Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2017Btlr/Mmmh
Stock Number:
040026-MU
Citation ID:
RRID:MMRRC_040026-MU
Other Names:
R2017 (G1), C57BL/6J-MtgxR2017Btlr
Major Collection:

Strain Information

Edn3
Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13616
HGNC: HGNC:3178
Homologene: 88
Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Rasgrp2
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19395
HGNC: HGNC:9879
Homologene: 4250
Efemp1
Name: epidermal growth factor-containing fibulin-like extracellular matrix protein 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216616
HGNC: HGNC:3218
Homologene: 3028
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Med26
Name: mediator complex subunit 26
Synonyms: 5730493L18Rik, Crsp7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70625
HGNC: HGNC:2376
Homologene: 68417
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53625
Homologene: 4797
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 66,412,799 bp
  • G to T, chromosome 1 at 182,449,015 bp
  • A to T, chromosome 1 at 186,630,765 bp
  • A to G, chromosome 1 at 187,048,453 bp
  • T to C, chromosome 2 at 66,095,198 bp
  • T to C, chromosome 2 at 66,515,321 bp
  • A to G, chromosome 2 at 75,981,457 bp
  • A to G, chromosome 2 at 82,982,732 bp
  • C to T, chromosome 2 at 90,464,614 bp
  • A to G, chromosome 2 at 92,391,034 bp
  • G to A, chromosome 2 at 93,837,996 bp
  • G to T, chromosome 2 at 111,479,187 bp
  • A to G, chromosome 2 at 125,673,201 bp
  • T to A, chromosome 2 at 135,362,420 bp
  • T to C, chromosome 2 at 154,517,807 bp
  • T to C, chromosome 2 at 160,752,449 bp
  • G to A, chromosome 2 at 160,909,610 bp
  • T to C, chromosome 2 at 165,079,026 bp
  • A to C, chromosome 2 at 170,348,161 bp
  • A to G, chromosome 2 at 174,778,662 bp
  • A to G, chromosome 4 at 58,070,568 bp
  • G to A, chromosome 4 at 65,540,941 bp
  • A to T, chromosome 4 at 82,882,883 bp
  • A to G, chromosome 4 at 144,394,674 bp
  • A to G, chromosome 5 at 3,661,752 bp
  • G to A, chromosome 6 at 29,443,797 bp
  • A to T, chromosome 6 at 83,048,977 bp
  • A to C, chromosome 6 at 90,689,930 bp
  • G to T, chromosome 6 at 147,107,793 bp
  • T to C, chromosome 7 at 12,153,343 bp
  • T to C, chromosome 7 at 15,758,882 bp
  • A to T, chromosome 7 at 30,872,780 bp
  • T to C, chromosome 7 at 103,186,930 bp
  • T to A, chromosome 8 at 4,215,205 bp
  • T to C, chromosome 8 at 11,445,086 bp
  • T to C, chromosome 8 at 18,705,731 bp
  • T to C, chromosome 8 at 61,684,765 bp
  • A to G, chromosome 8 at 72,496,947 bp
  • A to G, chromosome 8 at 72,852,197 bp
  • T to C, chromosome 8 at 85,230,744 bp
  • A to G, chromosome 8 at 86,563,988 bp
  • T to C, chromosome 9 at 80,440,667 bp
  • A to G, chromosome 9 at 86,755,512 bp
  • T to A, chromosome 9 at 106,839,088 bp
  • A to G, chromosome 9 at 106,847,923 bp
  • C to T, chromosome 10 at 14,130,757 bp
  • A to G, chromosome 10 at 14,422,662 bp
  • A to T, chromosome 10 at 33,927,464 bp
  • C to T, chromosome 10 at 50,690,211 bp
  • A to G, chromosome 10 at 51,721,604 bp
  • A to G, chromosome 10 at 79,612,989 bp
  • C to T, chromosome 10 at 128,634,157 bp
  • T to C, chromosome 10 at 130,446,713 bp
  • A to T, chromosome 11 at 9,290,619 bp
  • T to C, chromosome 11 at 22,836,621 bp
  • G to T, chromosome 11 at 28,921,613 bp
  • A to G, chromosome 11 at 32,210,471 bp
  • T to C, chromosome 11 at 67,284,611 bp
  • T to A, chromosome 11 at 69,437,070 bp
  • T to A, chromosome 11 at 74,270,333 bp
  • G to T, chromosome 11 at 82,905,547 bp
  • T to C, chromosome 11 at 87,874,337 bp
  • T to A, chromosome 11 at 100,386,341 bp
  • G to A, chromosome 11 at 100,421,673 bp
  • T to A, chromosome 11 at 103,501,125 bp
  • A to G, chromosome 11 at 104,637,962 bp
  • T to A, chromosome 12 at 3,474,487 bp
  • G to A, chromosome 12 at 8,007,751 bp
  • T to A, chromosome 12 at 12,362,361 bp
  • T to C, chromosome 12 at 91,366,464 bp
  • A to T, chromosome 12 at 101,885,360 bp
  • A to T, chromosome 12 at 113,062,457 bp
  • T to C, chromosome 12 at 118,125,728 bp
  • A to T, chromosome 13 at 3,576,770 bp
  • T to C, chromosome 14 at 100,022,637 bp
  • T to C, chromosome 16 at 10,511,676 bp
  • T to A, chromosome 16 at 14,461,204 bp
  • T to A, chromosome 16 at 20,159,181 bp
  • T to C, chromosome 16 at 32,751,303 bp
  • T to C, chromosome 16 at 56,732,806 bp
  • T to C, chromosome 16 at 57,316,278 bp
  • A to T, chromosome 17 at 34,026,213 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 66,957,153 bp
  • T to C, chromosome 18 at 20,266,196 bp
  • T to A, chromosome 18 at 24,111,753 bp
  • A to G, chromosome 18 at 34,313,602 bp
  • T to C, chromosome 18 at 64,540,334 bp
  • T to C, chromosome 19 at 4,111,873 bp
  • T to C, chromosome 19 at 6,413,165 bp
  • T to C, chromosome 19 at 24,824,312 bp
  • T to A, chromosome X at 112,364,561 bp
  • T to C, chromosome X at 134,547,601 bp
  • C to T, chromosome X at 134,596,322 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2017 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040026-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.