Strain Name:
Stock Number:
Citation ID:
Other Names:
R1982 (G1), C57BL/6J-MtgxR1982Btlr
Major Collection:

Gene Information

Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11990
Homologene: 22542
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Name: GATA zinc finger domain containing 2A
Synonyms: 1110066C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234366
Homologene: 9766
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224273
Homologene: 28544
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224650
Homologene: 9068
Name: kinesin-associated protein 3
Synonyms: KAP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16579
Homologene: 7799
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 321006
Homologene: 8805
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 109263
Homologene: 8243
Name: mindbomb E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225164
Homologene: 10810
Name: glucocorticoid induced transcript 1
Synonyms: GIG18, 2310047L21Rik, Tssn1, A130036A18Rik, Fam117c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 170772
Homologene: 15773
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 236511
Homologene: 81826
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Name: centrin 3
Synonyms: MmCEN3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 12626
VEGA: 13
Homologene: 74521
Name: transcription factor AP-2, gamma
Synonyms: Ap-2.2, Stra2, AP2gamma, Tcfap2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 21420
Homologene: 2423
Name: nephronectin
Synonyms: POEM, 1110009H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 114249
Homologene: 14138
Name: toll-like receptor 4
Synonyms: Lps, Rasl2-8, lipopolysaccharide response
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21898
Homologene: 41317
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20563
Homologene: 3516
Name: toll-like receptor adaptor molecule 1
Synonyms: Trif, TICAM-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106759
Homologene: 8605
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NMDAR2C, NR2C, GluRepsilon3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14813
Homologene: 647
Name: desmoglein 4
Synonyms: lah, CDHF13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16769
Homologene: 65341
Name: zinc finger protein 982
Synonyms: Gm13152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 195531
Name: centrosomal protein 63
Synonyms: CD20R, ET2, D9Mgc41, D9Mgc48e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 28135
Homologene: 11861
Name: glutamine fructose-6-phosphate transaminase 1
Synonyms: GFAT, GFA, GFAT1, 2810423A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14583
Homologene: 68220
Name: vascular endothelial growth factor A
Synonyms: VPF, VEGF-A, VEGF120, Vegf, VEGF188, VEGF164
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22339
Homologene: 2534
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74369
Homologene: 46535
Name: dipeptidase 2
Synonyms: MBD-2, F630103D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 319446
Homologene: 49703
Name: aminolevulinic acid synthase 1
Synonyms: 5-aminolevulinate synthase, succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11655
Homologene: 55478
Name: LIM motif-containing protein kinase 2
Synonyms: Limk2b, Limk2a, A930024P04Rik, LIM kinase 2, whe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16886
Homologene: 55911
Name: interferon-related developmental regulator 2
Synonyms: SKMc15, 1810034A24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 15983
Homologene: 21341
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Piezo1, Fam38a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234839
Homologene: 124356
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 171395
Homologene: 51376
Name: serine/threonine kinase 32B
Synonyms: 2510009F08Rik, YANK2, STKG6, Stk32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 64293
Homologene: 48654
Name: jagged 1
Synonyms: Serrate-1, Headturner, Htu, ABE2, Ozz, Gsfabe2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16449
Homologene: 180
Name: aquaporin 4
Synonyms: aquaporin-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 11829
VEGA: 18
Homologene: 37507
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19661
VEGA: 14
Homologene: 9261
Name: selenoprotein P
Synonyms: D15Ucla1, selp, Se-P, Sepp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20363
Homologene: 3945
Name: BarH-like homeobox 2
Synonyms: Barx2b, 2310006E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12023
Homologene: 2715
Name: reticuloendotheliosis oncogene
Synonyms: c-Rel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19696
Homologene: 2182
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Synonyms: aggrecanase-1, ADAM-TS4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240913
Homologene: 36169
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237954
Homologene: 138824
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Name: hematopoietic SH2 domain containing
Synonyms: ALX, Hsh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 209488
Homologene: 13142
Name: zinc finger protein 990
Synonyms: Gm13225
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 101056073
Name: ArfGAP with FG repeats 2
Synonyms: A630095P14Rik, Hrbl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231801
Homologene: 4430
Name: butyrophilin-like 1
Synonyms: NG10, LOC240074, LOC240074, Btnl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100038862
Homologene: 103816
Name: calsequestrin 1
Synonyms: CSQ-1, CSQ1, CSQ, sCSQ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12372
Homologene: 20329
Name: platelet-activating factor receptor
Synonyms: PAFR, PAF receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19204
Homologene: 20260
Name: peptidylprolyl isomerase C
Synonyms: cyclophilin C, CyP-20c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 19038
VEGA: 18
Homologene: 727
Name: maestro heat-like repeat family member 8
Synonyms: 4922505G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 629499
Homologene: 51864
Name: interferon activated gene 207
Synonyms: AI607873, Pyhin-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226691
Homologene: 115929
Name: retinitis pigmentosa GTPase regulator interacting protein 1
Synonyms: 4930505G06Rik, A930002K18Rik, 4930401L23Rik, nmf247
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 77945
Homologene: 10679
Name: PRAME like 25
Synonyms: MGC:91194, Gm13023
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 194227
Homologene: 103830
Name: GUF1 homolog, GTPase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231279
Homologene: 6505
Name: solute carrier family 2 (facilitated glucose transporter), member 2
Synonyms: liver-type glucose transporter, Glut-2, Glut2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20526
Homologene: 68047
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: 2'-5' oligoadenylate synthetase-like 10, Oasl10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 246727
Homologene: 4510
Name: GLIS family zinc finger 3
Synonyms: E330013K21Rik, 4833409N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226075
Homologene: 34989
Name: olfactory receptor 512
Synonyms: GA_x6K02T2PBJ9-11043421-11044365, MOR268-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258719
Homologene: 138316
Name: annexin A8
Synonyms: Anx8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11752
Homologene: 20393
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11302
Homologene: 74861
Name: MANSC domain containing 4
Synonyms: Gm5887
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545893
Homologene: 86837
Name: nebulin-related anchoring protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18175
Homologene: 4499
Name: hepatocyte nuclear factor 4, gamma
Synonyms: NR2A2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 30942
Homologene: 37886
Name: immunoglobulin superfamily, member 9B
Synonyms: LOC235086, AI414108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235086
Homologene: 19472
Name: glucagon-like peptide 1 receptor
Synonyms: GLP-1R, GLP1Rc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14652
VEGA: 17
Homologene: 1558
Name: oxysterol binding protein-like 5
Synonyms: Obph1, ORP5, 1110006M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 79196
Homologene: 98024
Name: serine (or cysteine) peptidase inhibitor, clade I, member 2
Synonyms: 1810006A24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67931
Homologene: 21248
Name: coiled-coil domain containing 33
Synonyms: LOC382077, 4930535E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382077
Homologene: 19641
Name: flavin containing monooxygenase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14261
Homologene: 55520
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384220
Homologene: 104825
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: protein kinase C substrate 80K-H
Synonyms: 80K-H, hepatocystin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19089
Homologene: 2056
Name: inter-alpha trypsin inhibitor, heavy chain 3
Synonyms: Intin3, Itih-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16426
Homologene: 1669
Name: interferon-induced protein 35
Synonyms: IFP35, 2010008K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70110
Homologene: 4040
Name: proline rich 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233895
Homologene: 11424
Name: family with sequence similarity 71, member F2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 245884
Homologene: 52974
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93838
Homologene: 14143
Name: predicted gene 7030
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 630294
Homologene: 133121
Name: carbonic anhydrase 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12354
Homologene: 55875
Name: DEAD box helicase 19b
Synonyms: 4921519L13Rik, 2810457M08Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234733
Homologene: 56032
Name: acyl-Coenzyme A oxidase 2, branched chain
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 93732
Homologene: 74473
Name: protein kinase, cAMP dependent regulatory, type I beta
Synonyms: RIbeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19085
Homologene: 37665
Name: olfactory receptor 91
Synonyms: MOR256-20, GA_x6K02T2PSCP-1533927-1532989
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258470
Homologene: 72346
Name: CD84 antigen
Synonyms: CDw84, SLAMF5, A130013D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12523
Homologene: 48249
Name: GATA binding protein 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14464
Homologene: 32031
Name: UDP glucuronosyltransferase 2 family, polypeptide B34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100727
Homologene: 117389
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Name: STRA6-like
Synonyms: Rbpr2, 1300002K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74152
Homologene: 81924
Name: RIKEN cDNA E130304I02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78547
Name: GTPase, IMAP family member 7
Synonyms: IAN7, Ian3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 231932
Homologene: 134307
Name: transmembrane protein 35B
Synonyms: Zmym6nb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100039968
Homologene: 106612
Name: zinc finger protein 324
Synonyms: D430030K24Rik, ZF5128
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243834
Homologene: 8648
Name: olfactory receptor 1
Synonyms: MOR135-13, GA_x6K02T2P1NL-3556334-3555390, I54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258923
Homologene: 115482
Name: phospholipid phosphatase related 3
Synonyms: BC005764, Lppr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216152
Homologene: 11769
Name: olfactory receptor 5
Synonyms: MOR103-8, GA_x6K02T2QGBW-3210997-3210059
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18349
Homologene: 72037
Name: glutamic pyruvate transaminase (alanine aminotransferase) 2
Synonyms: ALT2, 4631422C05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 108682
Homologene: 68832
Name: solute carrier family 43, member 1
Synonyms: PB39, 2610016F07Rik, Pov1, Lat3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72401
Homologene: 2688
Name: spermatogenesis associated multipass transmembrane protein 3
Synonyms: 1700072E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 73495
Homologene: 87060
Name: carcinoembryonic antigen-related cell adhesion molecule 9
Synonyms: mmCGM8, Cea-5, Cea5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26368
Homologene: 74987
Name: synovial sarcoma, X member B10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 385312
Homologene: 85956
Name: RIKEN cDNA 4930415L06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245511
Homologene: 133109
Name: centromere protein I
Synonyms: Fshprh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 102920
Homologene: 4899
Name: proliferating cell nuclear antigen pseudogene 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18540
VEGA: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 162,839,756 bp
  • T to A, chromosome 1 at 163,862,022 bp
  • T to C, chromosome 1 at 171,258,934 bp
  • C to A, chromosome 1 at 171,884,585 bp
  • C to T, chromosome 1 at 172,215,530 bp
  • T to G, chromosome 1 at 173,735,239 bp
  • G to T, chromosome 2 at 84,856,889 bp
  • A to G, chromosome 2 at 130,970,222 bp
  • T to A, chromosome 2 at 137,085,237 bp
  • A to G, chromosome 2 at 157,271,975 bp
  • A to T, chromosome 2 at 172,557,236 bp
  • G to A, chromosome 2 at 180,328,437 bp
  • A to G, chromosome 3 at 3,638,208 bp
  • G to A, chromosome 3 at 28,717,441 bp
  • C to T, chromosome 3 at 75,249,157 bp
  • T to C, chromosome 3 at 132,948,132 bp
  • T to A, chromosome 4 at 45,867,237 bp
  • T to A, chromosome 4 at 66,841,035 bp
  • T to C, chromosome 4 at 121,150,112 bp
  • A to T, chromosome 4 at 126,463,663 bp
  • A to T, chromosome 4 at 127,126,053 bp
  • A to G, chromosome 4 at 132,579,985 bp
  • C to A, chromosome 4 at 143,795,150 bp
  • A to C, chromosome 4 at 145,536,869 bp
  • T to A, chromosome 4 at 147,512,592 bp
  • T to A, chromosome 5 at 37,649,114 bp
  • G to A, chromosome 5 at 48,249,836 bp
  • T to A, chromosome 5 at 69,567,226 bp
  • T to C, chromosome 5 at 86,906,313 bp
  • T to C, chromosome 5 at 109,364,024 bp
  • T to C, chromosome 5 at 120,761,835 bp
  • A to T, chromosome 5 at 137,664,253 bp
  • C to T, chromosome 5 at 139,127,643 bp
  • T to C, chromosome 6 at 8,592,980 bp
  • A to G, chromosome 6 at 29,285,922 bp
  • A to T, chromosome 6 at 48,724,241 bp
  • G to A, chromosome 6 at 83,058,577 bp
  • T to A, chromosome 6 at 87,054,630 bp
  • T to C, chromosome 6 at 139,622,548 bp
  • T to A, chromosome 6 at 147,075,675 bp
  • T to C, chromosome 7 at 6,480,932 bp
  • T to C, chromosome 7 at 12,971,218 bp
  • T to G, chromosome 7 at 16,725,307 bp
  • G to A, chromosome 7 at 35,802,623 bp
  • A to G, chromosome 7 at 108,713,695 bp
  • G to T, chromosome 7 at 127,475,490 bp
  • A to C, chromosome 7 at 143,741,671 bp
  • G to A, chromosome 8 at 69,913,132 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • C to T, chromosome 8 at 85,516,203 bp
  • C to T, chromosome 8 at 104,548,377 bp
  • A to C, chromosome 8 at 105,989,455 bp
  • T to C, chromosome 8 at 111,009,343 bp
  • G to T, chromosome 8 at 122,496,729 bp
  • A to G, chromosome 9 at 22,012,868 bp
  • G to A, chromosome 9 at 27,322,239 bp
  • A to C, chromosome 9 at 31,913,012 bp
  • T to A, chromosome 9 at 58,117,168 bp
  • T to C, chromosome 9 at 102,602,880 bp
  • A to T, chromosome 9 at 106,238,185 bp
  • C to T, chromosome 9 at 106,863,261 bp
  • T to C, chromosome 9 at 107,589,894 bp
  • A to G, chromosome 10 at 79,866,425 bp
  • A to T, chromosome 11 at 3,355,461 bp
  • T to A, chromosome 11 at 8,901,362 bp
  • C to T, chromosome 11 at 23,742,761 bp
  • A to T, chromosome 11 at 73,395,092 bp
  • A to T, chromosome 11 at 101,458,286 bp
  • G to A, chromosome 11 at 103,498,966 bp
  • G to T, chromosome 11 at 115,260,905 bp
  • G to T, chromosome 11 at 120,013,514 bp
  • A to T, chromosome 12 at 25,051,194 bp
  • A to C, chromosome 12 at 51,785,841 bp
  • A to G, chromosome 12 at 79,255,243 bp
  • T to A, chromosome 12 at 110,954,785 bp
  • A to G, chromosome 13 at 81,784,697 bp
  • A to G, chromosome 14 at 8,253,572 bp
  • G to T, chromosome 14 at 12,344,405 bp
  • T to C, chromosome 14 at 30,923,583 bp
  • T to C, chromosome 14 at 33,954,545 bp
  • A to T, chromosome 14 at 34,096,570 bp
  • G to A, chromosome 14 at 52,152,194 bp
  • A to T, chromosome 15 at 3,275,694 bp
  • A to G, chromosome 15 at 82,103,312 bp
  • T to C, chromosome 16 at 59,544,125 bp
  • T to C, chromosome 17 at 27,985,121 bp
  • C to A, chromosome 17 at 30,925,627 bp
  • A to T, chromosome 17 at 34,379,751 bp
  • T to A, chromosome 17 at 36,128,722 bp
  • T to A, chromosome 17 at 37,093,808 bp
  • A to C, chromosome 17 at 46,018,860 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • C to T, chromosome 17 at 56,271,555 bp
  • A to G, chromosome 18 at 10,812,064 bp
  • T to C, chromosome 18 at 15,393,551 bp
  • A to T, chromosome 18 at 20,471,212 bp
  • G to A, chromosome 18 at 53,407,068 bp
  • T to C, chromosome 19 at 9,283,683 bp
  • A to T, chromosome 19 at 28,531,274 bp
  • T to C, chromosome 19 at 56,384,105 bp
  • A to G, chromosome X at 8,331,019 bp
  • A to C, chromosome X at 86,047,134 bp
  • A to T, chromosome X at 89,931,445 bp
  • T to A, chromosome X at 134,318,033 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1982 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039994-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.