Strain Name:
C57BL/6J-MtgxR1981Btlr/Mmmh
Stock Number:
039993-MU
Citation ID:
RRID:MMRRC_039993-MU
Other Names:
R1981 (G1), C57BL/6J-MtgxR1981Btlr
Major Collection:

Strain Information

Fezf2
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Pax2
Name: paired box 2
Synonyms: Pax-2, Opdc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18504
HGNC: HGNC:8616
Homologene: 2968
Mcoln3
Name: mucolipin 3
Synonyms: varitint-waddler, Va, 6720490O21Rik, TRPML3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 171166
Homologene: 10118
Ltbp3
Name: latent transforming growth factor beta binding protein 3
Synonyms: Ltbp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 16998
VEGA: 19
HGNC: HGNC:6716
Homologene: 7405
Casp8
Name: caspase 8
Synonyms: Mch5, MACH, FLICE, Caspase-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12370
HGNC: HGNC:1509
Homologene: 7657
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234358
Strn4
Name: striatin, calmodulin binding protein 4
Synonyms: ZIN, zinedin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 97387
Homologene: 8378
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224650
Homologene: 9068
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17776
Homologene: 7428
Usp15
Name: ubiquitin specific peptidase 15
Synonyms: Gcap18, 4921514G19Rik, E430033I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14479
VEGA: 10
Homologene: 101542
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74569
Homologene: 10100
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Hat1
Name: histone aminotransferase 1
Synonyms: 2410071B14Rik, KAT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 107435
HGNC: HGNC:4821
Homologene: 2701
Tead1
Name: TEA domain family member 1
Synonyms: mTEF-1, TEF-1, TEAD-1, Tcf13, Gtrgeo5, B230114H05Rik, 2610024B07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21676
Homologene: 2418
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Prr11
Name: proline rich 11
Synonyms: B930067F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 270906
Homologene: 10123
Git2
Name: GIT ArfGAP 2
Synonyms: Cool associated tyrosine phosphorylated-2, Cat-2, ARF GTPase activating protein 2, 5830420E16Rik, B230104M05Rik, 1500036H07Rik, 9630056M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Ticam1
Name: TIR domain containing adaptor molecule 1
Synonyms: Trif, TICAM-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106759
Homologene: 8605
Tjp1
Name: tight junction protein 1
Synonyms: ZO-1, ZO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21872
Homologene: 2445
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: ZF5, Zfp161, b2b1982Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22666
Homologene: 2560
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74369
Homologene: 46535
Ntng1
Name: netrin G1
Synonyms: Lmnt1, A930010C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80883
Homologene: 8949
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Eipr1
Name: EARP complex and GARP complex interacting protein 1
Synonyms: D12Ertd604e, Tssc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380752
VEGA: 12
Homologene: 2481
Myo19
Name: myosin XIX
Synonyms: 1110055A02Rik, Myohd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66196
Homologene: 49819
Rsrc1
Name: arginine/serine-rich coiled-coil 1
Synonyms: SRrp53, 1200013F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66880
Homologene: 41147
Atad1
Name: ATPase family, AAA domain containing 1
Synonyms: 4921525H23Rik, Thorase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67979
VEGA: 19
Homologene: 5960
Plekho2
Name: pleckstrin homology domain containing, family O member 2
Synonyms: Plekhq1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102595
VEGA: 9
Homologene: 11870
Ttc13
Name: tetratricopeptide repeat domain 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234875
Homologene: 11569
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244049
Homologene: 69254
Aqp4
Name: aquaporin 4
Synonyms: aquaporin-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 11829
VEGA: 18
HGNC: HGNC:637
Homologene: 37507
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf112, nmf181, nmf252, bob, sals
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22295
Homologene: 11142
Rnasek
Name: ribonuclease, RNase K
Synonyms: 2310033H11Rik, D11Bwg0434e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 52898
Homologene: 45475
Rel
Name: reticuloendotheliosis oncogene
Synonyms: c-Rel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19696
HGNC: HGNC:9954
Homologene: 2182
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Rbm15b
Name: RNA binding motif protein 15B
Synonyms: 1810017N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 109095
Homologene: 8325
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 260315
Homologene: 56688
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329628
Homologene: 14377
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110876
Homologene: 75001
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 195046
Homologene: 133820
Kdm7a
Name: lysine (K)-specific demethylase 7A
Synonyms: A630082K20Rik, ENSMUSG00000073143, Kdm7a, Jhdm1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 338523
Homologene: 25281
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231646
Homologene: 82639
Oas3
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: 2'-5' oligoadenylate synthetase-like 10, Oasl10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 246727
HGNC: HGNC:8088
Homologene: 4510
Nsun7
Name: NOL1/NOP2/Sun domain family, member 7
Synonyms: 4921525L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70918
Homologene: 11653
Impdh1
Name: inosine monophosphate dehydrogenase 1
Synonyms: B930086D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 23917
HGNC: HGNC:6052
Homologene: 68096
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: C030015H18Rik, Dnaic2, b2b3405Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432611
Homologene: 11311
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239081
Homologene: 77905
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Gmip
Name: Gem-interacting protein
Synonyms: 5031419I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 78816
Homologene: 9570
Fam149a
Name: family with sequence similarity 149, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212326
Homologene: 27540
Mansc4
Name: MANSC domain containing 4
Synonyms: Gm5887
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545893
Homologene: 86837
Or8k53
Name: olfactory receptor family 8 subfamily K member 53
Synonyms: GA_x6K02T2Q125-47819205-47818258, MOR186-1, Olfr1055
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 259023
Homologene: 131140
Col16a1
Name: collagen, type XVI, alpha 1
Synonyms: [a]1 (XVI) collagen, 2700007F12Rik, A530052M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107581
HGNC: HGNC:2193
Homologene: 1397
Ndor1
Name: NADPH dependent diflavin oxidoreductase 1
Synonyms: NR1, 4930447P04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78797
Homologene: 7144
Zfp976
Name: zinc finger protein 976
Synonyms: 9830147E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 208111
Homologene: 134004
Smg8
Name: SMG8 nonsense mediated mRNA decay factor
Synonyms: 1200011M11Rik, smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74133
Homologene: 32393
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Prkcsh
Name: protein kinase C substrate 80K-H
Synonyms: 80K-H, hepatocystin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19089
VEGA: 9
HGNC: HGNC:9411
Homologene: 2056
Or4k47
Name: olfactory receptor family 4 subfamily K member 47
Synonyms: GA_x6K02T2Q125-72673494-72672556, MOR248-4, Olfr1297
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258890
Homologene: 115545
Gm1527
Name: predicted gene 1527
Synonyms: LOC385263
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 385263
Homologene: 133976
Cyp3a13
Name: cytochrome P450, family 3, subfamily a, polypeptide 13
Synonyms: IIIAm2, steroid inducible
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13113
Homologene: 133564
Fam217a
Name: family with sequence similarity 217, member A
Synonyms: 1700026J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 71864
VEGA: 13
Homologene: 82344
Dapk2
Name: death-associated protein kinase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13143
HGNC: HGNC:2675
Homologene: 74940
Gm7030
Name: predicted gene 7030
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 630294
Homologene: 133121
Car7
Name: carbonic anhydrase 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12354
HGNC: HGNC:1381
Homologene: 55875
Padi4
Name: peptidyl arginine deiminase, type IV
Synonyms: PAD type IV, Pdi4, Pad4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18602
Homologene: 7883
Ddx19b
Name: DEAD box helicase 19b
Synonyms: 4921519L13Rik, 2810457M08Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234733
HGNC: HGNC:2742
Homologene: 56032
Acox2
Name: acyl-Coenzyme A oxidase 2, branched chain
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 93732
HGNC: HGNC:120
Homologene: 74473
Cyp2c29
Name: cytochrome P450, family 2, subfamily c, polypeptide 29
Synonyms: AHOH, AHOHase, Ahh-1, Ah-2, P450-2C, Cyp2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13095
Homologene: 117948
Or5bw2
Name: olfactory receptor family 5 subfamily BW member 2
Synonyms: GA_x6K02T2QGBW-3300391-3301317, MOR222-3, Olfr1350
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258384
Pcsk4
Name: proprotein convertase subtilisin/kexin type 4
Synonyms: PC4, SPC5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18551
HGNC: HGNC:8746
Homologene: 22495
Qars1
Name: glutaminyl-tRNA synthetase 1
Synonyms: 1110018N24Rik, 1200016L19Rik, Qars
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 97541
HGNC: HGNC:9751
Homologene: 133975
Or10v9
Name: olfactory receptor family 10 subfamily V member 9
Synonyms: GA_x6K02T2RE5P-2207258-2206302, MOR266-5, Olfr1418
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258227
Homologene: 79372
Tbx20
Name: T-box 20
Synonyms: Tbx12, 9430010M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 57246
VEGA: 9
Homologene: 32476
Usp18
Name: ubiquitin specific peptidase 18
Synonyms: UBP43, 1110058H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 24110
Homologene: 8047
Or8b3
Name: olfactory receptor family 8 subfamily B member 3
Synonyms: M3, GA_x6K02T2PVTD-32098059-32099003, MOR164-1, Olfr147
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258869
VEGA: 9
Homologene: 128279
Or6z7
Name: olfactory receptor family 6 subfamily Z member 7
Synonyms: MOR103-8, GA_x6K02T2QGBW-3210997-3210059, Olfr5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18349
Homologene: 72037
Gcsam
Name: germinal center associated, signaling and motility
Synonyms: M17, Gcet2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 14525
Homologene: 49157
Nmnat3
Name: nicotinamide nucleotide adenylyltransferase 3
Synonyms: PNAT3, 4933408N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74080
Homologene: 39772
Samt3
Name: spermatogenesis associated multipass transmembrane protein 3
Synonyms: 1700072E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 73495
Homologene: 87060
Ceacam9
Name: CEA cell adhesion molecule 9
Synonyms: mmCGM8, Cea-5, Cea5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26368
Homologene: 74987
Vmn1r12
Name: vomeronasal 1 receptor 12
Synonyms: Gm6674
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 626397
Homologene: 74373
Ssxb10
Name: SSX member B10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 385312
Homologene: 85956
Ppp4r3c1
Name: protein phosphatase 4 regulatory subunit 3C1
Synonyms: 4930415L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245511
Homologene: 133109
Sh2d6
Name: SH2 domain containing 6
Synonyms: 4933424C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71130
Homologene: 65986
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 20,117,060 bp
  • C to A, chromosome 1 at 58,828,962 bp
  • T to C, chromosome 2 at 25,255,224 bp
  • A to G, chromosome 2 at 59,923,680 bp
  • C to A, chromosome 2 at 65,690,170 bp
  • A to G, chromosome 2 at 71,389,977 bp
  • A to T, chromosome 2 at 86,347,142 bp
  • T to C, chromosome 2 at 94,326,704 bp
  • T to A, chromosome 2 at 111,621,241 bp
  • T to C, chromosome 3 at 28,915,835 bp
  • G to A, chromosome 3 at 38,991,664 bp
  • A to G, chromosome 3 at 67,350,005 bp
  • A to G, chromosome 3 at 109,935,010 bp
  • A to T, chromosome 3 at 146,140,590 bp
  • T to C, chromosome 4 at 116,314,840 bp
  • C to G, chromosome 4 at 130,065,443 bp
  • T to A, chromosome 4 at 140,752,522 bp
  • T to C, chromosome 5 at 66,261,214 bp
  • T to C, chromosome 5 at 114,353,837 bp
  • C to T, chromosome 5 at 114,749,559 bp
  • T to C, chromosome 5 at 120,761,835 bp
  • T to C, chromosome 5 at 137,911,856 bp
  • T to A, chromosome 6 at 29,206,451 bp
  • T to C, chromosome 6 at 39,147,175 bp
  • A to T, chromosome 6 at 57,159,661 bp
  • G to A, chromosome 6 at 72,517,544 bp
  • A to G, chromosome 6 at 121,252,517 bp
  • T to A, chromosome 6 at 147,075,675 bp
  • T to C, chromosome 7 at 6,480,932 bp
  • A to G, chromosome 7 at 6,570,558 bp
  • T to G, chromosome 7 at 16,725,307 bp
  • T to C, chromosome 7 at 16,838,551 bp
  • T to G, chromosome 7 at 25,000,975 bp
  • G to A, chromosome 7 at 42,613,622 bp
  • A to T, chromosome 7 at 65,312,855 bp
  • T to C, chromosome 7 at 72,164,698 bp
  • C to A, chromosome 7 at 112,891,745 bp
  • A to G, chromosome 7 at 125,644,272 bp
  • T to G, chromosome 8 at 45,381,741 bp
  • T to A, chromosome 8 at 69,228,172 bp
  • T to C, chromosome 8 at 69,818,792 bp
  • C to T, chromosome 8 at 104,548,377 bp
  • T to C, chromosome 8 at 111,009,343 bp
  • A to G, chromosome 8 at 124,714,187 bp
  • A to G, chromosome 9 at 22,012,868 bp
  • T to A, chromosome 9 at 24,770,913 bp
  • T to C, chromosome 9 at 38,403,735 bp
  • A to G, chromosome 9 at 59,894,146 bp
  • A to T, chromosome 9 at 65,558,692 bp
  • A to G, chromosome 9 at 66,268,898 bp
  • T to C, chromosome 9 at 98,410,299 bp
  • A to G, chromosome 9 at 106,881,623 bp
  • A to G, chromosome 9 at 108,515,028 bp
  • A to T, chromosome 10 at 60,378,751 bp
  • T to A, chromosome 10 at 80,325,779 bp
  • T to A, chromosome 10 at 90,995,809 bp
  • G to T, chromosome 10 at 109,719,090 bp
  • T to A, chromosome 10 at 123,125,041 bp
  • C to T, chromosome 11 at 23,742,761 bp
  • A to G, chromosome 11 at 69,474,325 bp
  • A to T, chromosome 11 at 70,236,865 bp
  • A to G, chromosome 11 at 71,098,938 bp
  • A to T, chromosome 11 at 84,892,170 bp
  • T to C, chromosome 11 at 87,085,331 bp
  • T to A, chromosome 11 at 87,103,290 bp
  • T to A, chromosome 11 at 114,732,929 bp
  • T to C, chromosome 12 at 28,863,025 bp
  • T to A, chromosome 13 at 34,916,754 bp
  • A to G, chromosome 14 at 8,253,572 bp
  • G to T, chromosome 14 at 12,344,405 bp
  • T to A, chromosome 14 at 50,361,988 bp
  • A to G, chromosome 15 at 82,103,312 bp
  • A to T, chromosome 16 at 45,619,974 bp
  • A to G, chromosome 16 at 79,078,935 bp
  • G to A, chromosome 17 at 12,733,903 bp
  • T to C, chromosome 17 at 27,985,121 bp
  • T to A, chromosome 17 at 36,128,722 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • C to T, chromosome 17 at 56,271,555 bp
  • C to A, chromosome 17 at 69,388,502 bp
  • T to C, chromosome 18 at 15,393,551 bp
  • A to G, chromosome 19 at 5,758,079 bp
  • T to G, chromosome 19 at 11,855,007 bp
  • G to T, chromosome 19 at 32,695,810 bp
  • A to G, chromosome 19 at 39,307,772 bp
  • G to A, chromosome 19 at 44,818,465 bp
  • A to G, chromosome X at 8,331,019 bp
  • A to C, chromosome X at 86,047,134 bp
  • A to T, chromosome X at 89,931,445 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1981 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039993-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.