Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1981Btlr/Mmmh
Stock Number:
039993-MU
Citation ID:
RRID:MMRRC_039993-MU
Other Names:
R1981 (G1), C57BL/6J-MtgxR1981Btlr
Major Collection:

Strain Information

Fezf2
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Pax2
Name: paired box 2
Synonyms: Pax-2, Opdc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18504
HGNC: HGNC:8616
Homologene: 2968
Mcoln3
Name: mucolipin 3
Synonyms: varitint-waddler, Va, 6720490O21Rik, TRPML3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171166
Homologene: 10118
Ltbp3
Name: latent transforming growth factor beta binding protein 3
Synonyms: Ltbp2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16998
VEGA: 19
HGNC: HGNC:6716
Homologene: 7405
Casp8
Name: caspase 8
Synonyms: Mch5, MACH, FLICE, Caspase-8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12370
HGNC: HGNC:1509
Homologene: 7657
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234358
Strn4
Name: striatin, calmodulin binding protein 4
Synonyms: ZIN, zinedin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 97387
Homologene: 8378
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 20,117,060 bp
  • C to A, chromosome 1 at 58,828,962 bp
  • T to C, chromosome 2 at 25,255,224 bp
  • A to G, chromosome 2 at 59,923,680 bp
  • C to A, chromosome 2 at 65,690,170 bp
  • A to G, chromosome 2 at 71,389,977 bp
  • A to T, chromosome 2 at 86,347,142 bp
  • T to C, chromosome 2 at 94,326,704 bp
  • T to A, chromosome 2 at 111,621,241 bp
  • T to C, chromosome 3 at 28,915,835 bp
  • G to A, chromosome 3 at 38,991,664 bp
  • A to G, chromosome 3 at 67,350,005 bp
  • A to G, chromosome 3 at 109,935,010 bp
  • A to T, chromosome 3 at 146,140,590 bp
  • T to C, chromosome 4 at 116,314,840 bp
  • C to G, chromosome 4 at 130,065,443 bp
  • T to A, chromosome 4 at 140,752,522 bp
  • T to C, chromosome 5 at 66,261,214 bp
  • T to C, chromosome 5 at 114,353,837 bp
  • C to T, chromosome 5 at 114,749,559 bp
  • T to C, chromosome 5 at 120,761,835 bp
  • T to C, chromosome 5 at 137,911,856 bp
  • T to A, chromosome 6 at 29,206,451 bp
  • T to C, chromosome 6 at 39,147,175 bp
  • A to T, chromosome 6 at 57,159,661 bp
  • G to A, chromosome 6 at 72,517,544 bp
  • A to G, chromosome 6 at 121,252,517 bp
  • T to A, chromosome 6 at 147,075,675 bp
  • T to C, chromosome 7 at 6,480,932 bp
  • A to G, chromosome 7 at 6,570,558 bp
  • T to G, chromosome 7 at 16,725,307 bp
  • T to C, chromosome 7 at 16,838,551 bp
  • T to G, chromosome 7 at 25,000,975 bp
  • G to A, chromosome 7 at 42,613,622 bp
  • A to T, chromosome 7 at 65,312,855 bp
  • T to C, chromosome 7 at 72,164,698 bp
  • C to A, chromosome 7 at 112,891,745 bp
  • A to G, chromosome 7 at 125,644,272 bp
  • T to G, chromosome 8 at 45,381,741 bp
  • T to A, chromosome 8 at 69,228,172 bp
  • T to C, chromosome 8 at 69,818,792 bp
  • C to T, chromosome 8 at 104,548,377 bp
  • T to C, chromosome 8 at 111,009,343 bp
  • A to G, chromosome 8 at 124,714,187 bp
  • A to G, chromosome 9 at 22,012,868 bp
  • T to A, chromosome 9 at 24,770,913 bp
  • T to C, chromosome 9 at 38,403,735 bp
  • A to G, chromosome 9 at 59,894,146 bp
  • A to T, chromosome 9 at 65,558,692 bp
  • A to G, chromosome 9 at 66,268,898 bp
  • T to C, chromosome 9 at 98,410,299 bp
  • A to G, chromosome 9 at 106,881,623 bp
  • A to G, chromosome 9 at 108,515,028 bp
  • A to T, chromosome 10 at 60,378,751 bp
  • T to A, chromosome 10 at 80,325,779 bp
  • T to A, chromosome 10 at 90,995,809 bp
  • G to T, chromosome 10 at 109,719,090 bp
  • T to A, chromosome 10 at 123,125,041 bp
  • C to T, chromosome 11 at 23,742,761 bp
  • A to G, chromosome 11 at 69,474,325 bp
  • A to T, chromosome 11 at 70,236,865 bp
  • A to G, chromosome 11 at 71,098,938 bp
  • A to T, chromosome 11 at 84,892,170 bp
  • T to C, chromosome 11 at 87,085,331 bp
  • T to A, chromosome 11 at 87,103,290 bp
  • T to A, chromosome 11 at 114,732,929 bp
  • T to C, chromosome 12 at 28,863,025 bp
  • T to A, chromosome 13 at 34,916,754 bp
  • A to G, chromosome 14 at 8,253,572 bp
  • G to T, chromosome 14 at 12,344,405 bp
  • T to A, chromosome 14 at 50,361,988 bp
  • A to G, chromosome 15 at 82,103,312 bp
  • A to T, chromosome 16 at 45,619,974 bp
  • A to G, chromosome 16 at 79,078,935 bp
  • G to A, chromosome 17 at 12,733,903 bp
  • T to C, chromosome 17 at 27,985,121 bp
  • T to A, chromosome 17 at 36,128,722 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • C to T, chromosome 17 at 56,271,555 bp
  • C to A, chromosome 17 at 69,388,502 bp
  • T to C, chromosome 18 at 15,393,551 bp
  • A to G, chromosome 19 at 5,758,079 bp
  • T to G, chromosome 19 at 11,855,007 bp
  • G to T, chromosome 19 at 32,695,810 bp
  • A to G, chromosome 19 at 39,307,772 bp
  • G to A, chromosome 19 at 44,818,465 bp
  • A to G, chromosome X at 8,331,019 bp
  • A to C, chromosome X at 86,047,134 bp
  • A to T, chromosome X at 89,931,445 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1981 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039993-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.