Strain Name:
Stock Number:
Citation ID:
Other Names:
R2017 (G1), C57BL/6J-MtgxR2017Btlr
Major Collection:

Gene Information

Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13616
Homologene: 88
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11601
Homologene: 22401
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19395
Homologene: 4250
Name: epidermal growth factor-containing fibulin-like extracellular matrix protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216616
Homologene: 3028
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12396
Homologene: 3733
Name: mediator complex subunit 26
Synonyms: 5730493L18Rik, Crsp7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 70625
Homologene: 68417
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53625
Homologene: 4797
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 321006
Homologene: 8805
Name: YEATS domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75302
Homologene: 10102
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 109181
Homologene: 20897
Name: cms small ribosomal subunit 1
Synonyms: 4930572F24Rik, 1110001A06Rik, 2610528E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66497
VEGA: 16
Homologene: 11979
Name: phospholipase C, gamma 1
Synonyms: Plcg-1, Plc-1, Plc-gamma1, Cded
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18803
Homologene: 1997
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 209456
Homologene: 3959
Name: Kruppel-like factor 12
Synonyms: AP-2rep, B130052C06Rik, 2700063E05Rik, D530033K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16597
VEGA: 14
Homologene: 21417
Name: apolipoprotein O-like
Synonyms: E130106L15Rik, 6720473G16Rik, 9430083G14Rik, Micos27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 68117
Homologene: 57144
Name: centrosomal protein 128
Synonyms: 5430424K18Rik, 4930534B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75216
Homologene: 35315
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Name: protein tyrosine phosphatase, receptor type, J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19271
Homologene: 2130
Name: integrin beta 3
Synonyms: platelet glycoprotein IIIa (GP3A), CD61
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16416
Homologene: 55444
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
Homologene: 328
Name: protein tyrosine phosphatase, receptor type, M
Synonyms: RPTPmu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19274
VEGA: 17
Homologene: 37694
Name: junction plakoglobin
Synonyms: PG, plakoglobin, gamma-catenin, D930025P04Rik, Ctnng
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16480
Homologene: 1680
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 11789
Homologene: 30950
Name: microtubule-associated protein 2
Synonyms: MAP-2, G1-397-34, Mtap2, repro4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17756
Homologene: 1779
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72333
Homologene: 75052
Name: notchless homolog 1
Synonyms: notchless, Nle, l11Jus4, l11Jus1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217011
Homologene: 5494
Name: protease, serine 35
Synonyms: 6030424L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244954
Homologene: 17734
Name: polypeptide N-acetylgalactosaminyltransferase 3
Synonyms: ppGaNTase-T3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14425
Homologene: 55827
Name: ATPase, class I, type 8B, member 1
Synonyms: Ic, FIC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 54670
VEGA: 18
Homologene: 21151
Name: Bruton agammaglobulinemia tyrosine kinase
Synonyms: Bruton's tyrosine kinase, xid, X-linked immune deficiency
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 12229
Homologene: 30953
Name: CD22 antigen
Synonyms: Lyb-8, Lyb8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12483
Homologene: 31052
Name: phosphatidylinositol transfer protein, membrane-associated 1
Synonyms: DRES9, RdgB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18739
Homologene: 3608
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268379
Homologene: 27991
Name: class II transactivator
Synonyms: C2ta, Gm9475
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12265
VEGA: 16
Homologene: 207
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
Homologene: 72110
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237954
Homologene: 138824
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 140474
Homologene: 124469
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1203Clo, b2b1279Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
Homologene: 2801
Name: phosphoglucomutase 5
Synonyms: 9530034F03Rik, aciculin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226041
Homologene: 74881
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64817
Homologene: 23386
Name: PRAME like 13
Synonyms: 4930569K13Rik, Pramef12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77632
Homologene: 135701
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15273
Homologene: 4900
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17885
Homologene: 68256
Name: astrotactin 2
Synonyms: 1d8, Astnl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56079
Homologene: 77850
Name: vomeronasal 1 receptor 78
Synonyms: V1rg7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171242
Homologene: 74316
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Name: olfactory receptor 371
Synonyms: GA_x6K02T2NUPS-13298842-13299780, MOR141-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 258858
Homologene: 65998
Name: olfactory receptor 406
Synonyms: GA_x6K02T2P1NL-4415162-4416133, MOR133-1, Olfr406-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258181
Name: interphotoreceptor matrix proteoglycan 1
Synonyms: SPACR, IMP150, A930015H12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 63859
Homologene: 1201
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms: MRP9, 4930467B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244562
Homologene: 57211
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20274
Homologene: 2237
Name: 1-aminocyclopropane-1-carboxylate synthase (non-functional)
Synonyms: 2610203E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329470
Homologene: 75335
Name: kelch-like 42
Synonyms: C230080I20Rik, Klhdc5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232539
Homologene: 45842
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 320995
Homologene: 18318
Name: INO80 complex subunit C
Synonyms: D030070L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225280
Homologene: 45426
Name: rhomboid 5 homolog 1
Synonyms: Dist1, Egfr-rs, Dist
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13650
Homologene: 32085
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12827
Homologene: 1390
Name: IKAROS family zinc finger 4
Synonyms: Eos, A630026H08Rik, Zfpn1a4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22781
Homologene: 69103
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68794
Homologene: 37481
Name: CYFIP related Rac1 interactor A
Synonyms: 2410157M17Rik, D12Ertd553e, Fam49a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76820
VEGA: 12
Homologene: 12657
Name: IQ motif and Sec7 domain 1
Synonyms: cI-43, D6Ertd349e, BRAG2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232227
Homologene: 82429
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 211924
Name: zinc finger containing ubiquitin peptidase 1
Synonyms: 2700019D07Rik, Zufsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 72580
VEGA: 10
Homologene: 12472
Name: spermatogenesis associated 17
Synonyms: 4930504I07Rik, 1700065F16Rik, 4930513F16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74717
Homologene: 12551
Name: LARGE xylosyl- and glucuronyltransferase 1
Synonyms: fg, BPFD#36, froggy, enr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16795
Homologene: 7810
Name: transmembrane BAX inhibitor motif containing 7
Synonyms: 4930500J03Rik, 4930403J02Rik, 4930511M11Rik, Lfg5, Tmbim1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75010
Homologene: 81927
Name: lysyl oxidase-like 3
Synonyms: Lor2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16950
Homologene: 56591
Name: phosphofurin acidic cluster sorting protein 2
Synonyms: 6720425G15Rik, Pacs1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217893
VEGA: 12
Homologene: 15016
Name: mitogen-activated protein kinase 8 interacting protein 1
Synonyms: JIP-1, MAPK8IP1, IB1, Prkm8ip, mjip-2a, Skip, Jip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19099
Homologene: 31314
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215798
Homologene: 10724
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Synonyms: MRP, Mdrap, Mrp1, Abcc1b, Abcc1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17250
Homologene: 133779
Name: oocyte specific homeobox 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 252829
Homologene: 44937
Name: brain enriched myelin associated protein 1
Synonyms: NABC1, 2210416M21Rik, 9030223A09Rik, breast carcinoma amplified sequence 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76960
Homologene: 2714
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 280635
Homologene: 18817
Name: C2 calcium-dependent domain containing 4C
Synonyms: LOC237397, 4932409I22Rik, Fam148c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237397
VEGA: 10
Homologene: 19012
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 625109
Homologene: 129606
Name: eosinophil peroxidase
Synonyms: EPO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13861
Homologene: 20144
Name: proline rich 36
Synonyms: BC068157
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73072
Homologene: 136398
Name: FK506 binding protein 10
Synonyms: FKBP65, Fkbp1-rs, Fkbp-rs1, Fkbp6, 65kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14230
Homologene: 7718
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239853
Homologene: 13115
Name: tetratricopeptide repeat domain 30A1
Synonyms: 4930506L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78802
Homologene: 136638
Name: olfactory receptor 592
Synonyms: GA_x6K02T2PBJ9-5902266-5903204, MOR0-3P, MOR32-13, MOR0-3P, Olfr1525-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404317
Homologene: 66215
Name: EP300 interacting inhibitor of differentiation 1
Synonyms: 2610002K20Rik, EID-1, ORF12, Cri1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58521
Homologene: 49376
Name: H2-K region expressed gene 6
Synonyms: Ring2, H-2Ke6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14979
Homologene: 56588
Name: transforming growth factor, beta 2
Synonyms: Tgf-beta2, Tgfb-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21808
Homologene: 2432
Name: olfactory receptor 1288
Synonyms: GA_x6K02T2Q125-72530279-72531217, MOR245-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258395
Homologene: 88360
Name: RIKEN cDNA 1700025C18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72211
Name: cerberus 1, DAN family BMP antagonist
Synonyms: Cerberus-like, Cerr1, cer-1, Cerl, Cerl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12622
Homologene: 3983
Name: galactosidase, alpha
Synonyms: Ags
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 11605
Homologene: 90852
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 66,412,799 bp
  • G to T, chromosome 1 at 182,449,015 bp
  • A to T, chromosome 1 at 186,630,765 bp
  • A to G, chromosome 1 at 187,048,453 bp
  • T to C, chromosome 2 at 66,095,198 bp
  • T to C, chromosome 2 at 66,515,321 bp
  • A to G, chromosome 2 at 75,981,457 bp
  • A to G, chromosome 2 at 82,982,732 bp
  • C to T, chromosome 2 at 90,464,614 bp
  • A to G, chromosome 2 at 92,391,034 bp
  • G to A, chromosome 2 at 93,837,996 bp
  • G to T, chromosome 2 at 111,479,187 bp
  • A to G, chromosome 2 at 125,673,201 bp
  • T to A, chromosome 2 at 135,362,420 bp
  • T to C, chromosome 2 at 154,517,807 bp
  • T to C, chromosome 2 at 160,752,449 bp
  • G to A, chromosome 2 at 160,909,610 bp
  • T to C, chromosome 2 at 165,079,026 bp
  • A to C, chromosome 2 at 170,348,161 bp
  • A to G, chromosome 2 at 174,778,662 bp
  • A to G, chromosome 4 at 58,070,568 bp
  • G to A, chromosome 4 at 65,540,941 bp
  • A to T, chromosome 4 at 82,882,883 bp
  • A to G, chromosome 4 at 144,394,674 bp
  • A to G, chromosome 5 at 3,661,752 bp
  • G to A, chromosome 6 at 29,443,797 bp
  • A to T, chromosome 6 at 83,048,977 bp
  • A to C, chromosome 6 at 90,689,930 bp
  • G to T, chromosome 6 at 147,107,793 bp
  • T to C, chromosome 7 at 12,153,343 bp
  • T to C, chromosome 7 at 15,758,882 bp
  • A to T, chromosome 7 at 30,872,780 bp
  • T to C, chromosome 7 at 103,186,930 bp
  • T to A, chromosome 8 at 4,215,205 bp
  • T to C, chromosome 8 at 11,445,086 bp
  • T to C, chromosome 8 at 18,705,731 bp
  • T to C, chromosome 8 at 61,684,765 bp
  • A to G, chromosome 8 at 72,496,947 bp
  • A to G, chromosome 8 at 72,852,197 bp
  • T to C, chromosome 8 at 85,230,744 bp
  • A to G, chromosome 8 at 86,563,988 bp
  • T to C, chromosome 9 at 80,440,667 bp
  • A to G, chromosome 9 at 86,755,512 bp
  • T to A, chromosome 9 at 106,839,088 bp
  • A to G, chromosome 9 at 106,847,923 bp
  • C to T, chromosome 10 at 14,130,757 bp
  • A to G, chromosome 10 at 14,422,662 bp
  • A to T, chromosome 10 at 33,927,464 bp
  • C to T, chromosome 10 at 50,690,211 bp
  • A to G, chromosome 10 at 51,721,604 bp
  • A to G, chromosome 10 at 79,612,989 bp
  • C to T, chromosome 10 at 128,634,157 bp
  • T to C, chromosome 10 at 130,446,713 bp
  • A to T, chromosome 11 at 9,290,619 bp
  • T to C, chromosome 11 at 22,836,621 bp
  • G to T, chromosome 11 at 28,921,613 bp
  • A to G, chromosome 11 at 32,210,471 bp
  • T to C, chromosome 11 at 67,284,611 bp
  • T to A, chromosome 11 at 69,437,070 bp
  • T to A, chromosome 11 at 74,270,333 bp
  • G to T, chromosome 11 at 82,905,547 bp
  • T to C, chromosome 11 at 87,874,337 bp
  • T to A, chromosome 11 at 100,386,341 bp
  • G to A, chromosome 11 at 100,421,673 bp
  • T to A, chromosome 11 at 103,501,125 bp
  • A to G, chromosome 11 at 104,637,962 bp
  • T to A, chromosome 12 at 3,474,487 bp
  • G to A, chromosome 12 at 8,007,751 bp
  • T to A, chromosome 12 at 12,362,361 bp
  • T to C, chromosome 12 at 91,366,464 bp
  • A to T, chromosome 12 at 101,885,360 bp
  • A to T, chromosome 12 at 113,062,457 bp
  • T to C, chromosome 12 at 118,125,728 bp
  • A to T, chromosome 13 at 3,576,770 bp
  • T to C, chromosome 14 at 100,022,637 bp
  • T to C, chromosome 16 at 10,511,676 bp
  • T to A, chromosome 16 at 14,461,204 bp
  • T to A, chromosome 16 at 20,159,181 bp
  • T to C, chromosome 16 at 32,751,303 bp
  • T to C, chromosome 16 at 56,732,806 bp
  • T to C, chromosome 16 at 57,316,278 bp
  • A to T, chromosome 17 at 34,026,213 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 66,957,153 bp
  • T to C, chromosome 18 at 20,266,196 bp
  • T to A, chromosome 18 at 24,111,753 bp
  • A to G, chromosome 18 at 34,313,602 bp
  • T to C, chromosome 18 at 64,540,334 bp
  • T to C, chromosome 19 at 4,111,873 bp
  • T to C, chromosome 19 at 6,413,165 bp
  • T to C, chromosome 19 at 24,824,312 bp
  • T to A, chromosome X at 112,364,561 bp
  • T to C, chromosome X at 134,547,601 bp
  • C to T, chromosome X at 134,596,322 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2017 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040026-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.