Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1913Btlr/Mmmh
Stock Number:
039931-MU
Citation ID:
RRID:MMRRC_039931-MU
Other Names:
R1913 (G1), C57BL/6J-MtgxR1913Btlr
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Dcx
Name: doublecortin
Synonyms: lissencephaly, X-linked (doublecortin), Dbct
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13193
HGNC: HGNC:2714
Homologene: 7683
Kcns2
Name: K+ voltage-gated channel, subfamily S, 2
Synonyms: Kv9.2, E130006J24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16539
VEGA: 15
HGNC: HGNC:6301
Homologene: 22465
Agpat5
Name: 1-acylglycerol-3-phosphate O-acyltransferase 5
Synonyms: 1110013A05Rik, D8Ertd319e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52123
Homologene: 10153
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Hcn2
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 2
Synonyms: HAC1, trls
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15166
HGNC: HGNC:4846
Homologene: 31022
Agtrap
Name: angiotensin II, type I receptor-associated protein
Synonyms: Atrap, D4Wsu124e, 3300002E14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11610
Homologene: 7621
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,566,756 bp
  • T to C, chromosome 1 at 74,133,354 bp
  • A to T, chromosome 1 at 151,476,185 bp
  • C to A, chromosome 1 at 165,601,805 bp
  • G to A, chromosome 1 at 183,330,789 bp
  • A to G, chromosome 2 at 39,080,081 bp
  • A to T, chromosome 2 at 61,785,456 bp
  • G to A, chromosome 2 at 65,525,864 bp
  • A to G, chromosome 2 at 93,675,387 bp
  • T to C, chromosome 2 at 129,016,620 bp
  • T to C, chromosome 2 at 154,873,542 bp
  • T to C, chromosome 2 at 166,922,191 bp
  • G to T, chromosome 2 at 181,233,750 bp
  • T to C, chromosome 3 at 66,244,555 bp
  • T to C, chromosome 3 at 83,044,980 bp
  • C to A, chromosome 3 at 92,437,468 bp
  • A to G, chromosome 3 at 96,875,633 bp
  • C to T, chromosome 3 at 154,979,199 bp
  • A to G, chromosome 4 at 49,447,498 bp
  • A to G, chromosome 4 at 57,892,963 bp
  • G to A, chromosome 4 at 86,249,748 bp
  • A to G, chromosome 4 at 134,192,675 bp
  • G to A, chromosome 4 at 138,592,020 bp
  • T to A, chromosome 4 at 140,107,312 bp
  • T to A, chromosome 4 at 148,083,977 bp
  • T to G, chromosome 5 at 9,266,275 bp
  • T to C, chromosome 5 at 31,495,617 bp
  • T to C, chromosome 5 at 107,348,613 bp
  • A to G, chromosome 5 at 108,427,190 bp
  • T to A, chromosome 5 at 109,054,788 bp
  • G to A, chromosome 5 at 135,064,332 bp
  • G to A, chromosome 5 at 139,235,732 bp
  • C to T, chromosome 6 at 37,957,815 bp
  • T to A, chromosome 6 at 42,896,753 bp
  • G to T, chromosome 6 at 52,765,952 bp
  • G to T, chromosome 6 at 62,379,894 bp
  • C to A, chromosome 6 at 115,978,017 bp
  • T to C, chromosome 6 at 122,070,870 bp
  • A to T, chromosome 7 at 17,759,577 bp
  • A to T, chromosome 7 at 19,710,961 bp
  • A to G, chromosome 7 at 47,078,868 bp
  • G to T, chromosome 7 at 98,443,847 bp
  • T to C, chromosome 7 at 101,901,247 bp
  • A to T, chromosome 7 at 120,541,240 bp
  • T to C, chromosome 7 at 122,096,691 bp
  • T to A, chromosome 7 at 128,444,659 bp
  • T to G, chromosome 8 at 13,792,108 bp
  • T to A, chromosome 8 at 13,837,143 bp
  • T to C, chromosome 8 at 18,879,613 bp
  • T to A, chromosome 8 at 54,687,726 bp
  • T to A, chromosome 8 at 85,901,920 bp
  • T to C, chromosome 8 at 104,616,468 bp
  • T to A, chromosome 8 at 122,269,680 bp
  • A to G, chromosome 9 at 64,160,952 bp
  • T to A, chromosome 9 at 69,760,101 bp
  • T to A, chromosome 9 at 95,866,733 bp
  • T to C, chromosome 9 at 99,320,311 bp
  • T to C, chromosome 9 at 122,767,013 bp
  • C to A, chromosome 10 at 24,776,771 bp
  • C to G, chromosome 10 at 39,625,940 bp
  • A to G, chromosome 10 at 57,519,465 bp
  • A to G, chromosome 10 at 79,730,943 bp
  • G to A, chromosome 10 at 102,544,939 bp
  • T to C, chromosome 11 at 7,149,952 bp
  • C to A, chromosome 11 at 32,824,441 bp
  • A to G, chromosome 11 at 68,213,185 bp
  • A to T, chromosome 11 at 69,464,930 bp
  • T to C, chromosome 11 at 69,793,584 bp
  • A to G, chromosome 11 at 82,443,417 bp
  • G to A, chromosome 11 at 83,709,928 bp
  • T to C, chromosome 11 at 87,567,012 bp
  • C to T, chromosome 11 at 100,267,249 bp
  • T to A, chromosome 11 at 104,187,889 bp
  • C to T, chromosome 11 at 104,328,075 bp
  • T to C, chromosome 11 at 109,428,871 bp
  • A to G, chromosome 11 at 113,856,726 bp
  • A to G, chromosome 12 at 75,899,246 bp
  • C to T, chromosome 13 at 33,325,846 bp
  • A to T, chromosome 13 at 43,303,445 bp
  • T to C, chromosome 13 at 49,263,848 bp
  • T to C, chromosome 13 at 74,182,316 bp
  • C to T, chromosome 13 at 100,152,157 bp
  • A to G, chromosome 14 at 20,689,111 bp
  • T to C, chromosome 14 at 26,792,264 bp
  • A to G, chromosome 14 at 52,178,135 bp
  • A to T, chromosome 15 at 3,971,322 bp
  • G to T, chromosome 15 at 7,884,410 bp
  • T to C, chromosome 15 at 34,839,709 bp
  • A to G, chromosome 15 at 66,380,577 bp
  • G to A, chromosome 15 at 76,594,519 bp
  • C to T, chromosome 15 at 76,911,951 bp
  • T to A, chromosome 15 at 85,801,099 bp
  • T to C, chromosome 16 at 16,329,966 bp
  • T to A, chromosome 16 at 18,081,027 bp
  • T to C, chromosome 16 at 32,273,882 bp
  • T to C, chromosome 16 at 45,599,693 bp
  • A to G, chromosome 16 at 48,977,876 bp
  • T to C, chromosome 16 at 49,296,920 bp
  • C to A, chromosome 16 at 89,798,694 bp
  • T to C, chromosome 16 at 91,404,170 bp
  • T to C, chromosome 17 at 14,956,809 bp
  • A to G, chromosome 17 at 17,971,408 bp
  • T to C, chromosome 17 at 32,775,917 bp
  • A to T, chromosome 17 at 33,549,555 bp
  • G to A, chromosome 17 at 35,666,922 bp
  • T to A, chromosome 17 at 36,081,016 bp
  • C to A, chromosome 17 at 36,774,768 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAG to TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG, chromosome 17 at 46,412,514 bp
  • GAAGAA to GAAGAACAAGAA, chromosome 17 at 46,412,524 bp
  • T to A, chromosome 17 at 46,663,190 bp
  • C to T, chromosome 17 at 84,756,253 bp
  • A to T, chromosome 17 at 87,257,919 bp
  • T to C, chromosome 18 at 12,495,279 bp
  • A to T, chromosome 18 at 21,093,229 bp
  • G to A, chromosome 18 at 53,723,286 bp
  • T to A, chromosome 18 at 58,061,742 bp
  • T to A, chromosome 19 at 9,007,922 bp
  • A to G, chromosome 19 at 41,558,474 bp
  • A to T, chromosome 19 at 43,807,244 bp
  • A to G, chromosome 19 at 59,235,058 bp
  • G to C, chromosome X at 143,923,103 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1913 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039931-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.