Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2127Btlr/Mmmh
Stock Number:
040130-MU
Citation ID:
RRID:MMRRC_040130-MU
Other Names:
R2127 (G1), C57BL/6J-MtgxR2127Btlr
Major Collection:

Strain Information

Wnt3
Name: wingless-type MMTV integration site family, member 3
Synonyms: Wnt-3, Int-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22415
Homologene: 22527
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Abhd17c
Name: abhydrolase domain containing 17C
Synonyms: 2210412D01Rik, Fam108c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70178
Homologene: 26429
Usp30
Name: ubiquitin specific peptidase 30
Synonyms: 6330590F17Rik, D5Ertd483e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100756
Homologene: 32789
Trim36
Name: tripartite motif-containing 36
Synonyms: D18Wsu100e, Haprin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 28105
VEGA: 18
Homologene: 10275
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Ccar2
Name: cell cycle activator and apoptosis regulator 2
Synonyms: 2610301G19Rik, Dbc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219158
VEGA: 14
Homologene: 10910
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 37,366,919 bp
  • T to A, chromosome 1 at 92,938,034 bp
  • A to G, chromosome 2 at 19,201,811 bp
  • T to C, chromosome 2 at 38,941,687 bp
  • A to G, chromosome 2 at 87,810,341 bp
  • A to T, chromosome 2 at 87,962,832 bp
  • T to C, chromosome 2 at 91,645,174 bp
  • T to G, chromosome 2 at 126,737,575 bp
  • T to C, chromosome 2 at 156,044,642 bp
  • T to C, chromosome 2 at 174,648,124 bp
  • G to A, chromosome 2 at 181,259,049 bp
  • C to A, chromosome 3 at 116,497,674 bp
  • T to G, chromosome 3 at 135,239,780 bp
  • T to A, chromosome 4 at 65,297,257 bp
  • A to G, chromosome 4 at 100,442,093 bp
  • C to T, chromosome 4 at 133,210,621 bp
  • T to C, chromosome 4 at 134,213,806 bp
  • G to A, chromosome 4 at 141,017,096 bp
  • G to A, chromosome 4 at 149,187,640 bp
  • G to A, chromosome 4 at 155,860,470 bp
  • A to T, chromosome 5 at 89,568,065 bp
  • A to G, chromosome 5 at 103,609,056 bp
  • A to T, chromosome 5 at 112,831,078 bp
  • A to G, chromosome 5 at 114,111,163 bp
  • T to C, chromosome 5 at 123,622,849 bp
  • T to A, chromosome 5 at 146,504,942 bp
  • T to C, chromosome 6 at 55,218,265 bp
  • T to A, chromosome 6 at 66,553,549 bp
  • A to G, chromosome 6 at 113,760,650 bp
  • A to C, chromosome 6 at 128,558,437 bp
  • A to C, chromosome 6 at 135,778,700 bp
  • G to T, chromosome 7 at 13,915,260 bp
  • T to G, chromosome 7 at 18,682,718 bp
  • T to C, chromosome 7 at 25,364,582 bp
  • A to G, chromosome 7 at 28,796,743 bp
  • T to C, chromosome 7 at 29,185,040 bp
  • T to C, chromosome 7 at 29,537,140 bp
  • A to T, chromosome 7 at 43,530,275 bp
  • G to T, chromosome 7 at 76,419,880 bp
  • A to G, chromosome 7 at 79,464,928 bp
  • C to A, chromosome 7 at 84,110,662 bp
  • C to T, chromosome 7 at 105,693,721 bp
  • C to T, chromosome 7 at 128,140,035 bp
  • A to G, chromosome 7 at 130,784,308 bp
  • A to G, chromosome 7 at 145,273,975 bp
  • T to C, chromosome 8 at 15,917,392 bp
  • G to T, chromosome 8 at 22,218,289 bp
  • A to T, chromosome 8 at 95,323,763 bp
  • C to T, chromosome 8 at 121,785,142 bp
  • T to C, chromosome 9 at 21,149,847 bp
  • T to C, chromosome 9 at 44,340,707 bp
  • A to G, chromosome 9 at 52,069,732 bp
  • T to A, chromosome 9 at 59,520,200 bp
  • T to G, chromosome 9 at 92,488,630 bp
  • G to A, chromosome 9 at 104,008,243 bp
  • A to G, chromosome 9 at 108,811,733 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 10 at 23,786,878 bp
  • T to C, chromosome 10 at 82,226,042 bp
  • C to A, chromosome 10 at 117,774,475 bp
  • T to A, chromosome 10 at 120,224,753 bp
  • A to G, chromosome 11 at 43,705,318 bp
  • A to G, chromosome 11 at 64,435,403 bp
  • A to T, chromosome 11 at 69,458,185 bp
  • C to G, chromosome 11 at 73,602,805 bp
  • G to A, chromosome 11 at 79,033,313 bp
  • A to G, chromosome 11 at 83,030,342 bp
  • A to T, chromosome 11 at 99,772,501 bp
  • A to G, chromosome 11 at 103,812,648 bp
  • A to G, chromosome 11 at 110,219,649 bp
  • A to G, chromosome 11 at 113,369,803 bp
  • A to G, chromosome 11 at 117,869,774 bp
  • T to A, chromosome 12 at 4,867,659 bp
  • T to A, chromosome 12 at 44,308,057 bp
  • A to T, chromosome 13 at 8,034,975 bp
  • G to A, chromosome 13 at 11,712,195 bp
  • T to G, chromosome 13 at 13,635,262 bp
  • T to A, chromosome 13 at 73,265,476 bp
  • A to G, chromosome 13 at 76,824,822 bp
  • A to T, chromosome 13 at 81,557,080 bp
  • A to T, chromosome 13 at 107,733,944 bp
  • T to C, chromosome 13 at 119,893,746 bp
  • C to A, chromosome 14 at 20,724,893 bp
  • C to A, chromosome 14 at 47,530,106 bp
  • T to G, chromosome 14 at 70,139,651 bp
  • T to C, chromosome 15 at 9,729,661 bp
  • C to T, chromosome 16 at 43,908,635 bp
  • T to C, chromosome 16 at 57,121,871 bp
  • A to G, chromosome 16 at 58,718,255 bp
  • A to G, chromosome 17 at 24,158,308 bp
  • T to C, chromosome 17 at 24,496,996 bp
  • A to G, chromosome 17 at 25,723,560 bp
  • C to T, chromosome 17 at 32,819,498 bp
  • C to T, chromosome 17 at 80,273,048 bp
  • C to T, chromosome 18 at 19,968,354 bp
  • A to T, chromosome 18 at 46,212,337 bp
  • A to G, chromosome 18 at 46,465,664 bp
  • G to A, chromosome 18 at 60,691,208 bp
  • G to A, chromosome 19 at 4,871,675 bp
  • A to T, chromosome 19 at 20,642,915 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2127 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040130-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.