Strain Name:
C57BL/6J-MtgxR2069Btlr/Mmmh
Stock Number:
040074-MU
Citation ID:
RRID:MMRRC_040074-MU
Other Names:
R2069 (G1), C57BL/6J-MtgxR2069Btlr
Major Collection:

Gene Information

Trim32
Name: tripartite motif-containing 32
Synonyms: Zfp117, 1810045E12Rik, 3f3, BBS11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 69807
Homologene: 36327
Pxn
Name: paxillin
Synonyms: Pax
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 19303
HGNC: HGNC:9718
Homologene: 37697
Nfib
Name: nuclear factor I/B
Synonyms: E030026I10Rik, 6720429L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Ssc4d
Name: scavenger receptor cysteine rich family, 4 domains
Synonyms: C330016E03Rik, Srcrb4d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 109267
Homologene: 34137
Tlk2
Name: tousled-like kinase 2 (Arabidopsis)
Synonyms: PKUalpha, 4933403M19Rik, protein kinase U-alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 24086
Homologene: 4993
Abl2
Name: v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)
Synonyms: Abll, Arg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
S1pr2
Name: sphingosine-1-phosphate receptor 2
Synonyms: LPb2, S1P2, 1100001A16Rik, Edg5, Gpcr13, H218
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 14739
VEGA: 9
HGNC: HGNC:3169
Homologene: 3118
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 71805
Homologene: 40971
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 20286
VEGA: 15
Homologene: 9735
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 55935
Homologene: 9087
Cse1l
Name: chromosome segregation 1-like (S. cerevisiae)
Synonyms: Capts, Cas, Xpo2, 2610100P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 110750
HGNC: HGNC:2431
Homologene: 1006
Arid2
Name: AT rich interactive domain 2 (ARID, RFX-like)
Synonyms: zipzap/p200, 4432409D24Rik, 1700124K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 77044
Homologene: 14601
Fam193b
Name: family with sequence similarity 193, member B
Synonyms: IRIZIO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 212483
VEGA: 13
Homologene: 130095
Ufl1
Name: UFM1 specific ligase 1
Synonyms: 1810074P20Rik, Rcad, Maxer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 67490
Homologene: 9093
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: B130055N23Rik, TFIIIB90, TAF3B1, Tfnr, G630013P12Rik, TFIIIB150, TFC5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 544971
Homologene: 34582
Atp13a1
Name: ATPase type 13A1
Synonyms: catp, Cgi152, Atp13a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 170759
VEGA: 8
Homologene: 5791
Arhgap42
Name: Rho GTPase activating protein 42
Synonyms: 9030420J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 71544
Homologene: 28446
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: DR6, Death receptor 6, TR7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 94185
VEGA: 17
Homologene: 8696
Ahi1
Name: Abelson helper integration site 1
Synonyms: 1700015F03Rik, Ahi-1, Jouberin, D10Bwg0629e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 52906
VEGA: 10
Homologene: 9762
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: mNudel, 2600006O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 83431
Homologene: 32567
Map2k3
Name: mitogen-activated protein kinase kinase 3
Synonyms: Prkmk3, MKK3, MAP kinase kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 26397
HGNC: HGNC:6843
Homologene: 56430
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: p600, A930005E13Rik, 1810009A16Rik, LOC381562, D930005K06Rik, Zubr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 69116
Homologene: 10804
Plec
Name: plectin
Synonyms: Plec1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18810
HGNC: HGNC:9069
Homologene: 384
Dnmt3l
Name: DNA (cytosine-5-)-methyltransferase 3-like
Synonyms: D6Ertd14e, ecat7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 54427
HGNC: HGNC:2980
Homologene: 8362
Runx2
Name: runt related transcription factor 2
Synonyms: Pebpa2a, SL3-3 enhancer factor 1, polyomavirus enhancer binding factor 2 (PEBP2), Osf2, Cbfa1, PEBP2aA, AML3, PEBP2 alpha A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 12393
Homologene: 68389
Eif2s1
Name: eukaryotic translation initiation factor 2, subunit 1 alpha
Synonyms: eIF2alpha, Eif2a, 0910001O23Rik, 2410026C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 13665
HGNC: HGNC:3265
Homologene: 3020
Trap1
Name: TNF receptor-associated protein 1
Synonyms: 2410002K23Rik, HSP75
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 68015
Homologene: 9457
Brd8
Name: bromodomain containing 8
Synonyms: SMAP, 2610007E11Rik, 4432404P07Rik, p120
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 78656
Homologene: 41790
Cenpk
Name: centromere protein K
Synonyms: B130045K24Rik, Solt, C530004N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 60411
VEGA: 13
Homologene: 11035
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, C230081A13Rik, NKF3 kinase family member
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 244895
Homologene: 18259
Cachd1
Name: cache domain containing 1
Synonyms: B430218L07Rik, Vwcd1, 1190007F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 320508
Homologene: 10854
Spryd3
Name: SPRY domain containing 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223918
Homologene: 13138
Nrde2
Name: nrde-2 necessary for RNA interference, domain containing
Synonyms: BC002230, 6720454P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 217827
VEGA: 12
Homologene: 41213
Cfi
Name: complement component factor i
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12630
HGNC: HGNC:5394
Homologene: 171
Cilp
Name: cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms: C130036G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 214425
HGNC: HGNC:1980
Homologene: 2679
P2ry10
Name: purinergic receptor P2Y, G-protein coupled 10
Synonyms: P2Y10, 5830408N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 78826
Homologene: 8717
Insc
Name: INSC spindle orientation adaptor protein
Synonyms: 3830422K02Rik, Inscuteable
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233752
Homologene: 78662
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 78249
Homologene: 51953
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b1537Clo, b2b1565Clo, b2b3491Clo, b2b1154Clo, Mdnah5, Dnahc5, b2b1134Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 77480
VEGA: 12
Homologene: 14254
Mlxipl
Name: MLX interacting protein-like
Synonyms: bHLHd14, WS-bHLH, Wbscr14, ChREBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 58805
Homologene: 32507
Avl9
Name: AVL9 cell migration associated
Synonyms: 5830411G16Rik, D730049P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 78937
Homologene: 62425
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Vmn2r6
Name: vomeronasal 2, receptor 6
Synonyms: EG620718, EG667069
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 667069
Homologene: 129754
Gsap
Name: gamma-secretase activating protein
Synonyms: A530088I07Rik, Pion
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 212167
Homologene: 45504
Wdr24
Name: WD repeat domain 24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 268933
Homologene: 6870
Fbp2
Name: fructose bisphosphatase 2
Synonyms: FBPase muscle, Fbp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 14120
VEGA: 13
HGNC: HGNC:3607
Homologene: 55784
Pmfbp1
Name: polyamine modulated factor 1 binding protein 1
Synonyms: F77, 1700016D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 56523
Homologene: 23182
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: Gprc2a-rs2, EG637873, Casr-rs2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 637873
Homologene: 129683
Cdh7
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Ceacam10
Name: carcinoembryonic antigen-related cell adhesion molecule 10
Synonyms: Bgp3, Cea10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 26366
Ttc38
Name: tetratricopeptide repeat domain 38
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 239570
Homologene: 41208
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Duox1
Name: dual oxidase 1
Synonyms: THOX1, 9930101G15Rik, NOXEF1, LNOX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Duox2
Name: dual oxidase 2
Synonyms: A430065P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 214593
Homologene: 9689
Morc2b
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 240069
Homologene: 18615
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230622
Homologene: 135888
Olfr714
Name: olfactory receptor 714
Synonyms: GA_x6K02T2PBJ9-9453401-9454354, MOR263-2, P4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 259035
HGNC: HGNC:8161
Homologene: 72055
Coq8b
Name: coenzyme Q8B
Synonyms: Adck4, 0610012P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 76889
Homologene: 86731
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Pnmal2
Name: PNMA-like 2
Synonyms: EG434128
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 434128
Homologene: 35491
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MYH-2B, Minmus, Minimsc, Myhsf, MM, MyHC-IIb, MHC2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Olfr1283
Name: olfactory receptor 1283
Synonyms: MOR248-19, GA_x6K02T2Q125-72420217-72421134
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228443
Homologene: 133657
Gucy1a2
Name: guanylate cyclase 1, soluble, alpha 2
Synonyms: A230060L24Rik, 6330407I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 234889
HGNC: HGNC:4684
Homologene: 47953
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: 6720489L24Rik, Adp, Mdga2, 9330209L04Rik, Tg(Prnp-PFN1*G118V)838Kiaei, Mamdc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 320772
Homologene: 45659
Sp100
Name: nuclear antigen Sp100
Synonyms: A430075G10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20684
Homologene: 86761
Ptk6
Name: PTK6 protein tyrosine kinase 6
Synonyms: Tksk, Sik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20459
HGNC: HGNC:9617
Homologene: 68494
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232367
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: Zfp469, EG381742
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231861
Homologene: 45603
Olfr749
Name: olfactory receptor 749
Synonyms: MOR106-1, GA_x6K02T2PMLR-6484046-6483105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 56858
Homologene: 10652
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: Caspr5-2, C230078M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241175
Homologene: 104295
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 213234
Homologene: 11661
B3glct
Name: beta-3-glucosyltransferase
Synonyms: B3galtl, LOC381694
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 381694
Homologene: 14978
Abcc3
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Synonyms: MRP3, 1700019L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Ube4a
Name: ubiquitination factor E4A
Synonyms: 4732444G18Rik, UFD2b, 9930123J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 140630
Homologene: 3517
Rsad1
Name: radical S-adenosyl methionine domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237926
Homologene: 41252
Efcab5
Name: EF-hand calcium binding domain 5
Synonyms: 4930563A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 319634
Homologene: 63366
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98733
Capn9
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Ccr9
Name: chemokine (C-C motif) receptor 9
Synonyms: GPR-9-6, Cmkbr10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12769
HGNC: HGNC:1610
Homologene: 22546
Plaat5
Name: phospholipase A and acyltransferase 5
Synonyms: Hrasls5, 1700086E08Rik, iNAT, 1700055A14Rik, 4921526K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 66727
Homologene: 12019
Olfr1240
Name: olfactory receptor 1240
Synonyms: MOR231-8, GA_x6K02T2Q125-50883183-50882239
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258804
Homologene: 121591
Slc36a4
Name: solute carrier family 36 (proton/amino acid symporter), member 4
Synonyms: PAT4, 6330573I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 234967
Homologene: 56300
Gm7534
Name: predicted gene 7534
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 665186
Homologene: 104039
Ttc9
Name: tetratricopeptide repeat domain 9
Synonyms: 1700029M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 69480
VEGA: 12
Homologene: 52649
Erg
Name: ETS transcription factor
Synonyms: D030036I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 13876
HGNC: HGNC:3446
Homologene: 15848
4930519G04Rik
Name: RIKEN cDNA 4930519G04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 67593
Homologene: 87032
Ubash3b
Name: ubiquitin associated and SH3 domain containing, B
Synonyms: TULA-2, 2810457I06Rik, Sts-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 72828
Homologene: 13152
Bcorl1
Name: BCL6 co-repressor-like 1
Synonyms: 6720425J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 320376
Homologene: 41458
Map4k2
Name: mitogen-activated protein kinase kinase kinase kinase 2
Synonyms: BL44, Rab8ip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 26412
HGNC: HGNC:6864
Homologene: 3370
Olfr824
Name: olfactory receptor 824
Synonyms: GA_x6K02T2PULF-11797746-11796799, MOR210-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 258669
Homologene: 45026
Gab3
Name: growth factor receptor bound protein 2-associated protein 3
Synonyms: 5930433H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 210710
Homologene: 15417
Mboat2
Name: membrane bound O-acyltransferase domain containing 2
Synonyms: 2810049G06Rik, Oact2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 67216
VEGA: 12
Homologene: 6971
Oxct1
Name: 3-oxoacid CoA transferase 1
Synonyms: 2610008O03Rik, Scot-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 67041
HGNC: HGNC:8527
Homologene: 377
Stx17
Name: syntaxin 17
Synonyms: 6330411F21Rik, 4833418L03Rik, 9030425C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 67727
Homologene: 9917
Ccdc113
Name: coiled-coil domain containing 113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244608
Homologene: 40927
Chil4
Name: chitinase-like 4
Synonyms: Ym2, Chi3l4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 104183
Homologene: 74931
Sftpd
Name: surfactant associated protein D
Synonyms: Sftp4, SP-D, Sfpd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 20390
VEGA: 14
Homologene: 2272
Jph2
Name: junctophilin 2
Synonyms: 1110002E14Rik, JP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 59091
Homologene: 10714
Olfr6
Name: olfactory receptor 6
Synonyms: MOR103-16, GA_x6K02T2PBJ9-9337331-9336381, M50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233670
Homologene: 28439
CAAA01066805.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
Ccnl2
Name: cyclin L2
Synonyms: ania-6b, Pcee, 1700010A01Rik, 2010319M22Rik, 1810019L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 56036
Homologene: 69477
Krtap29-1
Name: keratin associated protein 29-1
Synonyms: Gm14195
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
Bmp15
Name: bone morphogenetic protein 15
Synonyms: GDF-9B, Bmp-15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 12155
HGNC: HGNC:1068
Homologene: 3977
Slitrk2
Name: SLIT and NTRK-like family, member 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 245450
Homologene: 13054
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,486,756 bp
  • A to G, chromosome 1 at 85,681,142 bp
  • G to A, chromosome 1 at 100,358,725 bp
  • A to T, chromosome 1 at 110,138,159 bp
  • T to A, chromosome 1 at 156,620,827 bp
  • T to C, chromosome 2 at 76,726,848 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • T to G, chromosome 2 at 90,758,372 bp
  • A to G, chromosome 2 at 111,369,095 bp
  • T to C, chromosome 2 at 122,287,108 bp
  • A to T, chromosome 2 at 122,333,062 bp
  • A to G, chromosome 2 at 163,339,685 bp
  • A to G, chromosome 2 at 166,941,492 bp
  • G to T, chromosome 2 at 181,199,772 bp
  • A to T, chromosome 3 at 64,556,098 bp
  • A to T, chromosome 3 at 75,078,412 bp
  • G to A, chromosome 3 at 106,219,455 bp
  • A to G, chromosome 3 at 129,858,804 bp
  • C to T, chromosome 4 at 25,269,036 bp
  • T to A, chromosome 4 at 48,158,870 bp
  • T to A, chromosome 4 at 65,614,776 bp
  • A to C, chromosome 4 at 82,498,615 bp
  • A to G, chromosome 4 at 100,990,844 bp
  • A to G, chromosome 4 at 113,238,132 bp
  • T to G, chromosome 4 at 134,201,941 bp
  • T to A, chromosome 4 at 139,479,540 bp
  • A to T, chromosome 4 at 155,812,481 bp
  • C to A, chromosome 4 at 156,241,450 bp
  • T to C, chromosome 5 at 21,226,839 bp
  • T to C, chromosome 5 at 114,874,280 bp
  • A to G, chromosome 5 at 115,545,667 bp
  • A to G, chromosome 5 at 135,107,005 bp
  • A to C, chromosome 5 at 135,970,317 bp
  • A to T, chromosome 5 at 142,766,087 bp
  • C to T, chromosome 5 at 149,709,380 bp
  • T to A, chromosome 6 at 56,736,435 bp
  • T to A, chromosome 6 at 124,224,483 bp
  • T to C, chromosome 7 at 16,945,789 bp
  • A to T, chromosome 7 at 24,778,372 bp
  • A to G, chromosome 7 at 27,257,377 bp
  • A to G, chromosome 7 at 42,300,001 bp
  • A to T, chromosome 7 at 106,956,287 bp
  • A to T, chromosome 7 at 107,074,619 bp
  • G to T, chromosome 7 at 114,804,593 bp
  • T to C, chromosome 8 at 69,799,773 bp
  • C to A, chromosome 8 at 94,243,739 bp
  • G to A, chromosome 8 at 95,557,296 bp
  • A to T, chromosome 8 at 109,532,103 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • C to T, chromosome 9 at 3,582,697 bp
  • C to T, chromosome 9 at 9,035,600 bp
  • T to A, chromosome 9 at 15,726,980 bp
  • A to T, chromosome 9 at 20,967,494 bp
  • G to A, chromosome 9 at 41,043,573 bp
  • T to C, chromosome 9 at 44,948,099 bp
  • A to T, chromosome 9 at 56,258,759 bp
  • G to A, chromosome 9 at 65,278,090 bp
  • T to C, chromosome 9 at 123,779,364 bp
  • C to T, chromosome 10 at 20,959,996 bp
  • T to C, chromosome 10 at 78,052,732 bp
  • A to G, chromosome 10 at 130,126,205 bp
  • T to C, chromosome 11 at 60,950,027 bp
  • T to C, chromosome 11 at 67,246,366 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • A to T, chromosome 11 at 77,172,321 bp
  • A to T, chromosome 11 at 94,364,417 bp
  • A to C, chromosome 11 at 94,549,125 bp
  • A to G, chromosome 11 at 99,978,612 bp
  • A to T, chromosome 11 at 105,240,440 bp
  • T to C, chromosome 12 at 24,951,443 bp
  • T to A, chromosome 12 at 24,987,006 bp
  • G to A, chromosome 12 at 66,568,917 bp
  • G to A, chromosome 12 at 78,877,185 bp
  • T to A, chromosome 12 at 81,631,796 bp
  • A to C, chromosome 12 at 84,793,733 bp
  • A to G, chromosome 12 at 100,142,232 bp
  • C to T, chromosome 13 at 42,183,786 bp
  • A to T, chromosome 13 at 55,542,998 bp
  • T to A, chromosome 13 at 62,854,061 bp
  • T to C, chromosome 13 at 100,050,988 bp
  • T to A, chromosome 13 at 104,236,176 bp
  • T to C, chromosome 14 at 41,174,462 bp
  • T to A, chromosome 14 at 50,736,576 bp
  • G to T, chromosome 15 at 4,092,525 bp
  • G to A, chromosome 15 at 28,312,388 bp
  • A to G, chromosome 15 at 76,188,926 bp
  • A to T, chromosome 15 at 81,792,328 bp
  • T to A, chromosome 15 at 85,821,231 bp
  • G to T, chromosome 15 at 85,838,788 bp
  • C to T, chromosome 15 at 96,362,590 bp
  • A to C, chromosome 15 at 102,118,181 bp
  • A to G, chromosome 16 at 4,068,336 bp
  • A to G, chromosome 16 at 95,361,078 bp
  • T to C, chromosome 17 at 15,742,294 bp
  • T to A, chromosome 17 at 25,826,282 bp
  • T to C, chromosome 17 at 33,136,760 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to T, chromosome 17 at 43,037,938 bp
  • A to G, chromosome 17 at 44,735,342 bp
  • T to C, chromosome 18 at 34,614,479 bp
  • C to A, chromosome 19 at 6,342,738 bp
  • T to C, chromosome 19 at 7,612,638 bp
  • A to G, chromosome X at 6,316,021 bp
  • T to C, chromosome X at 48,401,917 bp
  • T to A, chromosome X at 66,654,629 bp
  • C to A, chromosome X at 75,000,095 bp
  • A to G, chromosome X at 107,103,253 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2069 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040074-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.