Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2069Btlr/Mmmh
Stock Number:
040074-MU
Citation ID:
RRID:MMRRC_040074-MU
Other Names:
R2069 (G1), C57BL/6J-MtgxR2069Btlr
Major Collection:

Strain Information

Trim32
Name: tripartite motif-containing 32
Synonyms: 3f3, 1810045E12Rik, Zfp117, BBS11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69807
Homologene: 36327
Nfib
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Ssc4d
Name: scavenger receptor cysteine rich family, 4 domains
Synonyms: C330016E03Rik, Srcrb4d
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109267
Homologene: 34137
Tlk2
Name: tousled-like kinase 2 (Arabidopsis)
Synonyms: protein kinase U-alpha, PKUalpha, 4933403M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 24086
Homologene: 4993
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,486,756 bp
  • A to G, chromosome 1 at 85,681,142 bp
  • G to A, chromosome 1 at 100,358,725 bp
  • A to T, chromosome 1 at 110,138,159 bp
  • T to A, chromosome 1 at 156,620,827 bp
  • T to C, chromosome 2 at 76,726,848 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • T to G, chromosome 2 at 90,758,372 bp
  • A to G, chromosome 2 at 111,369,095 bp
  • T to C, chromosome 2 at 122,287,108 bp
  • A to T, chromosome 2 at 122,333,062 bp
  • A to G, chromosome 2 at 163,339,685 bp
  • A to G, chromosome 2 at 166,941,492 bp
  • G to T, chromosome 2 at 181,199,772 bp
  • A to T, chromosome 3 at 64,556,098 bp
  • A to T, chromosome 3 at 75,078,412 bp
  • G to A, chromosome 3 at 106,219,455 bp
  • A to G, chromosome 3 at 129,858,804 bp
  • C to T, chromosome 4 at 25,269,036 bp
  • T to A, chromosome 4 at 48,158,870 bp
  • T to A, chromosome 4 at 65,614,776 bp
  • A to C, chromosome 4 at 82,498,615 bp
  • A to G, chromosome 4 at 100,990,844 bp
  • A to G, chromosome 4 at 113,238,132 bp
  • T to G, chromosome 4 at 134,201,941 bp
  • T to A, chromosome 4 at 139,479,540 bp
  • A to T, chromosome 4 at 155,812,481 bp
  • C to A, chromosome 4 at 156,241,450 bp
  • T to C, chromosome 5 at 21,226,839 bp
  • T to C, chromosome 5 at 114,874,280 bp
  • A to G, chromosome 5 at 115,545,667 bp
  • A to G, chromosome 5 at 135,107,005 bp
  • A to C, chromosome 5 at 135,970,317 bp
  • A to T, chromosome 5 at 142,766,087 bp
  • C to T, chromosome 5 at 149,709,380 bp
  • T to A, chromosome 6 at 56,736,435 bp
  • T to A, chromosome 6 at 124,224,483 bp
  • T to C, chromosome 7 at 16,945,789 bp
  • A to T, chromosome 7 at 24,778,372 bp
  • A to G, chromosome 7 at 27,257,377 bp
  • A to G, chromosome 7 at 42,300,001 bp
  • A to T, chromosome 7 at 106,956,287 bp
  • A to T, chromosome 7 at 107,074,619 bp
  • G to T, chromosome 7 at 114,804,593 bp
  • T to C, chromosome 8 at 69,799,773 bp
  • C to A, chromosome 8 at 94,243,739 bp
  • G to A, chromosome 8 at 95,557,296 bp
  • A to T, chromosome 8 at 109,532,103 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • C to T, chromosome 9 at 3,582,697 bp
  • C to T, chromosome 9 at 9,035,600 bp
  • T to A, chromosome 9 at 15,726,980 bp
  • A to T, chromosome 9 at 20,967,494 bp
  • G to A, chromosome 9 at 41,043,573 bp
  • T to C, chromosome 9 at 44,948,099 bp
  • A to T, chromosome 9 at 56,258,759 bp
  • G to A, chromosome 9 at 65,278,090 bp
  • T to C, chromosome 9 at 123,779,364 bp
  • C to T, chromosome 10 at 20,959,996 bp
  • T to C, chromosome 10 at 78,052,732 bp
  • A to G, chromosome 10 at 130,126,205 bp
  • T to C, chromosome 11 at 60,950,027 bp
  • T to C, chromosome 11 at 67,246,366 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • A to T, chromosome 11 at 77,172,321 bp
  • A to T, chromosome 11 at 94,364,417 bp
  • A to C, chromosome 11 at 94,549,125 bp
  • A to G, chromosome 11 at 99,978,612 bp
  • A to T, chromosome 11 at 105,240,440 bp
  • T to C, chromosome 12 at 24,951,443 bp
  • T to A, chromosome 12 at 24,987,006 bp
  • G to A, chromosome 12 at 66,568,917 bp
  • G to A, chromosome 12 at 78,877,185 bp
  • T to A, chromosome 12 at 81,631,796 bp
  • A to C, chromosome 12 at 84,793,733 bp
  • A to G, chromosome 12 at 100,142,232 bp
  • C to T, chromosome 13 at 42,183,786 bp
  • A to T, chromosome 13 at 55,542,998 bp
  • T to A, chromosome 13 at 62,854,061 bp
  • T to C, chromosome 13 at 100,050,988 bp
  • T to A, chromosome 13 at 104,236,176 bp
  • T to C, chromosome 14 at 41,174,462 bp
  • T to A, chromosome 14 at 50,736,576 bp
  • G to T, chromosome 15 at 4,092,525 bp
  • G to A, chromosome 15 at 28,312,388 bp
  • A to G, chromosome 15 at 76,188,926 bp
  • A to T, chromosome 15 at 81,792,328 bp
  • T to A, chromosome 15 at 85,821,231 bp
  • G to T, chromosome 15 at 85,838,788 bp
  • C to T, chromosome 15 at 96,362,590 bp
  • A to C, chromosome 15 at 102,118,181 bp
  • A to G, chromosome 16 at 4,068,336 bp
  • A to G, chromosome 16 at 95,361,078 bp
  • T to C, chromosome 17 at 15,742,294 bp
  • T to A, chromosome 17 at 25,826,282 bp
  • T to C, chromosome 17 at 33,136,760 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to T, chromosome 17 at 43,037,938 bp
  • A to G, chromosome 17 at 44,735,342 bp
  • T to C, chromosome 18 at 34,614,479 bp
  • C to A, chromosome 19 at 6,342,738 bp
  • T to C, chromosome 19 at 7,612,638 bp
  • A to G, chromosome X at 6,316,021 bp
  • T to C, chromosome X at 48,401,917 bp
  • T to A, chromosome X at 66,654,629 bp
  • C to A, chromosome X at 75,000,095 bp
  • A to G, chromosome X at 107,103,253 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2069 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040074-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.