Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2056Btlr/Mmmh
Stock Number:
040061-MU
Citation ID:
RRID:MMRRC_040061-MU
Other Names:
R2056 (G1), C57BL/6J-MtgxR2056Btlr
Major Collection:

Strain Information

Gpd2
Name: glycerol phosphate dehydrogenase 2, mitochondrial
Synonyms: Gdm1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14571
HGNC: HGNC:4456
Homologene: 352
Mcoln3
Name: mucolipin 3
Synonyms: varitint-waddler, Va, 6720490O21Rik, TRPML3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171166
Homologene: 10118
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Dscaml1
Name: DS cell adhesion molecule like 1
Synonyms: 4930435C18Rik, 4921507G06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114873
VEGA: 9
Homologene: 79549
Senp2
Name: SUMO/sentrin specific peptidase 2
Synonyms: 4930538C18Rik, 2310007L05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75826
VEGA: 16
Homologene: 11005
Kif11
Name: kinesin family member 11
Synonyms: Eg5, Knsl1, Kifl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16551
VEGA: 19
HGNC: HGNC:6388
Homologene: 3322
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Gstcd
Name: glutathione S-transferase, C-terminal domain containing
Synonyms: 4933434L15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67553
Homologene: 11693
Erbin
Name: Erbb2 interacting protein
Synonyms: 1700028E05Rik, Erbin, Erbb2ip
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 59079
Homologene: 41282
Phc1
Name: polyhomeotic 1
Synonyms: Rae-28, Mph1, rae28, Edr1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13619
HGNC: HGNC:3182
Homologene: 107079
Gsk3b
Name: glycogen synthase kinase 3 beta
Synonyms: GSK-3beta, GSK-3, 8430431H08Rik, 7330414F15Rik, GSK3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56637
HGNC: HGNC:4617
Homologene: 55629
Abcg2
Name: ATP binding cassette subfamily G member 2 (Junior blood group)
Synonyms: Bcrp, 4930430M16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26357
HGNC: HGNC:74
Homologene: 55852
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Brap
Name: BRCA1 associated protein
Synonyms: 3010002G07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72399
HGNC: HGNC:1099
Homologene: 4926
Dis3
Name: DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms: 2810028N01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72662
VEGA: 14
Homologene: 6910
Fbxo45
Name: F-box protein 45
Synonyms: 2610017J04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268882
Homologene: 14713
Lrrfip1
Name: leucine rich repeat (in FLII) interacting protein 1
Synonyms: FLAP (FLI LRR associated protein), Fliiap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16978
HGNC: HGNC:6702
Homologene: 48301
Fzd7
Name: frizzled class receptor 7
Synonyms: Fz7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14369
HGNC: HGNC:4045
Homologene: 20751
Gucy1a1
Name: guanylate cyclase 1, soluble, alpha 1
Synonyms: alpha 1 sGC, 1200016O07Rik, sGC-alpha1, Gucy1a3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 60596
HGNC: HGNC:4685
Homologene: 37360
Slc49a4
Name: solute carrier family 49 member 4
Synonyms: RCC4, Dirc2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224132
Homologene: 13137
Il7
Name: interleukin 7
Synonyms: Il-7, hlb368, A630026I06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16196
HGNC: HGNC:6023
Homologene: 680
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Lmbr1
Name: limb region 1
Synonyms: 1110048D14Rik, C79130
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56873
Homologene: 49706
Alas1
Name: aminolevulinic acid synthase 1
Synonyms: 5-aminolevulinate synthase, succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11655
HGNC: HGNC:396
Homologene: 55478
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Kif13a
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Mis18bp1
Name: MIS18 binding protein 1
Synonyms: C79407
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217653
Homologene: 10147
Scn2b
Name: sodium channel, voltage-gated, type II, beta
Synonyms: LOC214238, 2810451E09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72821
VEGA: 9
Homologene: 3373
Rerg
Name: RAS-like, estrogen-regulated, growth-inhibitor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232441
Homologene: 50026
Mtcl2
Name: microtubule crosslinking factor 2
Synonyms: D430036N24Rik, 9830001H06Rik, Soga1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320706
Homologene: 52382
Atp2b4
Name: ATPase, Ca++ transporting, plasma membrane 4
Synonyms: PMCA4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381290
HGNC: HGNC:817
Homologene: 48034
Frmd4b
Name: FERM domain containing 4B
Synonyms: 6030440G05Rik, GRSP1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232288
Homologene: 14916
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Ccser1
Name: coiled-coil serine rich 1
Synonyms: 6230405M12Rik, C130092O11Rik, Fam190a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232035
Homologene: 28086
Kng2
Name: kininogen 2
Synonyms: Kininogen-II
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385643
HGNC: HGNC:6383
Homologene: 88343
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Or14c40
Name: olfactory receptor family 14 subfamily C member 40
Synonyms: GA_x6K02T2NHDJ-9457744-9456734, MOR221-3, Olfr293
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257906
Homologene: 79385
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Kremen2
Name: kringle containing transmembrane protein 2
Synonyms: 2900054E04Rik, Krm2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73016
VEGA: 17
Homologene: 65132
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 632671
Nos1ap
Name: nitric oxide synthase 1 (neuronal) adaptor protein
Synonyms: 6330408P19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70729
Homologene: 135990
Cyp2d10
Name: cytochrome P450, family 2, subfamily d, polypeptide 10
Synonyms: Cyp2d, P450-2D
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13101
VEGA: 15
Homologene: 86099
Psd2
Name: pleckstrin and Sec7 domain containing 2
Synonyms: 6330404E20Rik, EFA6C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74002
Homologene: 12522
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Tubb1
Name: tubulin, beta 1 class VI
Synonyms: 2810484G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545486
Homologene: 69474
Sap30
Name: sin3 associated polypeptide
Synonyms: 30kDa
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 60406
Homologene: 2869
Il12b
Name: interleukin 12b
Synonyms: Il-12p40, IL-12 p40, Il-12b, IL-23 subunit p40
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16160
HGNC: HGNC:5970
Homologene: 1648
Mamdc4
Name: MAM domain containing 4
Synonyms: LOC381352
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381352
Homologene: 17102
Mmrn1
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70945
HGNC: HGNC:7178
Homologene: 49134
Mast1
Name: microtubule associated serine/threonine kinase 1
Synonyms: 9430008B02Rik, SAST170, SAST
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56527
Homologene: 10543
Ankmy1
Name: ankyrin repeat and MYND domain containing 1
Synonyms: 4930483I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241158
Homologene: 9561
Itih3
Name: inter-alpha trypsin inhibitor, heavy chain 3
Synonyms: Intin3, Itih-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16426
HGNC: HGNC:6168
Homologene: 1669
Tgm4
Name: transglutaminase 4 (prostate)
Synonyms: experimental autoimmune prostatitis antigen 1, Eapa1, 9530008N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331046
Homologene: 20689
Adh1
Name: alcohol dehydrogenase 1 (class I)
Synonyms: ADH-AA, class I alcohol dehydrogenase, Adh-1-t, Adh-1t, Adh-1, Adh1-t, Adh1-e, Adh1tl, Adh-1e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11522
Homologene: 73888
Cd84
Name: CD84 antigen
Synonyms: CDw84, SLAMF5, A130013D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12523
HGNC: HGNC:1704
Homologene: 48249
Spmip4
Name: sperm microtubule inner protein 4
Synonyms: 4921507P07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70821
Homologene: 69433
Tmod2
Name: tropomodulin 2
Synonyms: NTMOD, N-Tmod, neural tropomodulin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50876
VEGA: 9
Homologene: 22817
Arhgap18
Name: Rho GTPase activating protein 18
Synonyms: 4833419J07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73910
Homologene: 14135
4921506M07Rik
Name: RIKEN cDNA 4921506M07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Gpr153
Name: G protein-coupled receptor 153
Synonyms: 1110065N12Rik, PGR1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100129
Homologene: 18662
Psmc3
Name: proteasome (prosome, macropain) 26S subunit, ATPase 3
Synonyms: Tat binding protein 1, TBP-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19182
HGNC: HGNC:9549
Homologene: 2097
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Mab21l3
Name: mab-21-like 3
Synonyms: BC037703
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242125
Homologene: 17564
Tlcd4
Name: TLC domain containing 4
Synonyms: C730036B01Rik, 4930577M16Rik, Tmem56
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99887
Homologene: 45107
Or3a4
Name: olfactory receptor family 3 subfamily A member 4
Synonyms: GA_x6K02T2P1NL-4211516-4210581, MOR255-1, Olfr399
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259006
Homologene: 27325
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Or4p8
Name: olfactory receptor family 4 subfamily P member 8
Synonyms: GA_x6K02T2Q125-50372411-50371485, MOR225-4, Olfr1208
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258774
Homologene: 74190
Tmem176b
Name: transmembrane protein 176B
Synonyms: Clast1, Lr8, 1810009M01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 65963
Homologene: 8521
Sgpp2
Name: sphingosine-1-phosphate phosphatase 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 433323
Homologene: 51848
Cmtm4
Name: CKLF-like MARVEL transmembrane domain containing 4
Synonyms: Cklfsf4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 97487
Homologene: 45211
2700073G19Rik
Name: RIKEN cDNA 2700073G19 gene
Synonyms: neural regeneration protein, Npr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 654309
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 59,484,202 bp
  • A to G, chromosome 1 at 66,640,552 bp
  • T to A, chromosome 1 at 78,416,951 bp
  • A to G, chromosome 1 at 91,115,817 bp
  • T to C, chromosome 1 at 92,881,831 bp
  • A to G, chromosome 1 at 94,022,450 bp
  • T to C, chromosome 1 at 107,523,813 bp
  • G to T, chromosome 1 at 133,726,537 bp
  • T to A, chromosome 1 at 134,613,214 bp
  • G to A, chromosome 1 at 170,327,646 bp
  • A to G, chromosome 1 at 171,872,750 bp
  • T to C, chromosome 2 at 25,564,168 bp
  • T to C, chromosome 2 at 29,810,941 bp
  • T to A, chromosome 2 at 52,093,576 bp
  • T to A, chromosome 2 at 57,339,013 bp
  • T to C, chromosome 2 at 76,785,538 bp
  • A to G, chromosome 2 at 88,896,761 bp
  • T to C, chromosome 2 at 91,058,088 bp
  • G to A, chromosome 2 at 154,535,157 bp
  • C to T, chromosome 2 at 157,022,827 bp
  • C to T, chromosome 2 at 174,455,654 bp
  • A to T, chromosome 3 at 7,573,915 bp
  • T to A, chromosome 3 at 38,891,170 bp
  • A to G, chromosome 3 at 82,109,285 bp
  • C to A, chromosome 3 at 101,815,153 bp
  • T to G, chromosome 3 at 121,207,421 bp
  • T to C, chromosome 3 at 123,671,885 bp
  • T to C, chromosome 3 at 133,082,053 bp
  • A to G, chromosome 3 at 138,286,915 bp
  • A to G, chromosome 3 at 146,128,224 bp
  • A to G, chromosome 4 at 45,932,477 bp
  • G to A, chromosome 4 at 85,049,674 bp
  • A to T, chromosome 4 at 152,282,844 bp
  • G to A, chromosome 5 at 29,233,094 bp
  • A to T, chromosome 5 at 87,671,528 bp
  • G to A, chromosome 5 at 121,663,466 bp
  • A to T, chromosome 5 at 151,584,695 bp
  • G to A, chromosome 6 at 48,836,333 bp
  • T to C, chromosome 6 at 50,573,745 bp
  • T to C, chromosome 6 at 58,690,540 bp
  • C to T, chromosome 6 at 60,944,805 bp
  • T to A, chromosome 6 at 61,422,952 bp
  • C to T, chromosome 6 at 97,412,487 bp
  • T to C, chromosome 6 at 122,333,340 bp
  • G to A, chromosome 6 at 137,057,880 bp
  • A to T, chromosome 7 at 86,664,383 bp
  • G to A, chromosome 7 at 131,106,170 bp
  • A to G, chromosome 7 at 141,792,035 bp
  • A to G, chromosome 7 at 144,648,052 bp
  • T to C, chromosome 8 at 57,487,248 bp
  • T to C, chromosome 8 at 71,359,690 bp
  • A to G, chromosome 8 at 84,920,366 bp
  • A to C, chromosome 8 at 104,355,288 bp
  • G to T, chromosome 8 at 109,562,720 bp
  • T to C, chromosome 9 at 45,125,517 bp
  • A to G, chromosome 9 at 45,750,132 bp
  • T to C, chromosome 9 at 75,577,242 bp
  • T to C, chromosome 9 at 106,241,290 bp
  • T to C, chromosome 9 at 123,061,770 bp
  • C to T, chromosome 10 at 26,854,908 bp
  • A to C, chromosome 11 at 44,407,900 bp
  • A to T, chromosome 11 at 74,053,993 bp
  • G to T, chromosome 11 at 100,191,495 bp
  • T to A, chromosome 12 at 57,737,693 bp
  • A to C, chromosome 12 at 65,138,806 bp
  • C to T, chromosome 12 at 87,443,750 bp
  • T to A, chromosome 12 at 112,785,006 bp
  • A to G, chromosome 13 at 46,848,391 bp
  • T to A, chromosome 13 at 92,790,879 bp
  • A to G, chromosome 13 at 103,830,316 bp
  • A to C, chromosome 14 at 30,909,524 bp
  • A to T, chromosome 14 at 99,098,815 bp
  • T to A, chromosome 15 at 82,403,814 bp
  • A to G, chromosome 16 at 15,727,605 bp
  • C to T, chromosome 16 at 22,014,199 bp
  • TATGACCATGACCATGACCATGACCATGACCATGACCAT to TATGACCATGACCATGACCATGACCATGACCAT, chromosome 16 at 22,987,953 bp
  • G to T, chromosome 16 at 32,238,528 bp
  • A to G, chromosome 16 at 35,733,922 bp
  • T to A, chromosome 16 at 38,187,909 bp
  • T to C, chromosome 17 at 23,742,717 bp
  • T to C, chromosome 17 at 46,543,372 bp
  • A to G, chromosome 18 at 34,316,428 bp
  • A to G, chromosome 18 at 36,006,691 bp
  • A to G, chromosome 19 at 37,402,212 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2056 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040061-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.