Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1882Btlr/Mmmh
Stock Number:
039903-MU
Citation ID:
RRID:MMRRC_039903-MU
Other Names:
R1882 (G1), C57BL/6J-MtgxR1882Btlr
Major Collection:

Strain Information

Btrc
Name: beta-transducin repeat containing protein
Synonyms: SCF b-TRCP, beta-TrCP, Slimb, Beta-Trcp1, Fbw1a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12234
VEGA: 19
HGNC: HGNC:1144
Homologene: 39330
Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Lrig3
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9030421L11Rik, 9130004I02Rik, 9430095K15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: 5033407O22Rik, 4833414K03Rik, Ltpr7, CHAK1, CHAK, TRP-PLIK, 2310022G15Rik, LTRPC7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Tpx2
Name: TPX2, microtubule-associated
Synonyms: REPP86, DIL2, p100, 2610005B21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72119
HGNC: HGNC:1249
Homologene: 8107
Nfx1
Name: nuclear transcription factor, X-box binding 1
Synonyms: TEG-42, 1300017N15Rik, 3000003M19Rik, Tex42
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74164
HGNC: HGNC:7803
Homologene: 1875
Mynn
Name: myoneurin
Synonyms: SBBIZ1, 2810011C24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80732
Homologene: 10253
Msr1
Name: macrophage scavenger receptor 1
Synonyms: SR-AII, SR-AI, MSR-A, Scara1, Scvr, MRS-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20288
HGNC: HGNC:7376
Homologene: 12822
St7l
Name: suppression of tumorigenicity 7-like
Synonyms: St7r
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229681
Homologene: 14910
Pgm3
Name: phosphoglucomutase 3
Synonyms: Pgm-3, GlcNAc-P mutase, 2810473H05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109785
HGNC: HGNC:8907
Homologene: 9205
Mib2
Name: mindbomb E3 ubiquitin protein ligase 2
Synonyms: 2210008I11Rik, Zzank1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76580
Homologene: 16062
Prmt2
Name: protein arginine N-methyltransferase 2
Synonyms: Hrmt1l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15468
HGNC: HGNC:5186
Homologene: 55587
Dcc
Name: DCC netrin 1 receptor
Synonyms: C030036D22Rik, Igdcc1, deleted in colorectal carcinoma
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13176
HGNC: HGNC:2701
Homologene: 21081
Zfp277
Name: zinc finger protein 277
Synonyms: NIRF4, 2410017E24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 246196
VEGA: 12
Homologene: 11087
Brf2
Name: BRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms: BRFU, TFIIIB50, 5730512K07Rik, 2700059M06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66653
Homologene: 10127
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Tcgap, Snx26, NOMA-GAP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233071
Homologene: 76448
Creld1
Name: cysteine-rich with EGF-like domains 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171508
Homologene: 32265
Vamp3
Name: vesicle-associated membrane protein 3
Synonyms: cellubrevin, D130027G05Rik, VAMP-3, ceb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22319
Homologene: 3511
Dnajc16
Name: DnaJ heat shock protein family (Hsp40) member C16
Synonyms: 2900037O03Rik, 4732437J24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214063
Homologene: 45414
Stk32b
Name: serine/threonine kinase 32B
Synonyms: 2510009F08Rik, YANK2, STKG6, Stk32
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64293
Homologene: 48654
Snx27
Name: sorting nexin family member 27
Synonyms: ESTM47, 5730552M22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76742
Homologene: 12797
Gfra2
Name: glial cell line derived neurotrophic factor family receptor alpha 2
Synonyms: GFR alpha 2, GFR alpha-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14586
VEGA: 14
HGNC: HGNC:4244
Homologene: 1145
Trmt2a
Name: TRM2 tRNA methyltransferase 2A
Synonyms: Htf9c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15547
Homologene: 7374
Nos3
Name: nitric oxide synthase 3, endothelial cell
Synonyms: eNOS, ecNOS, Nos-3, 2310065A03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18127
HGNC: HGNC:7876
Homologene: 504
Vmn1r28
Name: vomeronasal 1 receptor 28
Synonyms: V1rc25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171198
Homologene: 138094
Chia1
Name: chitinase, acidic 1
Synonyms: AMCase, YNL, 2200003E03Rik, Chia
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 81600
Homologene: 75168
Slco1a8
Name: solute carrier organic anion transporter family, member 1a8
Synonyms: Gm6614
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 625716
Homologene: 87075
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Vwce
Name: von Willebrand factor C and EGF domains
Synonyms: 1300015B04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71768
VEGA: 19
Homologene: 17651
Klhl32
Name: kelch-like 32
Synonyms: LOC384000, D4Ertd389e, 6430524H05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212390
Homologene: 14173
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
1110012J17Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Adgrg3
Name: adhesion G protein-coupled receptor G3
Synonyms: Pb99, A030001G24Rik, Gpr97
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54672
Homologene: 18129
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Nlrp4d
Name: NLR family, pyrin domain containing 4D
Synonyms: Nalp-beta, Nalp4d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384752
Omg
Name: oligodendrocyte myelin glycoprotein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18377
HGNC: HGNC:8135
Homologene: 36099
Npc1l1
Name: NPC1 like intracellular cholesterol transporter 1
Synonyms: Niemann-Pick disease, type C1, 9130221N23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237636
HGNC: HGNC:7898
Homologene: 56585
Slc6a15
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Or2y17
Name: olfactory receptor family 2 subfamily Y member 17
Synonyms: GA_x6K02T2QP88-6094111-6093176, MOR256-2, Olfr1390
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259068
Nrg2
Name: neuregulin 2
Synonyms: NTAK, Don1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100042150
HGNC: HGNC:7998
Homologene: 75024
Rad51ap2
Name: RAD51 associated protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209550
VEGA: 12
Homologene: 85245
Abcc2
Name: ATP-binding cassette, sub-family member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Pramel15
Name: PRAME like 15
Synonyms: EG627009, Gm13125, Pramef20
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 627009
Homologene: 133194
Cenpu
Name: centromere protein U
Synonyms: 1700029A22Rik, Mlf1ip
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71876
Homologene: 11629
Vmn1r172
Name: vomeronasal 1 receptor 172
Synonyms: V3R9, V1rd9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81010
Homologene: 79577
Or8k16
Name: olfactory receptor family 8 subfamily K member 16
Synonyms: GA_x6K02T2Q125-47170431-47171372, MOR187-3, Olfr1008
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258866
Pcdh1
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75599
HGNC: HGNC:8655
Homologene: 12613
Or14j5
Name: olfactory receptor family 14 subfamily J member 5
Synonyms: MOR218-1, GA_x6K02T2PSCP-2307164-2308123, Olfr126
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258892
Homologene: 134080
P2ry2
Name: purinergic receptor P2Y, G-protein coupled 2
Synonyms: P2Y2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18442
HGNC: HGNC:8541
Homologene: 1927
Or10v9
Name: olfactory receptor family 10 subfamily V member 9
Synonyms: GA_x6K02T2RE5P-2207258-2206302, MOR266-5, Olfr1418
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258227
Homologene: 79372
H2-DMb2
Name: histocompatibility 2, class II, locus Mb2
Synonyms: H2-Mb2, H-2Mb2, H2-M beta2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15000
HGNC: HGNC:4935
Homologene: 68231
Dusp13b
Name: dual specificity phosphatase 13B
Synonyms: TMDP, LMW-DSP6, TS-DSP6, LOC382853, Dusp13
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27389
Homologene: 121602
Vps28
Name: vacuolar protein sorting 28
Synonyms: 1110014J03Rik, D730005C08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66914
VEGA: 15
Homologene: 69205
Pecr
Name: peroxisomal trans-2-enoyl-CoA reductase
Synonyms: 2400003B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 111175
Homologene: 69255
Ugdh
Name: UDP-glucose dehydrogenase
Synonyms: Udpgdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22235
Homologene: 2520
Ctla2a
Name: cytotoxic T lymphocyte-associated protein 2 alpha
Synonyms: Ctla-2a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13024
VEGA: 13
Homologene: 130627
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 72,274,977 bp
  • T to A, chromosome 2 at 85,689,606 bp
  • A to C, chromosome 2 at 126,812,777 bp
  • A to G, chromosome 2 at 152,869,691 bp
  • A to G, chromosome 3 at 30,616,813 bp
  • G to A, chromosome 3 at 94,519,109 bp
  • A to G, chromosome 3 at 104,868,047 bp
  • T to C, chromosome 3 at 106,128,474 bp
  • A to T, chromosome 4 at 24,743,916 bp
  • A to G, chromosome 4 at 41,009,240 bp
  • A to G, chromosome 4 at 85,100,835 bp
  • A to T, chromosome 4 at 141,784,766 bp
  • A to T, chromosome 4 at 144,376,915 bp
  • A to T, chromosome 4 at 151,050,909 bp
  • A to G, chromosome 4 at 155,656,062 bp
  • T to C, chromosome 5 at 24,368,820 bp
  • T to A, chromosome 5 at 37,531,687 bp
  • T to C, chromosome 5 at 65,423,596 bp
  • A to G, chromosome 6 at 58,265,978 bp
  • G to A, chromosome 6 at 113,492,205 bp
  • C to A, chromosome 6 at 141,993,637 bp
  • T to C, chromosome 7 at 10,382,677 bp
  • T to C, chromosome 7 at 23,660,226 bp
  • A to T, chromosome 7 at 30,522,809 bp
  • G to T, chromosome 7 at 100,998,851 bp
  • T to C, chromosome 8 at 27,128,549 bp
  • T to C, chromosome 8 at 39,611,619 bp
  • T to C, chromosome 8 at 46,556,190 bp
  • G to T, chromosome 8 at 95,040,315 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • A to G, chromosome 9 at 86,565,690 bp
  • T to C, chromosome 10 at 76,222,468 bp
  • T to C, chromosome 10 at 103,395,064 bp
  • G to A, chromosome 10 at 126,009,825 bp
  • C to T, chromosome 11 at 6,217,473 bp
  • A to G, chromosome 11 at 49,340,712 bp
  • C to T, chromosome 11 at 79,501,719 bp
  • A to G, chromosome 11 at 116,000,432 bp
  • T to A, chromosome 12 at 11,456,250 bp
  • T to C, chromosome 12 at 40,445,746 bp
  • A to G, chromosome 13 at 60,935,541 bp
  • A to T, chromosome 14 at 21,734,975 bp
  • C to T, chromosome 14 at 57,697,354 bp
  • A to T, chromosome 14 at 70,978,369 bp
  • C to A, chromosome 15 at 53,075,792 bp
  • C to A, chromosome 15 at 76,624,150 bp
  • A to G, chromosome 16 at 18,249,894 bp
  • T to C, chromosome 17 at 18,244,214 bp
  • C to T, chromosome 17 at 34,147,860 bp
  • T to C, chromosome 17 at 37,850,948 bp
  • T to C, chromosome 17 at 66,379,320 bp
  • C to A, chromosome 18 at 33,879,041 bp
  • T to C, chromosome 18 at 36,021,097 bp
  • T to C, chromosome 18 at 38,202,842 bp
  • A to G, chromosome 18 at 71,262,959 bp
  • A to G, chromosome 19 at 10,638,156 bp
  • T to C, chromosome 19 at 11,855,471 bp
  • T to C, chromosome 19 at 43,798,506 bp
  • G to A, chromosome 19 at 45,527,400 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1882 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039903-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.