Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1982Btlr/Mmmh
Stock Number:
039994-MU
Citation ID:
RRID:MMRRC_039994-MU
Other Names:
R1982 (G1), C57BL/6J-MtgxR1982Btlr
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Fezf2
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Gatad2a
Name: GATA zinc finger domain containing 2A
Synonyms: 1110066C11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234366
Homologene: 9766
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Kifap3
Name: kinesin-associated protein 3
Synonyms: KAP3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16579
Homologene: 7799
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 162,839,756 bp
  • T to A, chromosome 1 at 163,862,022 bp
  • T to C, chromosome 1 at 171,258,934 bp
  • C to A, chromosome 1 at 171,884,585 bp
  • C to T, chromosome 1 at 172,215,530 bp
  • T to G, chromosome 1 at 173,735,239 bp
  • G to T, chromosome 2 at 84,856,889 bp
  • A to G, chromosome 2 at 130,970,222 bp
  • T to A, chromosome 2 at 137,085,237 bp
  • A to G, chromosome 2 at 157,271,975 bp
  • A to T, chromosome 2 at 172,557,236 bp
  • G to A, chromosome 2 at 180,328,437 bp
  • A to G, chromosome 3 at 3,638,208 bp
  • G to A, chromosome 3 at 28,717,441 bp
  • C to T, chromosome 3 at 75,249,157 bp
  • T to C, chromosome 3 at 132,948,132 bp
  • T to A, chromosome 4 at 45,867,237 bp
  • T to A, chromosome 4 at 66,841,035 bp
  • T to C, chromosome 4 at 121,150,112 bp
  • A to T, chromosome 4 at 126,463,663 bp
  • A to T, chromosome 4 at 127,126,053 bp
  • A to G, chromosome 4 at 132,579,985 bp
  • C to A, chromosome 4 at 143,795,150 bp
  • A to C, chromosome 4 at 145,536,869 bp
  • T to A, chromosome 4 at 147,512,592 bp
  • T to A, chromosome 5 at 37,649,114 bp
  • G to A, chromosome 5 at 48,249,836 bp
  • T to A, chromosome 5 at 69,567,226 bp
  • T to C, chromosome 5 at 86,906,313 bp
  • T to C, chromosome 5 at 109,364,024 bp
  • T to C, chromosome 5 at 120,761,835 bp
  • A to T, chromosome 5 at 137,664,253 bp
  • C to T, chromosome 5 at 139,127,643 bp
  • T to C, chromosome 6 at 8,592,980 bp
  • A to G, chromosome 6 at 29,285,922 bp
  • A to T, chromosome 6 at 48,724,241 bp
  • G to A, chromosome 6 at 83,058,577 bp
  • T to A, chromosome 6 at 87,054,630 bp
  • T to C, chromosome 6 at 139,622,548 bp
  • T to A, chromosome 6 at 147,075,675 bp
  • T to C, chromosome 7 at 6,480,932 bp
  • T to C, chromosome 7 at 12,971,218 bp
  • T to G, chromosome 7 at 16,725,307 bp
  • G to A, chromosome 7 at 35,802,623 bp
  • A to G, chromosome 7 at 108,713,695 bp
  • G to T, chromosome 7 at 127,475,490 bp
  • A to C, chromosome 7 at 143,741,671 bp
  • G to A, chromosome 8 at 69,913,132 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • C to T, chromosome 8 at 85,516,203 bp
  • C to T, chromosome 8 at 104,548,377 bp
  • A to C, chromosome 8 at 105,989,455 bp
  • T to C, chromosome 8 at 111,009,343 bp
  • G to T, chromosome 8 at 122,496,729 bp
  • A to G, chromosome 9 at 22,012,868 bp
  • G to A, chromosome 9 at 27,322,239 bp
  • A to C, chromosome 9 at 31,913,012 bp
  • T to A, chromosome 9 at 58,117,168 bp
  • T to C, chromosome 9 at 102,602,880 bp
  • A to T, chromosome 9 at 106,238,185 bp
  • C to T, chromosome 9 at 106,863,261 bp
  • T to C, chromosome 9 at 107,589,894 bp
  • A to G, chromosome 10 at 79,866,425 bp
  • A to T, chromosome 11 at 3,355,461 bp
  • T to A, chromosome 11 at 8,901,362 bp
  • C to T, chromosome 11 at 23,742,761 bp
  • A to T, chromosome 11 at 73,395,092 bp
  • A to T, chromosome 11 at 101,458,286 bp
  • G to A, chromosome 11 at 103,498,966 bp
  • G to T, chromosome 11 at 115,260,905 bp
  • G to T, chromosome 11 at 120,013,514 bp
  • A to T, chromosome 12 at 25,051,194 bp
  • A to C, chromosome 12 at 51,785,841 bp
  • A to G, chromosome 12 at 79,255,243 bp
  • T to A, chromosome 12 at 110,954,785 bp
  • A to G, chromosome 13 at 81,784,697 bp
  • A to G, chromosome 14 at 8,253,572 bp
  • G to T, chromosome 14 at 12,344,405 bp
  • T to C, chromosome 14 at 30,923,583 bp
  • T to C, chromosome 14 at 33,954,545 bp
  • A to T, chromosome 14 at 34,096,570 bp
  • G to A, chromosome 14 at 52,152,194 bp
  • A to T, chromosome 15 at 3,275,694 bp
  • A to G, chromosome 15 at 82,103,312 bp
  • T to C, chromosome 16 at 59,544,125 bp
  • T to C, chromosome 17 at 27,985,121 bp
  • C to A, chromosome 17 at 30,925,627 bp
  • A to T, chromosome 17 at 34,379,751 bp
  • T to A, chromosome 17 at 36,128,722 bp
  • T to A, chromosome 17 at 37,093,808 bp
  • A to C, chromosome 17 at 46,018,860 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • C to T, chromosome 17 at 56,271,555 bp
  • A to G, chromosome 18 at 10,812,064 bp
  • T to C, chromosome 18 at 15,393,551 bp
  • A to T, chromosome 18 at 20,471,212 bp
  • G to A, chromosome 18 at 53,407,068 bp
  • T to C, chromosome 19 at 9,283,683 bp
  • A to T, chromosome 19 at 28,531,274 bp
  • T to C, chromosome 19 at 56,384,105 bp
  • A to G, chromosome X at 8,331,019 bp
  • A to C, chromosome X at 86,047,134 bp
  • A to T, chromosome X at 89,931,445 bp
  • T to A, chromosome X at 134,318,033 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1982 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039994-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.