Strain Name:
C57BL/6J-MtgxR2017Btlr/Mmmh
Stock Number:
040026-MU
Citation ID:
RRID:MMRRC_040026-MU
Other Names:
R2017 (G1), C57BL/6J-MtgxR2017Btlr
Major Collection:

Strain Information

Edn3
Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13616
HGNC: HGNC:3178
Homologene: 88
Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Rasgrp2
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19395
HGNC: HGNC:9879
Homologene: 4250
Efemp1
Name: epidermal growth factor-containing fibulin-like extracellular matrix protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216616
HGNC: HGNC:3218
Homologene: 3028
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Med26
Name: mediator complex subunit 26
Synonyms: 5730493L18Rik, Crsp7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 70625
HGNC: HGNC:2376
Homologene: 68417
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53625
Homologene: 4797
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 321006
Homologene: 8805
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Asxl2
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75302
Homologene: 10102
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 109181
Homologene: 20897
Cmss1
Name: cms small ribosomal subunit 1
Synonyms: 4930572F24Rik, 1110001A06Rik, 2610528E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66497
VEGA: 16
Homologene: 11979
Plcg1
Name: phospholipase C, gamma 1
Synonyms: Plc-1, Plcg-1, Plc-gamma1, Cded
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18803
HGNC: HGNC:9065
Homologene: 1997
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 209456
Homologene: 3959
Klf12
Name: Kruppel-like transcription factor 12
Synonyms: AP-2rep, B130052C06Rik, 2700063E05Rik, D530033K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16597
VEGA: 14
HGNC: HGNC:6346
Homologene: 21417
Apool
Name: apolipoprotein O-like
Synonyms: 6720473G16Rik, E130106L15Rik, 9430083G14Rik, Micos27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 68117
Homologene: 57144
Cep128
Name: centrosomal protein 128
Synonyms: 5430424K18Rik, 4930534B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75216
Homologene: 35315
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Itgb3
Name: integrin beta 3
Synonyms: platelet glycoprotein IIIa (GP3A), CD61
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16416
HGNC: HGNC:6156
Homologene: 55444
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Ptprm
Name: protein tyrosine phosphatase receptor type M
Synonyms: RPTPmu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19274
VEGA: 17
HGNC: HGNC:9675
Homologene: 37694
Jup
Name: junction plakoglobin
Synonyms: PG, plakoglobin, gamma-catenin, D930025P04Rik, Ctnng
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Map2
Name: microtubule-associated protein 2
Synonyms: MAP-2, G1-397-34, Mtap2, repro4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Palld
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72333
Homologene: 75052
Nle1
Name: notchless homolog 1
Synonyms: notchless, Nle, l11Jus4, l11Jus1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217011
Homologene: 5494
Prss35
Name: protease, serine 35
Synonyms: 6030424L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244954
Homologene: 17734
Galnt3
Name: polypeptide N-acetylgalactosaminyltransferase 3
Synonyms: ppGaNTase-T3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14425
HGNC: HGNC:4125
Homologene: 55827
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Btk
Name: Bruton agammaglobulinemia tyrosine kinase
Synonyms: Bruton's tyrosine kinase, xid, X-linked immune deficiency
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 12229
HGNC: HGNC:1133
Homologene: 30953
Cd22
Name: CD22 antigen
Synonyms: Lyb-8, Lyb8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12483
HGNC: HGNC:1643
Homologene: 31052
Pitpnm1
Name: phosphatidylinositol transfer protein, membrane-associated 1
Synonyms: DRES9, RdgB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18739
HGNC: HGNC:9003
Homologene: 3608
Abca13
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268379
Homologene: 27991
Ciita
Name: class II transactivator
Synonyms: C2ta, Gm9475
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12265
VEGA: 16
HGNC: HGNC:7067
Homologene: 207
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237954
Homologene: 138824
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, Dnahc11, avc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Pgm5
Name: phosphoglucomutase 5
Synonyms: 9530034F03Rik, aciculin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226041
HGNC: HGNC:8908
Homologene: 74881
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64817
Homologene: 23386
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Astn2
Name: astrotactin 2
Synonyms: 1d8, Astnl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56079
Homologene: 77850
Vmn1r78
Name: vomeronasal 1 receptor 78
Synonyms: V1rg7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171242
Homologene: 74316
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Or7c19
Name: olfactory receptor family 7 subfamily C member 19
Synonyms: GA_x6K02T2NUPS-13298842-13299780, MOR141-3, Olfr371
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 258858
Homologene: 65998
Or1p1c
Name: olfactory receptor family 1 subfamily P member 1C
Synonyms: GA_x6K02T2P1NL-4415162-4416133, MOR133-1, Olfr406-ps, Olfr406
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258181
HGNC: HGNC:8222
Impg1
Name: interphotoreceptor matrix proteoglycan 1
Synonyms: IMP150, SPACR, A930015H12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 63859
HGNC: HGNC:6055
Homologene: 1201
Abcc12
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms: MRP9, 4930467B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244562
Homologene: 57211
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20274
Homologene: 2237
Accs
Name: 1-aminocyclopropane-1-carboxylate synthase (non-functional)
Synonyms: 2610203E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329470
Homologene: 75335
Klhl42
Name: kelch-like 42
Synonyms: C230080I20Rik, Klhdc5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232539
Homologene: 45842
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 320995
Homologene: 18318
Ino80c
Name: INO80 complex subunit C
Synonyms: D030070L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225280
Homologene: 45426
Rhbdf1
Name: rhomboid 5 homolog 1
Synonyms: Dist1, Egfr-rs, Dist
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13650
Homologene: 32085
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Ikzf4
Name: IKAROS family zinc finger 4
Synonyms: Eos, A630026H08Rik, Zfpn1a4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22781
Homologene: 69103
Flnc
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Cyria
Name: CYFIP related Rac1 interactor A
Synonyms: 2410157M17Rik, D12Ertd553e, Fam49a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76820
VEGA: 12
Homologene: 12657
Iqsec1
Name: IQ motif and Sec7 domain 1
Synonyms: cI-43, D6Ertd349e, BRAG2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232227
Homologene: 82429
Dsg1c
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 211924
HGNC: HGNC:3048
Zup1
Name: zinc finger containing ubiquitin peptidase 1
Synonyms: 2700019D07Rik, Zufsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 72580
VEGA: 10
Homologene: 12472
Spata17
Name: spermatogenesis associated 17
Synonyms: 4930504I07Rik, 1700065F16Rik, 4930513F16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74717
Homologene: 12551
Large1
Name: LARGE xylosyl- and glucuronyltransferase 1
Synonyms: fg, BPFD#36, froggy, enr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16795
HGNC: HGNC:6511
Homologene: 7810
Tmbim7
Name: transmembrane BAX inhibitor motif containing 7
Synonyms: 4930500J03Rik, 4930403J02Rik, 4930511M11Rik, Lfg5, Tmbim1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75010
Homologene: 81927
Loxl3
Name: lysyl oxidase-like 3
Synonyms: Lor2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16950
Homologene: 56591
Pacs2
Name: phosphofurin acidic cluster sorting protein 2
Synonyms: 6720425G15Rik, Pacs1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217893
VEGA: 12
Homologene: 15016
Mapk8ip1
Name: mitogen-activated protein kinase 8 interacting protein 1
Synonyms: JIP-1, MAPK8IP1, IB1, Prkm8ip, mjip-2a, Skip, Jip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19099
HGNC: HGNC:6882
Homologene: 31314
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215798
Homologene: 10724
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Abcc1
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Synonyms: MRP, Mdrap, Mrp1, Abcc1b, Abcc1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Obox5
Name: oocyte specific homeobox 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 252829
Homologene: 44937
Bcas1
Name: brain enriched myelin associated protein 1
Synonyms: NABC1, 2210416M21Rik, 9030223A09Rik, breast carcinoma amplified sequence 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76960
HGNC: HGNC:974
Homologene: 2714
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 280635
Homologene: 18817
C2cd4c
Name: C2 calcium-dependent domain containing 4C
Synonyms: LOC237397, 4932409I22Rik, Fam148c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237397
VEGA: 10
Homologene: 19012
Vmn2r86
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 625109
Homologene: 129606
Epx
Name: eosinophil peroxidase
Synonyms: EPO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13861
HGNC: HGNC:3423
Homologene: 20144
Prr36
Name: proline rich 36
Synonyms: BC068157
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73072
Homologene: 136398
Fkbp10
Name: FK506 binding protein 10
Synonyms: FKBP65, Fkbp1-rs, Fkbp-rs1, Fkbp6, 65kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14230
Homologene: 7718
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239853
Homologene: 13115
Ift70a1
Name: intraflagellar transport 70A1
Synonyms: 4930506L13Rik, Ttc30a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78802
Homologene: 136638
Or52j3
Name: olfactory receptor family 52 subfamily J member 3
Synonyms: GA_x6K02T2PBJ9-5902266-5903204, MOR0-3P, MOR0-3P, MOR32-13, Olfr1525-ps1, Olfr592
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404317
Homologene: 66215
Eid1
Name: EP300 interacting inhibitor of differentiation 1
Synonyms: 2610002K20Rik, EID-1, ORF12, Cri1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58521
HGNC: HGNC:1191
Homologene: 49376
Hsd17b8
Name: hydroxysteroid 17-beta dehydrogenase 8
Synonyms: Ring2, H-2Ke6, H2-Ke6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14979
HGNC: HGNC:3554
Homologene: 56588
Tgfb2
Name: transforming growth factor, beta 2
Synonyms: Tgf-beta2, Tgfb-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21808
Homologene: 2432
Or4g7
Name: olfactory receptor family 4 subfamily G member 7
Synonyms: GA_x6K02T2Q125-72530279-72531217, MOR245-9, Olfr1288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258395
Homologene: 88360
1700025C18Rik
Name: RIKEN cDNA 1700025C18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72211
Cer1
Name: cerberus 1, DAN family BMP antagonist
Synonyms: Cerberus-like, Cerr1, cer-1, Cerl, Cerl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12622
HGNC: HGNC:1862
Homologene: 3983
Gla
Name: galactosidase, alpha
Synonyms: Ags
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 11605
HGNC: HGNC:4296
Homologene: 90852
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 66,412,799 bp
  • G to T, chromosome 1 at 182,449,015 bp
  • A to T, chromosome 1 at 186,630,765 bp
  • A to G, chromosome 1 at 187,048,453 bp
  • T to C, chromosome 2 at 66,095,198 bp
  • T to C, chromosome 2 at 66,515,321 bp
  • A to G, chromosome 2 at 75,981,457 bp
  • A to G, chromosome 2 at 82,982,732 bp
  • C to T, chromosome 2 at 90,464,614 bp
  • A to G, chromosome 2 at 92,391,034 bp
  • G to A, chromosome 2 at 93,837,996 bp
  • G to T, chromosome 2 at 111,479,187 bp
  • A to G, chromosome 2 at 125,673,201 bp
  • T to A, chromosome 2 at 135,362,420 bp
  • T to C, chromosome 2 at 154,517,807 bp
  • T to C, chromosome 2 at 160,752,449 bp
  • G to A, chromosome 2 at 160,909,610 bp
  • T to C, chromosome 2 at 165,079,026 bp
  • A to C, chromosome 2 at 170,348,161 bp
  • A to G, chromosome 2 at 174,778,662 bp
  • A to G, chromosome 4 at 58,070,568 bp
  • G to A, chromosome 4 at 65,540,941 bp
  • A to T, chromosome 4 at 82,882,883 bp
  • A to G, chromosome 4 at 144,394,674 bp
  • A to G, chromosome 5 at 3,661,752 bp
  • G to A, chromosome 6 at 29,443,797 bp
  • A to T, chromosome 6 at 83,048,977 bp
  • A to C, chromosome 6 at 90,689,930 bp
  • G to T, chromosome 6 at 147,107,793 bp
  • T to C, chromosome 7 at 12,153,343 bp
  • T to C, chromosome 7 at 15,758,882 bp
  • A to T, chromosome 7 at 30,872,780 bp
  • T to C, chromosome 7 at 103,186,930 bp
  • T to A, chromosome 8 at 4,215,205 bp
  • T to C, chromosome 8 at 11,445,086 bp
  • T to C, chromosome 8 at 18,705,731 bp
  • T to C, chromosome 8 at 61,684,765 bp
  • A to G, chromosome 8 at 72,496,947 bp
  • A to G, chromosome 8 at 72,852,197 bp
  • T to C, chromosome 8 at 85,230,744 bp
  • A to G, chromosome 8 at 86,563,988 bp
  • T to C, chromosome 9 at 80,440,667 bp
  • A to G, chromosome 9 at 86,755,512 bp
  • T to A, chromosome 9 at 106,839,088 bp
  • A to G, chromosome 9 at 106,847,923 bp
  • C to T, chromosome 10 at 14,130,757 bp
  • A to G, chromosome 10 at 14,422,662 bp
  • A to T, chromosome 10 at 33,927,464 bp
  • C to T, chromosome 10 at 50,690,211 bp
  • A to G, chromosome 10 at 51,721,604 bp
  • A to G, chromosome 10 at 79,612,989 bp
  • C to T, chromosome 10 at 128,634,157 bp
  • T to C, chromosome 10 at 130,446,713 bp
  • A to T, chromosome 11 at 9,290,619 bp
  • T to C, chromosome 11 at 22,836,621 bp
  • G to T, chromosome 11 at 28,921,613 bp
  • A to G, chromosome 11 at 32,210,471 bp
  • T to C, chromosome 11 at 67,284,611 bp
  • T to A, chromosome 11 at 69,437,070 bp
  • T to A, chromosome 11 at 74,270,333 bp
  • G to T, chromosome 11 at 82,905,547 bp
  • T to C, chromosome 11 at 87,874,337 bp
  • T to A, chromosome 11 at 100,386,341 bp
  • G to A, chromosome 11 at 100,421,673 bp
  • T to A, chromosome 11 at 103,501,125 bp
  • A to G, chromosome 11 at 104,637,962 bp
  • T to A, chromosome 12 at 3,474,487 bp
  • G to A, chromosome 12 at 8,007,751 bp
  • T to A, chromosome 12 at 12,362,361 bp
  • T to C, chromosome 12 at 91,366,464 bp
  • A to T, chromosome 12 at 101,885,360 bp
  • A to T, chromosome 12 at 113,062,457 bp
  • T to C, chromosome 12 at 118,125,728 bp
  • A to T, chromosome 13 at 3,576,770 bp
  • T to C, chromosome 14 at 100,022,637 bp
  • T to C, chromosome 16 at 10,511,676 bp
  • T to A, chromosome 16 at 14,461,204 bp
  • T to A, chromosome 16 at 20,159,181 bp
  • T to C, chromosome 16 at 32,751,303 bp
  • T to C, chromosome 16 at 56,732,806 bp
  • T to C, chromosome 16 at 57,316,278 bp
  • A to T, chromosome 17 at 34,026,213 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 66,957,153 bp
  • T to C, chromosome 18 at 20,266,196 bp
  • T to A, chromosome 18 at 24,111,753 bp
  • A to G, chromosome 18 at 34,313,602 bp
  • T to C, chromosome 18 at 64,540,334 bp
  • T to C, chromosome 19 at 4,111,873 bp
  • T to C, chromosome 19 at 6,413,165 bp
  • T to C, chromosome 19 at 24,824,312 bp
  • T to A, chromosome X at 112,364,561 bp
  • T to C, chromosome X at 134,547,601 bp
  • C to T, chromosome X at 134,596,322 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2017 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040026-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.