Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1940Btlr/Mmmh
Stock Number:
039958-MU
Citation ID:
RRID:MMRRC_039958-MU
Other Names:
R1940 (G1), C57BL/6J-MtgxR1940Btlr
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
Acvr1c
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269275
Homologene: 26724
Lhx3
Name: LIM homeobox protein 3
Synonyms: P-LIM, mLim-3, Lim3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16871
HGNC: HGNC:6595
Homologene: 7814
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Msra
Name: methionine sulfoxide reductase A
Synonyms: MSR-A, 2310045J23Rik, 6530413P12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110265
HGNC: HGNC:7377
Homologene: 5812
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 21,257,377 bp
  • A to T, chromosome 1 at 24,264,750 bp
  • A to T, chromosome 1 at 37,536,037 bp
  • A to C, chromosome 1 at 54,428,958 bp
  • T to A, chromosome 1 at 92,491,735 bp
  • G to A, chromosome 1 at 110,049,024 bp
  • T to A, chromosome 1 at 120,188,029 bp
  • A to T, chromosome 1 at 121,555,224 bp
  • A to T, chromosome 1 at 130,418,106 bp
  • G to A, chromosome 1 at 134,145,418 bp
  • T to C, chromosome 1 at 150,456,023 bp
  • A to G, chromosome 1 at 152,531,605 bp
  • A to G, chromosome 1 at 152,834,064 bp
  • A to G, chromosome 1 at 188,951,561 bp
  • T to C, chromosome 2 at 26,203,962 bp
  • A to T, chromosome 2 at 58,283,505 bp
  • T to C, chromosome 2 at 70,258,075 bp
  • A to G, chromosome 2 at 73,624,901 bp
  • CCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGC, chromosome 2 at 83,812,874 bp
  • T to A, chromosome 2 at 85,777,171 bp
  • T to A, chromosome 2 at 86,483,359 bp
  • A to T, chromosome 2 at 87,508,732 bp
  • T to A, chromosome 2 at 90,811,282 bp
  • T to C, chromosome 2 at 122,325,984 bp
  • A to G, chromosome 2 at 125,194,193 bp
  • C to A, chromosome 2 at 125,740,339 bp
  • C to T, chromosome 2 at 126,778,023 bp
  • A to G, chromosome 2 at 127,246,460 bp
  • G to T, chromosome 2 at 130,663,560 bp
  • C to T, chromosome 2 at 162,934,483 bp
  • A to G, chromosome 2 at 165,292,050 bp
  • T to C, chromosome 2 at 180,190,921 bp
  • A to G, chromosome 2 at 180,260,080 bp
  • A to G, chromosome 3 at 16,205,092 bp
  • T to G, chromosome 3 at 54,377,150 bp
  • T to C, chromosome 3 at 55,953,100 bp
  • T to A, chromosome 3 at 92,572,749 bp
  • A to G, chromosome 3 at 96,598,676 bp
  • T to C, chromosome 3 at 126,438,346 bp
  • T to C, chromosome 3 at 129,858,828 bp
  • T to C, chromosome 3 at 133,488,638 bp
  • G to A, chromosome 4 at 81,361,443 bp
  • C to A, chromosome 4 at 120,773,664 bp
  • T to C, chromosome 4 at 123,054,240 bp
  • C to T, chromosome 4 at 128,950,784 bp
  • A to G, chromosome 4 at 132,321,803 bp
  • T to C, chromosome 4 at 141,465,548 bp
  • A to G, chromosome 4 at 148,444,011 bp
  • G to A, chromosome 4 at 154,865,682 bp
  • G to A, chromosome 5 at 9,511,682 bp
  • A to T, chromosome 5 at 41,625,790 bp
  • G to T, chromosome 5 at 110,836,060 bp
  • G to A, chromosome 5 at 116,126,165 bp
  • C to T, chromosome 6 at 40,883,532 bp
  • A to T, chromosome 6 at 48,990,073 bp
  • G to A, chromosome 6 at 49,244,740 bp
  • C to A, chromosome 6 at 52,234,370 bp
  • A to T, chromosome 6 at 118,511,693 bp
  • T to C, chromosome 6 at 125,134,634 bp
  • T to C, chromosome 7 at 45,588,368 bp
  • C to T, chromosome 7 at 81,578,299 bp
  • T to C, chromosome 7 at 120,433,609 bp
  • A to T, chromosome 8 at 40,681,361 bp
  • C to A, chromosome 8 at 70,452,261 bp
  • C to T, chromosome 8 at 86,631,634 bp
  • C to A, chromosome 8 at 95,299,692 bp
  • T to C, chromosome 8 at 105,946,037 bp
  • A to G, chromosome 8 at 125,480,148 bp
  • A to G, chromosome 9 at 7,139,159 bp
  • A to T, chromosome 9 at 57,796,148 bp
  • A to T, chromosome 10 at 8,729,932 bp
  • G to A, chromosome 10 at 40,737,726 bp
  • G to A, chromosome 10 at 40,883,071 bp
  • C to A, chromosome 10 at 76,545,462 bp
  • G to A, chromosome 10 at 80,709,773 bp
  • A to T, chromosome 10 at 116,319,610 bp
  • A to G, chromosome 11 at 3,243,279 bp
  • A to T, chromosome 11 at 23,867,279 bp
  • T to C, chromosome 11 at 63,889,743 bp
  • T to C, chromosome 11 at 70,771,376 bp
  • C to T, chromosome 11 at 98,892,410 bp
  • T to A, chromosome 11 at 100,048,243 bp
  • A to G, chromosome 11 at 116,535,850 bp
  • A to G, chromosome 11 at 117,756,023 bp
  • T to C, chromosome 12 at 89,260,381 bp
  • G to A, chromosome 12 at 104,790,102 bp
  • C to T, chromosome 13 at 55,011,391 bp
  • A to T, chromosome 13 at 56,614,314 bp
  • A to T, chromosome 13 at 59,642,237 bp
  • C to A, chromosome 13 at 59,718,021 bp
  • G to C, chromosome 13 at 64,368,018 bp
  • A to G, chromosome 13 at 75,840,137 bp
  • A to T, chromosome 14 at 13,828,582 bp
  • A to G, chromosome 14 at 55,522,435 bp
  • G to A, chromosome 14 at 64,285,056 bp
  • T to A, chromosome 15 at 8,233,852 bp
  • T to A, chromosome 15 at 47,659,210 bp
  • T to A, chromosome 15 at 82,405,294 bp
  • C to T, chromosome 15 at 100,970,204 bp
  • A to G, chromosome 16 at 22,255,045 bp
  • A to T, chromosome 16 at 33,807,911 bp
  • A to T, chromosome 17 at 23,477,480 bp
  • A to T, chromosome 17 at 23,609,852 bp
  • T to C, chromosome 17 at 23,737,664 bp
  • A to G, chromosome 17 at 27,111,217 bp
  • A to T, chromosome 17 at 30,731,207 bp
  • A to T, chromosome 17 at 32,056,845 bp
  • G to A, chromosome 17 at 64,519,878 bp
  • A to T, chromosome 18 at 33,472,411 bp
  • C to A, chromosome 18 at 36,196,844 bp
  • A to G, chromosome 19 at 7,909,727 bp
  • A to C, chromosome 19 at 12,035,911 bp
  • T to A, chromosome 19 at 41,630,776 bp
  • G to A, chromosome X at 48,651,963 bp
  • A to G, chromosome X at 100,612,778 bp
  • A to T, chromosome X at 164,156,528 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1940 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039958-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.