Strain Name:
C57BL/6J-MtgxR1940Btlr/Mmmh
Stock Number:
039958-MU
Citation ID:
RRID:MMRRC_039958-MU
Other Names:
R1940 (G1), C57BL/6J-MtgxR1940Btlr
Major Collection:

Gene Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: urehr3, D630042G03Rik, Nkcc2, mBSC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20495
Homologene: 286
Acvr1c
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 269275
Homologene: 26724
Lhx3
Name: LIM homeobox protein 3
Synonyms: P-LIM, mLim-3, Lim3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16871
HGNC: HGNC:6595
Homologene: 7814
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 20562
Homologene: 2302
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 70097
Homologene: 69182
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: C630029C19Rik, nur14, NaCh6, med, seal, motor end-plate disease, nmf2, mnd-2, mnd2, NMF335, ataxia 3, nmf335, Nav1.6, nmf58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 20273
Homologene: 7927
Msra
Name: methionine sulfoxide reductase A
Synonyms: 6530413P12Rik, 2310045J23Rik, MSR-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 110265
HGNC: HGNC:7377
Homologene: 5812
Nbea
Name: neurobeachin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Nfyc
Name: nuclear transcription factor-Y gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18046
HGNC: HGNC:7806
Homologene: 7440
Ythdf3
Name: YTH N6-methyladenosine RNA binding protein 3
Synonyms: 9130022A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229096
Homologene: 34991
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: A930019J01Rik, D11Ertd166e, Clast4, 2610509L04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 74203
Homologene: 10522
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, 1200003H23Rik, EHB3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 71713
VEGA: 10
Homologene: 5716
Trit1
Name: tRNA isopentenyltransferase 1
Synonyms: MOD5, 2310075G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 66966
Homologene: 7010
Rab28
Name: RAB28, member RAS oncogene family
Synonyms: 2700023P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100972
HGNC: HGNC:9768
Homologene: 3135
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: Ayu17-449, E130014J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 214133
Homologene: 49498
Zbtb17
Name: zinc finger and BTB domain containing 17
Synonyms: Zfp100, mZ13, Miz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 22642
Homologene: 2575
Secisbp2l
Name: SECIS binding protein 2-like
Synonyms: 3110001I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 70354
Homologene: 18923
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 66887
Homologene: 12050
Gtf3c3
Name: general transcription factor IIIC, polypeptide 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98488
HGNC: HGNC:4666
Homologene: 40805
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: mBLVR1, Bolvr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Ccdc60
Name: coiled-coil domain containing 60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 269693
Homologene: 18624
Rrp1b
Name: ribosomal RNA processing 1 homolog B (S. cerevisiae)
Synonyms: 2600005C20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 72462
Homologene: 57086
Ddx18
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms: 2310005B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 66942
HGNC: HGNC:2741
Homologene: 6697
Wipf2
Name: WAS/WASL interacting protein family, member 2
Synonyms: 5730509C05Rik, 1110014J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 68524
Homologene: 15777
Mgat4a
Name: mannoside acetylglucosaminyltransferase 4, isoenzyme A
Synonyms: 9530018I07Rik, GnT-IVa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269181
HGNC: HGNC:7047
Homologene: 8153
Sphk1
Name: sphingosine kinase 1
Synonyms: 1110006G24Rik, SK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 20698
Homologene: 39748
Lss
Name: lanosterol synthase
Synonyms: Osc, 2810025N20Rik, D10Ertd116e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 16987
HGNC: HGNC:6708
Homologene: 37408
Fam171b
Name: family with sequence similarity 171, member B
Synonyms: D430039N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241520
Homologene: 18462
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Tra2a
Name: transformer 2 alpha
Synonyms: 1500010G04Rik, G430041M01Rik, mAWMS1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 101214
Homologene: 40866
Ace2
Name: angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Synonyms: 2010305L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 70008
Homologene: 41448
Ctsl
Name: cathepsin L
Synonyms: MEP, Cat L, 1190035F06Rik, major excreted protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 13039
VEGA: 13
HGNC: HGNC:2538
Homologene: 76699
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: 4432416O06Rik, DHC2, b2b414Clo, Dnchc2, m407Asp, m152Asp, D030010H02Rik, D330044F14Rik, DHC1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Nop2
Name: NOP2 nucleolar protein
Synonyms: Nol1, 120kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 110109
HGNC: HGNC:7867
Homologene: 135865
Slc12a4
Name: solute carrier family 12, member 4
Synonyms: KCC1, K-Cl Co-transporter-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 20498
Homologene: 21056
Mpdz
Name: multiple PDZ domain protein
Synonyms: B930003D11Rik, MUPP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 17475
HGNC: HGNC:7208
Homologene: 2841
Srsf6
Name: serine/arginine-rich splicing factor 6
Synonyms: 1210001E11Rik, Sfrs6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 67996
Homologene: 110783
Golm1
Name: golgi membrane protein 1
Synonyms: D030064E01Rik, GP73, 2310001L02Rik, Golph2, PSEC0257
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 105348
VEGA: 13
Homologene: 12346
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232339
Homologene: 45968
Ddrgk1
Name: DDRGK domain containing 1
Synonyms: 2600009E05Rik, 1110001I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 77006
Homologene: 11400
Arid3b
Name: AT rich interactive domain 3B (BRIGHT-like)
Synonyms: Bdp, Dri2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 56380
Homologene: 4721
Clmn
Name: calmin
Synonyms: 9330188N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 94040
VEGA: 12
Homologene: 11683
Klhl26
Name: kelch-like 26
Synonyms: C630013N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234378
Homologene: 41247
Tnrc6c
Name: trinucleotide repeat containing 6C
Synonyms: 9930033H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217351
Homologene: 23137
Abca16
Name: ATP-binding cassette, sub-family A (ABC1), member 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233810
Homologene: 132942
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Ip3r3, tf, Itpr-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: Cngb1, Cngb1b, BC016201
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Cfi
Name: complement component factor i
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12630
HGNC: HGNC:5394
Homologene: 171
Bcat2
Name: branched chain aminotransferase 2, mitochondrial
Synonyms: Eca40, Bcat-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 12036
HGNC: HGNC:977
Homologene: 81684
Chn1
Name: chimerin 1
Synonyms: alpha1 chimaerin, alpha2 chimaerin, 1700112L09Rik, 0710001E19Rik, 2900046J01Rik, ARHGAP2, 0610007I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 108699
HGNC: HGNC:1943
Homologene: 31056
Zscan10
Name: zinc finger and SCAN domain containing 10
Synonyms: Zfp206, Zscan10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 332221
Homologene: 13122
Ush2a
Name: usherin
Synonyms: Ush2a, Ushrn, MUSH2A, A930037M10Rik, A930011D15Rik, LOC269160, LOC381317
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22283
Homologene: 66151
Tgfbi
Name: transforming growth factor, beta induced
Synonyms: Beta-ig, bIG-h3, 68kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 21810
VEGA: 13
Homologene: 37294
Svs1
Name: seminal vesicle secretory protein 1
Synonyms: SVS I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 243377
Homologene: 18250
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: Hug, Jbts17, b2b012Clo, 2410089E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 73692
Homologene: 11315
Gm4934
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
Cdh7
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: Gprc1c, 0710001G23Rik, mGlu3, mGluR3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
3110009E18Rik
Name: RIKEN cDNA 3110009E18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 73103
Homologene: 41754
Usp50
Name: ubiquitin specific peptidase 50
Synonyms: 4930511O11Rik, 1700086G18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 75083
Homologene: 75281
Col19a1
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12823
HGNC: HGNC:2196
Homologene: 55608
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 239420
Homologene: 65982
Prg4
Name: proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms: SZP, MSF, DOL54, lubricin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 96875
HGNC: HGNC:9364
Homologene: 137352
Elmo2
Name: engulfment and cell motility 2
Synonyms: 1190002F24Rik, CED-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 140579
Homologene: 44338
Duox1
Name: dual oxidase 1
Synonyms: THOX1, 9930101G15Rik, NOXEF1, LNOX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Tra2b
Name: transformer 2 beta
Synonyms: Silg41, TRA2beta, Sfrs10, 5730405G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 20462
Homologene: 20965
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 329421
Homologene: 51393
Trnau1ap
Name: tRNA selenocysteine 1 associated protein 1
Synonyms: 1110007F05Rik, SECp43, Trspap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 71787
Homologene: 49509
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 194357
Homologene: 77226
Nrxn3
Name: neurexin III
Synonyms: neurexin III beta, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, 9330112C09Rik, 4933401A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Cyp2d10
Name: cytochrome P450, family 2, subfamily d, polypeptide 10
Synonyms: Cyp2d, P450-2D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 13101
VEGA: 15
Homologene: 86099
Gm281
Name: predicted gene 281
Synonyms: LOC238939
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 238939
Homologene: 141164
Postn
Name: periostin, osteoblast specific factor
Synonyms: Osf2, OSF-2, Periostin, A630052E07Rik, peri
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 50706
Homologene: 4730
Azin2
Name: antizyme inhibitor 2
Synonyms: 4933429I20Rik, AZIN2, Odcp, Adc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242669
Homologene: 62172
Papolg
Name: poly(A) polymerase gamma
Synonyms: 9630006B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216578
Homologene: 56959
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244668
Homologene: 18956
Slc22a27
Name: solute carrier family 22, member 27
Synonyms: mOAT6 related protein, AB056442
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 171405
Homologene: 77136
Whamm
Name: WAS protein homolog associated with actin, golgi membranes and microtubules
Synonyms: Whdc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 434204
Homologene: 45851
Nrg2
Name: neuregulin 2
Synonyms: Don1, NTAK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 100042150
HGNC: HGNC:7998
Homologene: 75024
Agbl2
Name: ATP/GTP binding protein-like 2
Synonyms: Ccp2, Ccp2, A430081C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 271813
Homologene: 11715
Ankrd34a
Name: ankyrin repeat domain 34A
Synonyms: Ankrd34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 545554
Homologene: 82882
Adam24
Name: a disintegrin and metallopeptidase domain 24 (testase 1)
Synonyms: Dtgn5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 13526
HGNC: HGNC:203
Homologene: 137232
Paqr4
Name: progestin and adipoQ receptor family member IV
Synonyms: 1500004C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 76498
VEGA: 17
Homologene: 22278
Rgl1
Name: ral guanine nucleotide dissociation stimulator,-like 1
Synonyms: Rgl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19731
Homologene: 9039
Olfr228
Name: olfactory receptor 228
Synonyms: MOR189-3, GA_x6K02T0101M-139-669
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258400
Homologene: 17233
Ivl
Name: involucrin
Synonyms: 1110019C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 16447
HGNC: HGNC:6187
Homologene: 137207
Hscb
Name: HscB iron-sulfur cluster co-chaperone
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100900
Homologene: 13945
Ptprb
Name: protein tyrosine phosphatase, receptor type, B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Gsta3
Name: glutathione S-transferase, alpha 3
Synonyms: Gst2-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14859
HGNC: HGNC:4628
Homologene: 37355
Vmn2r117
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 619788
Homologene: 86604
Olfr1423
Name: olfactory receptor 1423
Synonyms: GA_x6K02T2RE5P-2393361-2392429, MOR239-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 258675
Homologene: 128078
Cables2
Name: CDK5 and Abl enzyme substrate 2
Synonyms: ik3-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 252966
Homologene: 45440
Gm10549
Name: predicted gene 10549
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 433171
VEGA: 18
Mettl24
Name: methyltransferase like 24
Synonyms: 9030224M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 327747
Homologene: 65335
Krt31
Name: keratin 31
Synonyms: MKHA-1, Krt1-1, Kha1, Ha1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16660
HGNC: HGNC:6448
Homologene: 74433
Hk3
Name: hexokinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 212032
HGNC: HGNC:4925
Homologene: 55633
Olfr1415
Name: olfactory receptor 1415
Synonyms: MOR103-12, GA_x6K02T2R7CC-81266841-81267776
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 258228
Homologene: 79367
Arsj
Name: arylsulfatase J
Synonyms: 9330196J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 271970
Homologene: 35257
Ncf2
Name: neutrophil cytosolic factor 2
Synonyms: NADPH oxidase subunit (67kDa), Ncf-2, p67phox, NOXA2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 17970
HGNC: HGNC:7661
Homologene: 374
Zfp3
Name: zinc finger protein 3
Synonyms: Zfp-3, Fnp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 193043
Homologene: 27406
Hs3st3b1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Synonyms: 3-OST-3B, m3-OST-3B, HS3ST3B1, 3OST3B1, 3Ost3b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 54710
HGNC: HGNC:5198
Homologene: 88576
Muc13
Name: mucin 13, epithelial transmembrane
Synonyms: Ly64, 114/A10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 17063
HGNC: HGNC:7511
Homologene: 7822
Chit1
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 71884
HGNC: HGNC:1936
Homologene: 68318
Cd55b
Name: CD55 molecule, decay accelerating factor for complement B
Synonyms: Daf-TM, Daf2, complement-transmembrane, TM-DAF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13137
HGNC: HGNC:2665
Homologene: 479
Ttc34
Name: tetratricopeptide repeat domain 34
Synonyms: B230396O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242800
Homologene: 130480
Olfr1014
Name: olfactory receptor 1014
Synonyms: MOR213-5, GA_x6K02T2Q125-47255337-47256254
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258562
Homologene: 83447
Pramel6
Name: preferentially expressed antigen in melanoma like 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 347711
Homologene: 77635
Ciao1
Name: cytosolic iron-sulfur protein assembly 1
Synonyms: Wdr39
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 26371
Homologene: 55850
AU016765
Name: expressed sequence AU016765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 100043582
Hoxa10
Name: homeobox A10
Synonyms: Hox-1.8, Hoxa-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 15395
HGNC: HGNC:5100
Homologene: 7365
Ubiad1
Name: UbiA prenyltransferase domain containing 1
Synonyms: Tere1, 1200002M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 71707
Homologene: 8336
Slc25a14
Name: solute carrier family 25 (mitochondrial carrier, brain), member 14
Synonyms: UCP5, UCP5L, BMCP1, UCP5S
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 20523
Homologene: 2937
Arr3
Name: arrestin 3, retinal
Synonyms: X-arrestin, mCAR, mCARFL, CAR, arrestin 4, Arr4, cone arrestin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 170735
HGNC: HGNC:710
Homologene: 3182
Glrx
Name: glutaredoxin
Synonyms: D13Wsu156e, Grx1, TTase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 93692
HGNC: HGNC:4330
Homologene: 37566
Nrl
Name: neural retina leucine zipper gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 18185
VEGA: 14
HGNC: HGNC:8002
Homologene: 4501
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 21,257,377 bp
  • A to T, chromosome 1 at 24,264,750 bp
  • A to T, chromosome 1 at 37,536,037 bp
  • A to C, chromosome 1 at 54,428,958 bp
  • T to A, chromosome 1 at 92,491,735 bp
  • G to A, chromosome 1 at 110,049,024 bp
  • T to A, chromosome 1 at 120,188,029 bp
  • A to T, chromosome 1 at 121,555,224 bp
  • A to T, chromosome 1 at 130,418,106 bp
  • G to A, chromosome 1 at 134,145,418 bp
  • T to C, chromosome 1 at 150,456,023 bp
  • A to G, chromosome 1 at 152,531,605 bp
  • A to G, chromosome 1 at 152,834,064 bp
  • A to G, chromosome 1 at 188,951,561 bp
  • T to C, chromosome 2 at 26,203,962 bp
  • A to T, chromosome 2 at 58,283,505 bp
  • T to C, chromosome 2 at 70,258,075 bp
  • A to G, chromosome 2 at 73,624,901 bp
  • CCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGC, chromosome 2 at 83,812,874 bp
  • T to A, chromosome 2 at 85,777,171 bp
  • T to A, chromosome 2 at 86,483,359 bp
  • A to T, chromosome 2 at 87,508,732 bp
  • T to A, chromosome 2 at 90,811,282 bp
  • T to C, chromosome 2 at 122,325,984 bp
  • A to G, chromosome 2 at 125,194,193 bp
  • C to A, chromosome 2 at 125,740,339 bp
  • C to T, chromosome 2 at 126,778,023 bp
  • A to G, chromosome 2 at 127,246,460 bp
  • G to T, chromosome 2 at 130,663,560 bp
  • C to T, chromosome 2 at 162,934,483 bp
  • A to G, chromosome 2 at 165,292,050 bp
  • T to C, chromosome 2 at 180,190,921 bp
  • A to G, chromosome 2 at 180,260,080 bp
  • A to G, chromosome 3 at 16,205,092 bp
  • T to G, chromosome 3 at 54,377,150 bp
  • T to C, chromosome 3 at 55,953,100 bp
  • T to A, chromosome 3 at 92,572,749 bp
  • A to G, chromosome 3 at 96,598,676 bp
  • T to C, chromosome 3 at 126,438,346 bp
  • T to C, chromosome 3 at 129,858,828 bp
  • T to C, chromosome 3 at 133,488,638 bp
  • G to A, chromosome 4 at 81,361,443 bp
  • C to A, chromosome 4 at 120,773,664 bp
  • T to C, chromosome 4 at 123,054,240 bp
  • C to T, chromosome 4 at 128,950,784 bp
  • A to G, chromosome 4 at 132,321,803 bp
  • T to C, chromosome 4 at 141,465,548 bp
  • A to G, chromosome 4 at 148,444,011 bp
  • G to A, chromosome 4 at 154,865,682 bp
  • G to A, chromosome 5 at 9,511,682 bp
  • A to T, chromosome 5 at 41,625,790 bp
  • G to T, chromosome 5 at 110,836,060 bp
  • G to A, chromosome 5 at 116,126,165 bp
  • C to T, chromosome 6 at 40,883,532 bp
  • A to T, chromosome 6 at 48,990,073 bp
  • G to A, chromosome 6 at 49,244,740 bp
  • C to A, chromosome 6 at 52,234,370 bp
  • A to T, chromosome 6 at 118,511,693 bp
  • T to C, chromosome 6 at 125,134,634 bp
  • T to C, chromosome 7 at 45,588,368 bp
  • C to T, chromosome 7 at 81,578,299 bp
  • T to C, chromosome 7 at 120,433,609 bp
  • A to T, chromosome 8 at 40,681,361 bp
  • C to A, chromosome 8 at 70,452,261 bp
  • C to T, chromosome 8 at 86,631,634 bp
  • C to A, chromosome 8 at 95,299,692 bp
  • T to C, chromosome 8 at 105,946,037 bp
  • A to G, chromosome 8 at 125,480,148 bp
  • A to G, chromosome 9 at 7,139,159 bp
  • A to T, chromosome 9 at 57,796,148 bp
  • A to T, chromosome 10 at 8,729,932 bp
  • G to A, chromosome 10 at 40,737,726 bp
  • G to A, chromosome 10 at 40,883,071 bp
  • C to A, chromosome 10 at 76,545,462 bp
  • G to A, chromosome 10 at 80,709,773 bp
  • A to T, chromosome 10 at 116,319,610 bp
  • A to G, chromosome 11 at 3,243,279 bp
  • A to T, chromosome 11 at 23,867,279 bp
  • T to C, chromosome 11 at 63,889,743 bp
  • T to C, chromosome 11 at 70,771,376 bp
  • C to T, chromosome 11 at 98,892,410 bp
  • T to A, chromosome 11 at 100,048,243 bp
  • A to G, chromosome 11 at 116,535,850 bp
  • A to G, chromosome 11 at 117,756,023 bp
  • T to C, chromosome 12 at 89,260,381 bp
  • G to A, chromosome 12 at 104,790,102 bp
  • C to T, chromosome 13 at 55,011,391 bp
  • A to T, chromosome 13 at 56,614,314 bp
  • A to T, chromosome 13 at 59,642,237 bp
  • C to A, chromosome 13 at 59,718,021 bp
  • G to C, chromosome 13 at 64,368,018 bp
  • A to G, chromosome 13 at 75,840,137 bp
  • A to T, chromosome 14 at 13,828,582 bp
  • A to G, chromosome 14 at 55,522,435 bp
  • G to A, chromosome 14 at 64,285,056 bp
  • T to A, chromosome 15 at 8,233,852 bp
  • T to A, chromosome 15 at 47,659,210 bp
  • T to A, chromosome 15 at 82,405,294 bp
  • C to T, chromosome 15 at 100,970,204 bp
  • A to G, chromosome 16 at 22,255,045 bp
  • A to T, chromosome 16 at 33,807,911 bp
  • A to T, chromosome 17 at 23,477,480 bp
  • A to T, chromosome 17 at 23,609,852 bp
  • T to C, chromosome 17 at 23,737,664 bp
  • A to G, chromosome 17 at 27,111,217 bp
  • A to T, chromosome 17 at 30,731,207 bp
  • A to T, chromosome 17 at 32,056,845 bp
  • G to A, chromosome 17 at 64,519,878 bp
  • A to T, chromosome 18 at 33,472,411 bp
  • C to A, chromosome 18 at 36,196,844 bp
  • A to G, chromosome 19 at 7,909,727 bp
  • A to C, chromosome 19 at 12,035,911 bp
  • T to A, chromosome 19 at 41,630,776 bp
  • G to A, chromosome X at 48,651,963 bp
  • A to G, chromosome X at 100,612,778 bp
  • A to T, chromosome X at 164,156,528 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1940 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039958-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.