,368,820 bp
  • T to A, chromosome 5 at 37,531,687 bp
  • T to C, chromosome 5 at 65,423,596 bp
  • A to G, chromosome 6 at 58,265,978 bp
  • G to A, chromosome 6 at 113,492,205 bp
  • C to A, chromosome 6 at 141,993,637 bp
  • T to C, chromosome 7 at 10,382,677 bp
  • T to C, chromosome 7 at 23,660,226 bp
  • A to T, chromosome 7 at 30,522,809 bp
  • G to T, chromosome 7 at 100,998,851 bp
  • T to C, chromosome 8 at 27,128,549 bp
  • T to C, chromosome 8 at 39,611,619 bp
  • T to C, chromosome 8 at 46,556,190 bp
  • G to T, chromosome 8 at 95,040,315 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • A to G, chromosome 9 at 86,565,690 bp
  • T to C, chromosome 10 at 76,222,468 bp
  • T to C, chromosome 10 at 103,395,064 bp
  • G to A, chromosome 10 at 126,009,825 bp
  • C to T, chromosome 11 at 6,217,473 bp
  • A to G, chromosome 11 at 49,340,712 bp
  • C to T, chromosome 11 at 79,501,719 bp
  • A to G, chromosome 11 at 116,000,432 bp
  • T to A, chromosome 12 at 11,456,250 bp
  • T to C, chromosome 12 at 40,445,746 bp
  • A to G, chromosome 13 at 60,935,541 bp
  • A to T, chromosome 14 at 21,734,975 bp
  • C to T, chromosome 14 at 57,697,354 bp
  • A to T, chromosome 14 at 70,978,369 bp
  • C to A, chromosome 15 at 53,075,792 bp
  • C to A, chromosome 15 at 76,624,150 bp
  • A to G, chromosome 16 at 18,249,894 bp
  • T to C, chromosome 17 at 18,244,214 bp
  • C to T, chromosome 17 at 34,147,860 bp
  • T to C, chromosome 17 at 37,850,948 bp
  • T to C, chromosome 17 at 66,379,320 bp
  • C to A, chromosome 18 at 33,879,041 bp
  • T to C, chromosome 18 at 36,021,097 bp
  • T to C, chromosome 18 at 38,202,842 bp
  • A to G, chromosome 18 at 71,262,959 bp
  • A to G, chromosome 19 at 10,638,156 bp
  • T to C, chromosome 19 at 11,855,471 bp
  • T to C, chromosome 19 at 43,798,506 bp
  • G to A, chromosome 19 at 45,527,400 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1882 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039903-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.