Strain Name:
C57BL/6J-MtgxR1982Btlr/Mmmh
Stock Number:
039994-MU
Citation ID:
RRID:MMRRC_039994-MU
Other Names:
R1982 (G1), C57BL/6J-MtgxR1982Btlr
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Fezf2
Name: Fez family zinc finger 2
Synonyms: Zfp312, forebrain embryonic zinc finger, Fez, Fezl
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Gatad2a
Name: GATA zinc finger domain containing 2A
Synonyms: 1110066C11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234366
Homologene: 9766
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Kifap3
Name: kinesin-associated protein 3
Synonyms: KAP3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16579
Homologene: 7799
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: Vprbp, B930007L02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, mindbomb, Mib, mind bomb-1, skeletrophin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Glcci1
Name: glucocorticoid induced transcript 1
Synonyms: Tssn1, Fam117c, 2310047L21Rik, GIG18, A130036A18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170772
Homologene: 15773
Ago1
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236511
HGNC: HGNC:3262
Homologene: 81826
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: b2b327Clo, opm, A630086P08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Cetn3
Name: centrin 3
Synonyms: MmCEN3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12626
VEGA: 13
HGNC: HGNC:1868
Homologene: 74521
Tfap2c
Name: transcription factor AP-2, gamma
Synonyms: Stra2, Ap-2.2, AP2gamma, Tcfap2c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21420
Homologene: 2423
Npnt
Name: nephronectin
Synonyms: 1110009H02Rik, POEM
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 114249
Homologene: 14138
Tlr4
Name: toll-like receptor 4
Synonyms: Lps, lipopolysaccharide response, Rasl2-8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21898
Homologene: 41317
Slit2
Name: slit guidance ligand 2
Synonyms: Drad-1, E130320P19Rik, E030015M03Rik, Slil3, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Ticam1
Name: TIR domain containing adaptor molecule 1
Synonyms: Trif, TICAM-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106759
Homologene: 8605
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NR2C, NMDAR2C, GluRepsilon3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Dsg4
Name: desmoglein 4
Synonyms: CDHF13, lah
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16769
Homologene: 65341
Zfp982
Name: zinc finger protein 982
Synonyms: Gm13152
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 195531
Cep63
Name: centrosomal protein 63
Synonyms: D9Mgc48e, ET2, CD20R, D9Mgc41
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 28135
Homologene: 11861
Gfpt1
Name: glutamine fructose-6-phosphate transaminase 1
Synonyms: 2810423A18Rik, GFAT1, GFAT, GFA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14583
HGNC: HGNC:4241
Homologene: 68220
Vegfa
Name: vascular endothelial growth factor A
Synonyms: VEGF164, VEGF-A, Vegf, VEGF120, VEGF188, VPF
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22339
Homologene: 2534
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Dpep2
Name: dipeptidase 2
Synonyms: F630103D06Rik, MBD-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319446
Homologene: 49703
Alas1
Name: aminolevulinic acid synthase 1
Synonyms: succinyl-CoA: glycine C-succinyl transferase, Alas-1, 5-aminolevulinate synthase, ALAS-N
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11655
HGNC: HGNC:396
Homologene: 55478
Limk2
Name: LIM domain kinase 2
Synonyms: A930024P04Rik, whe, LIM kinase 2, Limk2b, Limk2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16886
HGNC: HGNC:6614
Homologene: 55911
Ifrd2
Name: interferon-related developmental regulator 2
Synonyms: SKMc15, 1810034A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15983
HGNC: HGNC:5457
Homologene: 21341
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, A630028O16Rik, LOC380767
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Piezo1
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Fam38a, Piezo1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234839
Homologene: 124356
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Stk32b
Name: serine/threonine kinase 32B
Synonyms: YANK2, Stk32, STKG6, 2510009F08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64293
Homologene: 48654
Jag1
Name: jagged 1
Synonyms: Serrate-1, Headturner, Ozz, Htu, Gsfabe2, ABE2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16449
HGNC: HGNC:6188
Homologene: 180
Aqp4
Name: aquaporin 4
Synonyms: aquaporin-4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11829
VEGA: 18
HGNC: HGNC:637
Homologene: 37507
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Rbp-3, Irbp
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Selenop
Name: selenoprotein P
Synonyms: Se-P, D15Ucla1, selp, Sepp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20363
Homologene: 3945
Barx2
Name: BarH-like homeobox 2
Synonyms: Barx2b, 2310006E12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12023
HGNC: HGNC:956
Homologene: 2715
Rel
Name: reticuloendotheliosis oncogene
Synonyms: c-Rel
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19696
HGNC: HGNC:9954
Homologene: 2182
Adamts4
Name: ADAM metallopeptidase with thrombospondin type 1 motif 4
Synonyms: aggrecanase-1, ADAM-TS4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240913
HGNC: HGNC:220
Homologene: 36169
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Hsh2d
Name: hematopoietic SH2 domain containing
Synonyms: Hsh2, ALX
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209488
Homologene: 13142
Zfp990
Name: zinc finger protein 990
Synonyms: Gm13225
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 101056073
Agfg2
Name: ArfGAP with FG repeats 2
Synonyms: Hrbl, A630095P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231801
HGNC: HGNC:5177
Homologene: 4430
Btnl1
Name: butyrophilin-like 1
Synonyms: NG10, LOC240074, LOC240074, Btnl3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100038862
Homologene: 103816
Casq1
Name: calsequestrin 1
Synonyms: CSQ1, sCSQ, CSQ-1, CSQ
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12372
HGNC: HGNC:1512
Homologene: 20329
Ptafr
Name: platelet-activating factor receptor
Synonyms: PAFR, PAF receptor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19204
HGNC: HGNC:9582
Homologene: 20260
Ppic
Name: peptidylprolyl isomerase C
Synonyms: cyclophilin C, CyP-20c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19038
VEGA: 18
HGNC: HGNC:9256
Homologene: 727
Mroh8
Name: maestro heat-like repeat family member 8
Synonyms: 4922505G16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 629499
Homologene: 51864
Ifi207
Name: interferon activated gene 207
Synonyms: AI607873, Pyhin-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226691
HGNC: HGNC:5395
Homologene: 115929
Rpgrip1
Name: retinitis pigmentosa GTPase regulator interacting protein 1
Synonyms: 4930505G06Rik, nmf247, A930002K18Rik, 4930401L23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 77945
Homologene: 10679
Pramel25
Name: PRAME like 25
Synonyms: MGC:91194, Gm13023
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194227
Homologene: 103830
Guf1
Name: GUF1 homolog, GTPase
Synonyms: mtEF4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231279
Homologene: 6505
Slc2a2
Name: solute carrier family 2 (facilitated glucose transporter), member 2
Synonyms: Glut2, Glut-2, liver-type glucose transporter
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20526
Homologene: 68047
Oas3
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: Oasl10, 2'-5' oligoadenylate synthetase-like 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246727
HGNC: HGNC:8088
Homologene: 4510
Glis3
Name: GLIS family zinc finger 3
Synonyms: E330013K21Rik, 4833409N03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226075
Homologene: 34989
Or10a3m
Name: olfactory receptor family 10 subfamily A member 3M
Synonyms: GA_x6K02T2PBJ9-11043421-11044365, MOR268-3, Olfr512
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258719
HGNC: HGNC:8162
Homologene: 138316
Anxa8
Name: annexin A8
Synonyms: Anx8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11752
Homologene: 20393
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Mansc4
Name: MANSC domain containing 4
Synonyms: Gm5887
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545893
Homologene: 86837
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Hnf4g
Name: hepatocyte nuclear factor 4, gamma
Synonyms: NR2A2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30942
HGNC: HGNC:5026
Homologene: 37886
Igsf9b
Name: immunoglobulin superfamily, member 9B
Synonyms: AI414108, LOC235086
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235086
Homologene: 19472
Glp1r
Name: glucagon-like peptide 1 receptor
Synonyms: GLP1Rc, GLP-1R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14652
VEGA: 17
HGNC: HGNC:4324
Homologene: 1558
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: ORP5, Obph1, 1110006M06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 79196
Homologene: 98024
Serpini2
Name: serine (or cysteine) peptidase inhibitor, clade I, member 2
Synonyms: 1810006A24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67931
HGNC: HGNC:8945
Homologene: 21248
Ccdc33
Name: coiled-coil domain containing 33
Synonyms: 4930535E21Rik, LOC382077
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382077
Homologene: 19641
Fmo1
Name: flavin containing monooxygenase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14261
HGNC: HGNC:3769
Homologene: 55520
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384220
Homologene: 104825
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: ELK1, Kv12.1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Prkcsh
Name: protein kinase C substrate 80K-H
Synonyms: hepatocystin, 80K-H
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19089
VEGA: 9
HGNC: HGNC:9411
Homologene: 2056
Itih3
Name: inter-alpha trypsin inhibitor, heavy chain 3
Synonyms: Itih-3, Intin3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16426
HGNC: HGNC:6168
Homologene: 1669
Ifi35
Name: interferon-induced protein 35
Synonyms: IFP35, 2010008K16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70110
HGNC: HGNC:5399
Homologene: 4040
Prr14
Name: proline rich 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233895
Homologene: 11424
Garin1a
Name: golgi associated RAB2 interactor 1A
Synonyms: Fam71f2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 245884
Homologene: 52974
Dqx1
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93838
Homologene: 14143
Gm7030
Name: predicted gene 7030
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 630294
Homologene: 133121
Car7
Name: carbonic anhydrase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12354
HGNC: HGNC:1381
Homologene: 55875
Ddx19b
Name: DEAD box helicase 19b
Synonyms: 2810457M08Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b, 4921519L13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234733
HGNC: HGNC:2742
Homologene: 56032
Acox2
Name: acyl-Coenzyme A oxidase 2, branched chain
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93732
HGNC: HGNC:120
Homologene: 74473
Prkar1b
Name: protein kinase, cAMP dependent regulatory, type I beta
Synonyms: RIbeta
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19085
HGNC: HGNC:9390
Homologene: 37665
Or2h1
Name: olfactory receptor family 2 subfamily H member 1
Synonyms: Olfr91, GA_x6K02T2PSCP-1533927-1532989, MOR256-20
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258470
HGNC: HGNC:8252
Homologene: 72346
Cd84
Name: CD84 antigen
Synonyms: SLAMF5, CDw84, A130013D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12523
HGNC: HGNC:1704
Homologene: 48249
Gata5
Name: GATA binding protein 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14464
Homologene: 32031
Ugt2b34
Name: UDP glucuronosyltransferase 2 family, polypeptide B34
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100727
Homologene: 117389
AC122511.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Stra6l
Name: STRA6-like
Synonyms: 1300002K09Rik, Rbpr2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74152
Homologene: 81924
E130304I02Rik
Name: RIKEN cDNA E130304I02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78547
Gimap7
Name: GTPase, IMAP family member 7
Synonyms: Ian3, IAN7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231932
Homologene: 134307
Tmem35b
Name: transmembrane protein 35B
Synonyms: Zmym6nb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039968
Homologene: 106612
Zfp324
Name: zinc finger protein 324
Synonyms: ZF5128, D430030K24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243834
Homologene: 8648
Or1e16
Name: olfactory receptor family 1 subfamily E member 16
Synonyms: MOR135-13, GA_x6K02T2P1NL-3556334-3555390, I54, Olfr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258923
Homologene: 115482
Plppr3
Name: phospholipid phosphatase related 3
Synonyms: Lppr3, BC005764
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216152
Homologene: 11769
Or6z7
Name: olfactory receptor family 6 subfamily Z member 7
Synonyms: GA_x6K02T2QGBW-3210997-3210059, Olfr5, MOR103-8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18349
Homologene: 72037
Gpt2
Name: glutamic pyruvate transaminase (alanine aminotransferase) 2
Synonyms: ALT2, 4631422C05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108682
Homologene: 68832
Slc43a1
Name: solute carrier family 43, member 1
Synonyms: 2610016F07Rik, PB39, Pov1, Lat3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72401
HGNC: HGNC:9225
Homologene: 2688
Samt3
Name: spermatogenesis associated multipass transmembrane protein 3
Synonyms: 1700072E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 73495
Homologene: 87060
Ceacam9
Name: CEA cell adhesion molecule 9
Synonyms: Cea-5, mmCGM8, Cea5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26368
Homologene: 74987
Ppp4r3c1
Name: protein phosphatase 4 regulatory subunit 3C1
Synonyms: 4930415L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245511
Homologene: 133109
Cenpi
Name: centromere protein I
Synonyms: Fshprh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 102920
HGNC: HGNC:3968
Homologene: 4899
Pcna-ps2
Name: proliferating cell nuclear antigen pseudogene 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18540
VEGA: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 162,839,756 bp
  • T to A, chromosome 1 at 163,862,022 bp
  • T to C, chromosome 1 at 171,258,934 bp
  • C to A, chromosome 1 at 171,884,585 bp
  • C to T, chromosome 1 at 172,215,530 bp
  • T to G, chromosome 1 at 173,735,239 bp
  • G to T, chromosome 2 at 84,856,889 bp
  • A to G, chromosome 2 at 130,970,222 bp
  • T to A, chromosome 2 at 137,085,237 bp
  • A to G, chromosome 2 at 157,271,975 bp
  • A to T, chromosome 2 at 172,557,236 bp
  • G to A, chromosome 2 at 180,328,437 bp
  • A to G, chromosome 3 at 3,638,208 bp
  • G to A, chromosome 3 at 28,717,441 bp
  • C to T, chromosome 3 at 75,249,157 bp
  • T to C, chromosome 3 at 132,948,132 bp
  • T to A, chromosome 4 at 45,867,237 bp
  • T to A, chromosome 4 at 66,841,035 bp
  • T to C, chromosome 4 at 121,150,112 bp
  • A to T, chromosome 4 at 126,463,663 bp
  • A to T, chromosome 4 at 127,126,053 bp
  • A to G, chromosome 4 at 132,579,985 bp
  • C to A, chromosome 4 at 143,795,150 bp
  • A to C, chromosome 4 at 145,536,869 bp
  • T to A, chromosome 4 at 147,512,592 bp
  • T to A, chromosome 5 at 37,649,114 bp
  • G to A, chromosome 5 at 48,249,836 bp
  • T to A, chromosome 5 at 69,567,226 bp
  • T to C, chromosome 5 at 86,906,313 bp
  • T to C, chromosome 5 at 109,364,024 bp
  • T to C, chromosome 5 at 120,761,835 bp
  • A to T, chromosome 5 at 137,664,253 bp
  • C to T, chromosome 5 at 139,127,643 bp
  • T to C, chromosome 6 at 8,592,980 bp
  • A to G, chromosome 6 at 29,285,922 bp
  • A to T, chromosome 6 at 48,724,241 bp
  • G to A, chromosome 6 at 83,058,577 bp
  • T to A, chromosome 6 at 87,054,630 bp
  • T to C, chromosome 6 at 139,622,548 bp
  • T to A, chromosome 6 at 147,075,675 bp
  • T to C, chromosome 7 at 6,480,932 bp
  • T to C, chromosome 7 at 12,971,218 bp
  • T to G, chromosome 7 at 16,725,307 bp
  • G to A, chromosome 7 at 35,802,623 bp
  • A to G, chromosome 7 at 108,713,695 bp
  • G to T, chromosome 7 at 127,475,490 bp
  • A to C, chromosome 7 at 143,741,671 bp
  • G to A, chromosome 8 at 69,913,132 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • C to T, chromosome 8 at 85,516,203 bp
  • C to T, chromosome 8 at 104,548,377 bp
  • A to C, chromosome 8 at 105,989,455 bp
  • T to C, chromosome 8 at 111,009,343 bp
  • G to T, chromosome 8 at 122,496,729 bp
  • A to G, chromosome 9 at 22,012,868 bp
  • G to A, chromosome 9 at 27,322,239 bp
  • A to C, chromosome 9 at 31,913,012 bp
  • T to A, chromosome 9 at 58,117,168 bp
  • T to C, chromosome 9 at 102,602,880 bp
  • A to T, chromosome 9 at 106,238,185 bp
  • C to T, chromosome 9 at 106,863,261 bp
  • T to C, chromosome 9 at 107,589,894 bp
  • A to G, chromosome 10 at 79,866,425 bp
  • A to T, chromosome 11 at 3,355,461 bp
  • T to A, chromosome 11 at 8,901,362 bp
  • C to T, chromosome 11 at 23,742,761 bp
  • A to T, chromosome 11 at 73,395,092 bp
  • A to T, chromosome 11 at 101,458,286 bp
  • G to A, chromosome 11 at 103,498,966 bp
  • G to T, chromosome 11 at 115,260,905 bp
  • G to T, chromosome 11 at 120,013,514 bp
  • A to T, chromosome 12 at 25,051,194 bp
  • A to C, chromosome 12 at 51,785,841 bp
  • A to G, chromosome 12 at 79,255,243 bp
  • T to A, chromosome 12 at 110,954,785 bp
  • A to G, chromosome 13 at 81,784,697 bp
  • A to G, chromosome 14 at 8,253,572 bp
  • G to T, chromosome 14 at 12,344,405 bp
  • T to C, chromosome 14 at 30,923,583 bp
  • T to C, chromosome 14 at 33,954,545 bp
  • A to T, chromosome 14 at 34,096,570 bp
  • G to A, chromosome 14 at 52,152,194 bp
  • A to T, chromosome 15 at 3,275,694 bp
  • A to G, chromosome 15 at 82,103,312 bp
  • T to C, chromosome 16 at 59,544,125 bp
  • T to C, chromosome 17 at 27,985,121 bp
  • C to A, chromosome 17 at 30,925,627 bp
  • A to T, chromosome 17 at 34,379,751 bp
  • T to A, chromosome 17 at 36,128,722 bp
  • T to A, chromosome 17 at 37,093,808 bp
  • A to C, chromosome 17 at 46,018,860 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • C to T, chromosome 17 at 56,271,555 bp
  • A to G, chromosome 18 at 10,812,064 bp
  • T to C, chromosome 18 at 15,393,551 bp
  • A to T, chromosome 18 at 20,471,212 bp
  • G to A, chromosome 18 at 53,407,068 bp
  • T to C, chromosome 19 at 9,283,683 bp
  • A to T, chromosome 19 at 28,531,274 bp
  • T to C, chromosome 19 at 56,384,105 bp
  • A to G, chromosome X at 8,331,019 bp
  • A to C, chromosome X at 86,047,134 bp
  • A to T, chromosome X at 89,931,445 bp
  • T to A, chromosome X at 134,318,033 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1982 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039994-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.