Strain Name:
C57BL/6J-MtgxR1913Btlr/Mmmh
Stock Number:
039931-MU
Citation ID:
RRID:MMRRC_039931-MU
Other Names:
R1913 (G1), C57BL/6J-MtgxR1913Btlr
Major Collection:

Gene Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Dcx
Name: doublecortin
Synonyms: lissencephaly, X-linked (doublecortin), Dbct
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13193
HGNC: HGNC:2714
Homologene: 7683
Kcns2
Name: K+ voltage-gated channel, subfamily S, 2
Synonyms: Kv9.2, E130006J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16539
VEGA: 15
HGNC: HGNC:6301
Homologene: 22465
Agpat5
Name: 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
Synonyms: 1110013A05Rik, D8Ertd319e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 52123
Homologene: 10153
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20269
Homologene: 56005
Hcn2
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 2
Synonyms: HAC1, trls
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15166
HGNC: HGNC:4846
Homologene: 31022
Agtrap
Name: angiotensin II, type I receptor-associated protein
Synonyms: Atrap, D4Wsu124e, 3300002E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11610
Homologene: 7621
Eif2s2
Name: eukaryotic translation initiation factor 2, subunit 2 (beta)
Synonyms: EIF2B, EIF2, 2810026E11Rik, 38kDa, D2Ertd303e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67204
HGNC: HGNC:3266
Homologene: 2904
Lcor
Name: ligand dependent nuclear receptor corepressor
Synonyms: 3110023F06Rik, Mlr2, A630025C20Rik, LOC381224, Gm340
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 212391
VEGA: 19
Homologene: 18153
Mapt
Name: microtubule-associated protein tau
Synonyms: Mtapt, Tau
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17762
HGNC: HGNC:6893
Homologene: 74962
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Ptpn5
Name: protein tyrosine phosphatase, non-receptor type 5
Synonyms: Step
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19259
HGNC: HGNC:9657
Homologene: 8423
Wdr70
Name: WD repeat domain 70
Synonyms: 4833422F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 545085
VEGA: 15
Homologene: 9972
Dnm1l
Name: dynamin 1-like
Synonyms: 6330417M19Rik, Drp1, python, Dnmlp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74006
VEGA: 16
HGNC: HGNC:2973
Homologene: 6384
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Cse1l
Name: chromosome segregation 1-like (S. cerevisiae)
Synonyms: Cas, Capts, 2610100P18Rik, Xpo2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110750
HGNC: HGNC:2431
Homologene: 1006
Rnf2
Name: ring finger protein 2
Synonyms: Ring1B, dinG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19821
Homologene: 2199
Psmd14
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Synonyms: 2610312C03Rik, 3200001M20Rik, POH1, Pad1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 59029
Homologene: 4240
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, D430004I05Rik, A130082H20Rik, TIF1alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21848
Homologene: 20830
Phkb
Name: phosphorylase kinase beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102093
HGNC: HGNC:8927
Homologene: 247
Zwilch
Name: zwilch kinetochore protein
Synonyms: 2310031L18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68014
Homologene: 32381
Supt16
Name: SPT16, facilitates chromatin remodeling subunit
Synonyms: Cdc68, Fact140, Spt16, Supt16h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 114741
VEGA: 14
Homologene: 5207
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 21844
Homologene: 2443
Lrpprc
Name: leucine-rich PPR-motif containing
Synonyms: Lrp130, 3110001K13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72416
Homologene: 32695
Gfod1
Name: glucose-fructose oxidoreductase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 328232
VEGA: 13
Homologene: 49581
Zfp318
Name: zinc finger protein 318
Synonyms: TZF, 2610034E08Rik, D530032D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57908
Homologene: 22808
Alx4
Name: aristaless-like homeobox 4
Synonyms: Aristaless-like 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11695
HGNC: HGNC:450
Homologene: 7229
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Tomt
Name: transmembrane O-methyltransferase
Synonyms: Comt2, F930017I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 791260
Homologene: 19664
Ntn1
Name: netrin 1
Synonyms: Netrin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18208
HGNC: HGNC:8029
Homologene: 21008
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224170
Homologene: 8771
Zfp871
Name: zinc finger protein 871
Synonyms: 9030612M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 208292
Homologene: 138401
Enpp3
Name: ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms: CD203c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 209558
VEGA: 10
HGNC: HGNC:3358
Homologene: 3683
Cep120
Name: centrosomal protein 120
Synonyms: Ccdc100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225523
VEGA: 18
Homologene: 27415
Ifnar2
Name: interferon (alpha and beta) receptor 2
Synonyms: Ifnar-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 15976
HGNC: HGNC:5433
Homologene: 49242
Cul7
Name: cullin 7
Synonyms: p193, 2510004L20Rik, p185, C230011P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 66515
Homologene: 56683
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Gpr89
Name: G protein-coupled receptor 89
Synonyms: SH120, 4933412D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67549
Homologene: 9475
Mpzl1
Name: myelin protein zero-like 1
Synonyms: 1110007A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68481
HGNC: HGNC:7226
Homologene: 2939
Tax1bp1
Name: Tax1 (human T cell leukemia virus type I) binding protein 1
Synonyms: D6Ertd404e, 1200003J11Rik, TXBP151, T6BP, D6Ertd772e, 1700069J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52440
Homologene: 4395
Tomm40
Name: translocase of outer mitochondrial membrane 40
Synonyms: Tom40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53333
Homologene: 101105
Serinc1
Name: serine incorporator 1
Synonyms: TMS-2, 1500011D18Rik, Tde1l, Tde2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56442
Homologene: 41334
Abca16
Name: ATP-binding cassette, sub-family A (ABC1), member 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233810
Homologene: 132942
Akap2
Name: A kinase (PRKA) anchor protein 2
Synonyms: B230340M18Rik, AKAP-KL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Phf10
Name: PHD finger protein 10
Synonyms: 1810055P05Rik, Baf45a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72057
Homologene: 10112
Esyt3
Name: extended synaptotagmin-like protein 3
Synonyms: D9Ertd280e, Fam62c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 272636
Homologene: 18626
Fgd3
Name: FYVE, RhoGEF and PH domain containing 3
Synonyms: ZFYVE5, 5830461L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 30938
Homologene: 22925
Ppara
Name: peroxisome proliferator activated receptor alpha
Synonyms: Nr1c1, PPAR-alpha, PPARalpha, Ppar, 4933429D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19013
HGNC: HGNC:9232
Homologene: 21047
Mep1b
Name: meprin 1 beta
Synonyms: Mep-1b, meprin beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17288
VEGA: 18
HGNC: HGNC:7020
Homologene: 48382
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Slc9c1
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208169
Homologene: 19505
Gpn1
Name: GPN-loop GTPase 1
Synonyms: 2410004J02Rik, Xab1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74254
Homologene: 5257
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237979
Homologene: 10406
Zfp469
Name: zinc finger protein 469
Synonyms: LOC195209, Gm22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 195209
Homologene: 18937
Sec24c
Name: Sec24 related gene family, member C (S. cerevisiae)
Synonyms: 2610204K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218811
VEGA: 14
Homologene: 3615
Wdr17
Name: WD repeat domain 17
Synonyms: 3010002I12Rik, B230207L18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244484
Homologene: 12460
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip-rs6, Naip2, Birc1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 229003
Homologene: 14118
Cdh16
Name: cadherin 16
Synonyms: KSP-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12556
HGNC: HGNC:1755
Homologene: 2997
Ccser1
Name: coiled-coil serine rich 1
Synonyms: 6230405M12Rik, C130092O11Rik, Fam190a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232035
Homologene: 28086
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Gucy2d
Name: guanylate cyclase 2d
Synonyms: guanylyl cyclase D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14918
Homologene: 71540
Tmem132e
Name: transmembrane protein 132E
Synonyms: LOC270893
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 270893
Homologene: 41524
Exoc3
Name: exocyst complex component 3
Synonyms: E430013E20Rik, Sec6l1, 2810050O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 211446
VEGA: 13
Homologene: 38296
Gm11492
Name: predicted gene 11492
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Ahnak
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: DY6, 1110004P15Rik, 2310047C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231014
Homologene: 27396
Vars2
Name: valyl-tRNA synthetase 2, mitochondrial
Synonyms: 1190004I24Rik, Vars2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68915
Homologene: 57502
Topaz1
Name: testis and ovary specific PAZ domain containing 1
Synonyms: Gm9524
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 671232
VEGA: 9
Homologene: 19835
Sppl2c
Name: signal peptide peptidase 2C
Synonyms: 4933407P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237958
Homologene: 18491
Lrrc6
Name: leucine rich repeat containing 6 (testis)
Synonyms: LRTP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 54562
Homologene: 34534
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 435626
Homologene: 52359
Serpinb9f
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9f
Synonyms: NK21, ovalbumin, Spi13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20709
HGNC: HGNC:8955
Homologene: 69093
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75718
Homologene: 19431
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17837
Homologene: 136663
Adamts10
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10
Synonyms: ZnMP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224697
Homologene: 81940
Sun1
Name: Sad1 and UNC84 domain containing 1
Synonyms: 4632417G13Rik, 5730434D03Rik, Unc84a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77053
Homologene: 11544
Krt42
Name: keratin 42
Synonyms: Ka22, K17n, ecat6, 2410039E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68239
Homologene: 107091
Prodh
Name: proline dehydrogenase
Synonyms: Pro1, Pro-1, Ym24d07
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19125
HGNC: HGNC:9453
Homologene: 40764
Abcc2
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Tnni3k
Name: TNNI3 interacting kinase
Synonyms: Cark, D830019J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 435766
Homologene: 41084
Smco1
Name: single-pass membrane protein with coiled-coil domains 1
Synonyms: 2310010M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 69576
Homologene: 18842
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384219
Homologene: 129606
Scai
Name: suppressor of cancer cell invasion
Synonyms: A930041I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320271
Homologene: 15523
Upf3a
Name: UPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms: 4930546M19Rik, RENT3A, UPF3, 2600001C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67031
Homologene: 23395
Veph1
Name: ventricular zone expressed PH domain-containing 1
Synonyms: Veph, 2810471M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72789
Homologene: 11624
Traf3ip2
Name: TRAF3 interacting protein 2
Synonyms: Act1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103213
HGNC: HGNC:1343
Homologene: 15885
Zc3h6
Name: zinc finger CCCH type containing 6
Synonyms: 4631426G04Rik, 4833425H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78751
Homologene: 35328
Chrnb1
Name: cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
Synonyms: Achr-2, Acrb, AChR beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11443
HGNC: HGNC:1961
Homologene: 594
Rassf9
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 9
Synonyms: Pamci
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237504
Homologene: 3976
H2-Bl
Name: histocompatibility 2, blastocyst
Synonyms: blastocyst MHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14963
HGNC: HGNC:4931
Homologene: 128352
Zfp647
Name: zinc finger protein 647
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239546
VEGA: 15
Homologene: 27805
Ceacam5
Name: carcinoembryonic antigen-related cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73250
Homologene: 115938
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: r, Pdeb, rd, rd10, rd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Acnat1
Name: acyl-coenzyme A amino acid N-acyltransferase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230161
Homologene: 28287
Zpld2
Name: zona pellucida like domain containing 2
Synonyms: Gm7534
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 665186
Homologene: 104039
Amz2
Name: archaelysin family metallopeptidase 2
Synonyms: ESTM12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100503496
H2-M10.5
Name: histocompatibility 2, M region locus 10.5
Synonyms: 6.9H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224761
Homologene: 117973
Igsf21
Name: immunoglobulin superfamily, member 21
Synonyms: LOC230868
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230868
Homologene: 13153
Foxb1
Name: forkhead box B1
Synonyms: Hfh-e5.1, C43, TWH, Fkh5, Mf3, Foxb1b, Foxb1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 64290
VEGA: 9
HGNC: HGNC:3799
Homologene: 8138
Brdt
Name: bromodomain, testis-specific
Synonyms: 7420412D09Rik, Brd6, Fsrg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 114642
HGNC: HGNC:1105
Homologene: 21064
AF366264
Name: cDNA sequence AF366264
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 231201
Homologene: 130042
Ndufab1
Name: NADH:ubiquinone oxidoreductase subunit AB1
Synonyms: 2210401F17Rik, 2310039H15Rik, 9130423F15Rik, 8kDa, 2610003B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70316
HGNC: HGNC:7694
Homologene: 80336
Tial1
Name: Tia1 cytotoxic granule-associated RNA binding protein-like 1
Synonyms: mTIAR, 5330433G13Rik, TIAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21843
Homologene: 87796
Adck5
Name: aarF domain containing kinase 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268822
Homologene: 34378
CAAA01083517.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Olfr448
Name: olfactory receptor 448
Synonyms: GA_x6K02T2P3E9-4663051-4662119, MOR261-13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258270
HGNC: HGNC:8232
Homologene: 64846
Sprr1b
Name: small proline-rich protein 1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20754
Homologene: 134537
Fpr3
Name: formyl peptide receptor 3
Synonyms: Lxa4r, LXA4-R, Fprl1, Fpr-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14294
HGNC: HGNC:3828
Kcnk18
Name: potassium channel, subfamily K, member 18
Synonyms: LOC332396, Tresk-2, Tresk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 332396
VEGA: 19
Homologene: 133808
Fbxo4
Name: F-box protein 4
Synonyms: 1700096C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 106052
Homologene: 8134
Dnajc30
Name: DnaJ heat shock protein family (Hsp40) member C30
Synonyms: 1300007M11Rik, Wbscr18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 66114
Homologene: 36428
Smim23
Name: small integral membrane protein 23
Synonyms: 1700008A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69351
Homologene: 85224
Wfdc18
Name: WAP four-disulfide core domain 18
Synonyms: WDNM1, Kal1, Expi
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14038
Gm5407
Name: predicted gene 5407
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 386061
VEGA: 16
Mcfd2
Name: multiple coagulation factor deficiency 2
Synonyms: 1810021C21Rik, LMAN1IP, F5F8D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 193813
Homologene: 44552
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,566,756 bp
  • T to C, chromosome 1 at 74,133,354 bp
  • A to T, chromosome 1 at 151,476,185 bp
  • C to A, chromosome 1 at 165,601,805 bp
  • G to A, chromosome 1 at 183,330,789 bp
  • A to G, chromosome 2 at 39,080,081 bp
  • A to T, chromosome 2 at 61,785,456 bp
  • G to A, chromosome 2 at 65,525,864 bp
  • A to G, chromosome 2 at 93,675,387 bp
  • T to C, chromosome 2 at 129,016,620 bp
  • T to C, chromosome 2 at 154,873,542 bp
  • T to C, chromosome 2 at 166,922,191 bp
  • G to T, chromosome 2 at 181,233,750 bp
  • T to C, chromosome 3 at 66,244,555 bp
  • T to C, chromosome 3 at 83,044,980 bp
  • C to A, chromosome 3 at 92,437,468 bp
  • A to G, chromosome 3 at 96,875,633 bp
  • C to T, chromosome 3 at 154,979,199 bp
  • A to G, chromosome 4 at 49,447,498 bp
  • A to G, chromosome 4 at 57,892,963 bp
  • G to A, chromosome 4 at 86,249,748 bp
  • A to G, chromosome 4 at 134,192,675 bp
  • G to A, chromosome 4 at 138,592,020 bp
  • T to A, chromosome 4 at 140,107,312 bp
  • T to A, chromosome 4 at 148,083,977 bp
  • T to G, chromosome 5 at 9,266,275 bp
  • T to C, chromosome 5 at 31,495,617 bp
  • T to C, chromosome 5 at 107,348,613 bp
  • A to G, chromosome 5 at 108,427,190 bp
  • T to A, chromosome 5 at 109,054,788 bp
  • G to A, chromosome 5 at 135,064,332 bp
  • G to A, chromosome 5 at 139,235,732 bp
  • C to T, chromosome 6 at 37,957,815 bp
  • T to A, chromosome 6 at 42,896,753 bp
  • G to T, chromosome 6 at 52,765,952 bp
  • G to T, chromosome 6 at 62,379,894 bp
  • C to A, chromosome 6 at 115,978,017 bp
  • T to C, chromosome 6 at 122,070,870 bp
  • A to T, chromosome 7 at 17,759,577 bp
  • A to T, chromosome 7 at 19,710,961 bp
  • A to G, chromosome 7 at 47,078,868 bp
  • G to T, chromosome 7 at 98,443,847 bp
  • T to C, chromosome 7 at 101,901,247 bp
  • A to T, chromosome 7 at 120,541,240 bp
  • T to C, chromosome 7 at 122,096,691 bp
  • T to A, chromosome 7 at 128,444,659 bp
  • T to G, chromosome 8 at 13,792,108 bp
  • T to A, chromosome 8 at 13,837,143 bp
  • T to C, chromosome 8 at 18,879,613 bp
  • T to A, chromosome 8 at 54,687,726 bp
  • T to A, chromosome 8 at 85,901,920 bp
  • T to C, chromosome 8 at 104,616,468 bp
  • T to A, chromosome 8 at 122,269,680 bp
  • A to G, chromosome 9 at 64,160,952 bp
  • T to A, chromosome 9 at 69,760,101 bp
  • T to A, chromosome 9 at 95,866,733 bp
  • T to C, chromosome 9 at 99,320,311 bp
  • T to C, chromosome 9 at 122,767,013 bp
  • C to A, chromosome 10 at 24,776,771 bp
  • C to G, chromosome 10 at 39,625,940 bp
  • A to G, chromosome 10 at 57,519,465 bp
  • A to G, chromosome 10 at 79,730,943 bp
  • G to A, chromosome 10 at 102,544,939 bp
  • T to C, chromosome 11 at 7,149,952 bp
  • C to A, chromosome 11 at 32,824,441 bp
  • A to G, chromosome 11 at 68,213,185 bp
  • A to T, chromosome 11 at 69,464,930 bp
  • T to C, chromosome 11 at 69,793,584 bp
  • A to G, chromosome 11 at 82,443,417 bp
  • G to A, chromosome 11 at 83,709,928 bp
  • T to C, chromosome 11 at 87,567,012 bp
  • C to T, chromosome 11 at 100,267,249 bp
  • T to A, chromosome 11 at 104,187,889 bp
  • C to T, chromosome 11 at 104,328,075 bp
  • T to C, chromosome 11 at 109,428,871 bp
  • A to G, chromosome 11 at 113,856,726 bp
  • A to G, chromosome 12 at 75,899,246 bp
  • C to T, chromosome 13 at 33,325,846 bp
  • A to T, chromosome 13 at 43,303,445 bp
  • T to C, chromosome 13 at 49,263,848 bp
  • T to C, chromosome 13 at 74,182,316 bp
  • C to T, chromosome 13 at 100,152,157 bp
  • A to G, chromosome 14 at 20,689,111 bp
  • T to C, chromosome 14 at 26,792,264 bp
  • A to G, chromosome 14 at 52,178,135 bp
  • A to T, chromosome 15 at 3,971,322 bp
  • G to T, chromosome 15 at 7,884,410 bp
  • T to C, chromosome 15 at 34,839,709 bp
  • A to G, chromosome 15 at 66,380,577 bp
  • G to A, chromosome 15 at 76,594,519 bp
  • C to T, chromosome 15 at 76,911,951 bp
  • T to A, chromosome 15 at 85,801,099 bp
  • T to C, chromosome 16 at 16,329,966 bp
  • T to A, chromosome 16 at 18,081,027 bp
  • T to C, chromosome 16 at 32,273,882 bp
  • T to C, chromosome 16 at 45,599,693 bp
  • A to G, chromosome 16 at 48,977,876 bp
  • T to C, chromosome 16 at 49,296,920 bp
  • C to A, chromosome 16 at 89,798,694 bp
  • T to C, chromosome 16 at 91,404,170 bp
  • T to C, chromosome 17 at 14,956,809 bp
  • A to G, chromosome 17 at 17,971,408 bp
  • T to C, chromosome 17 at 32,775,917 bp
  • A to T, chromosome 17 at 33,549,555 bp
  • G to A, chromosome 17 at 35,666,922 bp
  • T to A, chromosome 17 at 36,081,016 bp
  • C to A, chromosome 17 at 36,774,768 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAG to TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG, chromosome 17 at 46,412,514 bp
  • GAAGAA to GAAGAACAAGAA, chromosome 17 at 46,412,524 bp
  • T to A, chromosome 17 at 46,663,190 bp
  • C to T, chromosome 17 at 84,756,253 bp
  • A to T, chromosome 17 at 87,257,919 bp
  • T to C, chromosome 18 at 12,495,279 bp
  • A to T, chromosome 18 at 21,093,229 bp
  • G to A, chromosome 18 at 53,723,286 bp
  • T to A, chromosome 18 at 58,061,742 bp
  • T to A, chromosome 19 at 9,007,922 bp
  • A to G, chromosome 19 at 41,558,474 bp
  • A to T, chromosome 19 at 43,807,244 bp
  • A to G, chromosome 19 at 59,235,058 bp
  • G to C, chromosome X at 143,923,103 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1913 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039931-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.