Strain Name:
C57BL/6J-MtgxR2127Btlr/Mmmh
Stock Number:
040130-MU
Citation ID:
RRID:MMRRC_040130-MU
Other Names:
R2127 (G1), C57BL/6J-MtgxR2127Btlr
Major Collection:

Gene Information

Wnt3
Name: wingless-type MMTV integration site family, member 3
Synonyms: Wnt-3, Int-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22415
Homologene: 22527
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Abhd17c
Name: abhydrolase domain containing 17C
Synonyms: Fam108c, 2210412D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70178
Homologene: 26429
Usp30
Name: ubiquitin specific peptidase 30
Synonyms: 6330590F17Rik, D5Ertd483e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100756
Homologene: 32789
Trim36
Name: tripartite motif-containing 36
Synonyms: D18Wsu100e, Haprin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 28105
VEGA: 18
Homologene: 10275
Kif1b
Name: kinesin family member 1B
Synonyms: KIF1Bp204, KIF1Bp130, A530096N05Rik, D4Mil1e, N-3 kinesin, Kif1b alpha, Kif1b beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16561
Homologene: 99835
Ccar2
Name: cell cycle activator and apoptosis regulator 2
Synonyms: 2610301G19Rik, Dbc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219158
VEGA: 14
Homologene: 10910
Ccdc191
Name: coiled-coil domain containing 191
Synonyms: 2610015P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212153
Homologene: 19484
Nup107
Name: nucleoporin 107
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103468
VEGA: 10
Homologene: 5555
Rps12
Name: ribosomal protein S12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20042
VEGA: 10
Homologene: 110750
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Rtca
Name: RNA 3'-terminal phosphate cyclase
Synonyms: 2310009A18Rik, Rtcd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66368
Homologene: 2766
Tomm70a
Name: translocase of outer mitochondrial membrane 70A
Synonyms: D16Ium22, D16Wsu109e, 2610044B22Rik, D16Ium22e, Tom70, Tomm70a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 28185
VEGA: 16
Homologene: 40112
Polg
Name: polymerase (DNA directed), gamma
Synonyms: Polga, mitochondrial DNA polymerase-gamma, mitochondrial DNA polymerase gamma, polymerase gamma, Pol gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18975
HGNC: HGNC:9179
Homologene: 2016
Gpr3
Name: G-protein coupled receptor 3
Synonyms: Gpcr3, Gpcr21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14748
HGNC: HGNC:4484
Homologene: 31303
Slc39a11
Name: solute carrier family 39 (metal ion transporter), member 11
Synonyms: 1810074D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69806
Homologene: 12331
Zswim6
Name: zinc finger SWIM-type containing 6
Synonyms: 2900036G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67263
VEGA: 13
Homologene: 83517
Jph3
Name: junctophilin 3
Synonyms: JP-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 57340
Homologene: 10762
Zfp799
Name: zinc finger protein 799
Synonyms: 6030490I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240064
Homologene: 107106
Ror1
Name: receptor tyrosine kinase-like orphan receptor 1
Synonyms: Ntrkr1, 2810404D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26563
Homologene: 3675
Zfp408
Name: zinc finger protein 408
Synonyms: LOC381410
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381410
Homologene: 11687
Irx4
Name: Iroquois homeobox 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 50916
HGNC: HGNC:6129
Homologene: 9485
Cdc37
Name: cell division cycle 37
Synonyms: p50Cdc37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12539
VEGA: 9
HGNC: HGNC:1735
Homologene: 38268
Cenpe
Name: centromere protein E
Synonyms: 312kDa, Kif10, N-7 kinesin, CENP-E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Pwwp2a
Name: PWWP domain containing 2A
Synonyms: 4631424J17Rik, D930040F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70802
Homologene: 19687
Fbxo34
Name: F-box protein 34
Synonyms: 5830426G16Rik, 2900057B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 78938
VEGA: 14
Homologene: 12713
Inpp4a
Name: inositol polyphosphate-4-phosphatase, type I
Synonyms: 107kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269180
HGNC: HGNC:6074
Homologene: 2871
Usp8
Name: ubiquitin specific peptidase 8
Synonyms: Ubpy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 84092
Homologene: 3782
Tpcn2
Name: two pore segment channel 2
Synonyms: D830047E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233979
Homologene: 16375
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: wms, jog, Gena300, Tmy, PMCA2, D6Abb2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Rdx
Name: radixin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19684
VEGA: 9
HGNC: HGNC:9944
Homologene: 37707
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94109
Homologene: 69536
Nphp3
Name: nephronophthisis 3 (adolescent)
Synonyms: pcy, D330020E01Rik, 3632410F03Rik, nephrocystin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74025
HGNC: HGNC:7907
Homologene: 32697
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77505
Homologene: 131117
Aldh1a1
Name: aldehyde dehydrogenase family 1, subfamily A1
Synonyms: Ahd2, E1, Ahd-2, Raldh1, ALDH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 11668
HGNC: HGNC:402
Homologene: 110441
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 83771
Homologene: 12890
Btbd16
Name: BTB (POZ) domain containing 16
Synonyms: E330040A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330660
Homologene: 77327
Hmbs
Name: hydroxymethylbilane synthase
Synonyms: PBGD, Ups, Uros1, porphobilinogen deaminase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 15288
VEGA: 9
HGNC: HGNC:4982
Homologene: 158
Dhx57
Name: DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, Dnahc2, Dnhd3, 2900022L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Zfp831
Name: zinc finger protein 831
Synonyms: OTTMUSG00000017459, ENSMUSG00000050600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100043757
Homologene: 19013
4932431P20Rik
Name: RIKEN cDNA 4932431P20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 114675
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, Ccp4, EG244071
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244071
Homologene: 17552
Tmem202
Name: transmembrane protein 202
Synonyms: 4930425N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 73893
VEGA: 9
Homologene: 52264
Armc3
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70882
Homologene: 31589
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mgr1, Gpr98, Mass1, VLGR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Fer1l4
Name: fer-1-like 4 (C. elegans)
Synonyms: 9130402C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74562
Homologene: 19075
Chtf18
Name: CTF18, chromosome transmission fidelity factor 18
Synonyms: CTF18, 6030457M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 214901
Homologene: 32532
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232400
Homologene: 45969
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: NR2B, Nmdar2b, GluRepsilon2, NMDAR2B, GluN2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Slfn10-ps
Name: schlafen 10, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237887
Caskin1
Name: CASK interacting protein 1
Synonyms: C630036E02Rik, 3300002N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268932
VEGA: 17
Homologene: 25873
Pnpla8
Name: patatin-like phospholipase domain containing 8
Synonyms: 1200006O19Rik, iPLA2 gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 67452
Homologene: 12136
Abca6
Name: ATP-binding cassette, sub-family A (ABC1), member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Megf8
Name: multiple EGF-like-domains 8
Synonyms: b2b288Clo, b2b1702Clo, Egfl4, m687Ddg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: PAPP-A, PAG1, 8430414N03Rik, IGFBP-4ase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Ndst2
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Synonyms: Mndns, glucosaminyl N-deacetylase/N-sulphotransferase-2, [Heparan sulfate]-glucosamine N-sulfotransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 17423
VEGA: 14
HGNC: HGNC:7681
Homologene: 20803
Ksr1
Name: kinase suppressor of ras 1
Synonyms: D11Bhm183e, B-KSR1, D11Bhm184e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16706
HGNC: HGNC:6465
Homologene: 8410
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 320277
Homologene: 23371
Actn3
Name: actinin alpha 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 11474
HGNC: HGNC:165
Homologene: 862
Dsc3
Name: desmocollin 3
Synonyms: 5430426I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13507
VEGA: 18
HGNC: HGNC:3037
Homologene: 1462
Psg20
Name: pregnancy-specific glycoprotein 20
Synonyms: cea7, EG434540
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434540
Homologene: 110989
Mctp1
Name: multiple C2 domains, transmembrane 1
Synonyms: 2810465F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 78771
Homologene: 75211
Mfsd2b
Name: major facilitator superfamily domain containing 2B
Synonyms: Gm1964
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432628
Homologene: 47753
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230872
Homologene: 16811
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: 4631429H07Rik, Rsn, CLIP-170, Clip50, Clip 170, restin, 1110007I12Rik, cytoplasmic linker protein 50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56430
Homologene: 74455
Vps36
Name: vacuolar protein sorting 36
Synonyms: 2210415M20Rik, 2810408E15Rik, Eap45, 1700010A24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 70160
Homologene: 9374
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74376
Homologene: 53435
Npffr2
Name: neuropeptide FF receptor 2
Synonyms: NPFF2, Gpr74
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 104443
HGNC: HGNC:4525
Homologene: 56982
Plscr4
Name: phospholipid scramblase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235527
Homologene: 23217
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: Catsperg, A230107C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320225
Homologene: 10915
Itgax
Name: integrin alpha X
Synonyms: Cd11c, CD11C (p150) alpha polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16411
HGNC: HGNC:6152
Homologene: 55493
Zfp938
Name: zinc finger protein 938
Synonyms: B230315N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237411
Homologene: 135924
Mindy4
Name: MINDY lysine 48 deubiquitinase 4
Synonyms: LOC384387, C330043M08Rik, Fam188b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330323
Homologene: 49991
Gmeb2
Name: glucocorticoid modulatory element binding protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 229004
HGNC: HGNC:4371
Homologene: 8228
Tha1
Name: threonine aldolase 1
Synonyms: GLY1, 1300017K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71776
Homologene: 57081
Mospd4
Name: motile sperm domain containing 4
Synonyms: 2010013H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 72076
Gm9742
Name: predicted gene 9742
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 791083
VEGA: 13
Gm11595
Name: predicted gene 11595
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100040276
Homologene: 124486
Olfml2a
Name: olfactomedin-like 2A
Synonyms: photomedin-1, 4932431K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241327
Homologene: 35248
Olfr384
Name: olfactory receptor 384
Synonyms: GA_x6K02T2P1NL-3773152-3774090, MOR135-5, Olfr386, GA_x6K02T2P1NL-3739520-3740032
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 193053
Homologene: 105206
Amdhd2
Name: amidohydrolase domain containing 2
Synonyms: 5730457F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 245847
Homologene: 9311
Ndst1
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms: glucosaminyl N-deacetylase/N-sulfotransferase 1, 1200015G06Rik, Ndst-1, Hsst, b2b2230Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 15531
VEGA: 18
HGNC: HGNC:7680
Homologene: 20386
Vmn1r32
Name: vomeronasal 1 receptor 32
Synonyms: V1rc15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171188
Homologene: 115644
Slc10a6
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 6
Synonyms: 8430417G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75750
Homologene: 12620
Nckipsd
Name: NCK interacting protein with SH3 domain
Synonyms: DIP1, SPIN90, AF3P21, WISH, Wasbp, ORF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 80987
Homologene: 9514
Cd33
Name: CD33 antigen
Synonyms: Siglec-3, gp67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12489
HGNC: HGNC:1659
Sult2a4
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
Synonyms: Gm5584
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434121
Homologene: 37741
Catsper4
Name: cation channel, sperm associated 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329954
Homologene: 18638
Zfp319
Name: zinc finger protein 319
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 79233
Homologene: 11548
Capn10
Name: calpain 10
Synonyms: Capn8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23830
HGNC: HGNC:1477
Homologene: 36323
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546165
VEGA: 9
Rinl
Name: Ras and Rab interactor-like
Synonyms: 9930116N10Rik, 5830482F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320435
Homologene: 18556
Gpr15
Name: G protein-coupled receptor 15
Synonyms: 4933439K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 71223
VEGA: 16
HGNC: HGNC:4469
Homologene: 3869
Olfr1157
Name: olfactory receptor 1157
Synonyms: MOR174-1, GA_x6K02T2Q125-49446395-49445457
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258846
HGNC: HGNC:8350
Homologene: 17402
Olfr1145
Name: olfactory receptor 1145
Synonyms: MOR264-19, GA_x6K02T2Q125-49311440-49312384
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258317
Homologene: 27123
Tmbim4
Name: transmembrane BAX inhibitor motif containing 4
Synonyms: 0610007H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 68212
Homologene: 56740
4930449I24Rik
Name: RIKEN cDNA 4930449I24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67410
Homologene: 86127
AL646051.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Tcstv1
Name: 2-cell-stage, variable group, member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 54382
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 37,366,919 bp
  • T to A, chromosome 1 at 92,938,034 bp
  • A to G, chromosome 2 at 19,201,811 bp
  • T to C, chromosome 2 at 38,941,687 bp
  • A to G, chromosome 2 at 87,810,341 bp
  • A to T, chromosome 2 at 87,962,832 bp
  • T to C, chromosome 2 at 91,645,174 bp
  • T to G, chromosome 2 at 126,737,575 bp
  • T to C, chromosome 2 at 156,044,642 bp
  • T to C, chromosome 2 at 174,648,124 bp
  • G to A, chromosome 2 at 181,259,049 bp
  • C to A, chromosome 3 at 116,497,674 bp
  • T to G, chromosome 3 at 135,239,780 bp
  • T to A, chromosome 4 at 65,297,257 bp
  • A to G, chromosome 4 at 100,442,093 bp
  • C to T, chromosome 4 at 133,210,621 bp
  • T to C, chromosome 4 at 134,213,806 bp
  • G to A, chromosome 4 at 141,017,096 bp
  • G to A, chromosome 4 at 149,187,640 bp
  • G to A, chromosome 4 at 155,860,470 bp
  • A to T, chromosome 5 at 89,568,065 bp
  • A to G, chromosome 5 at 103,609,056 bp
  • A to T, chromosome 5 at 112,831,078 bp
  • A to G, chromosome 5 at 114,111,163 bp
  • T to C, chromosome 5 at 123,622,849 bp
  • T to A, chromosome 5 at 146,504,942 bp
  • T to C, chromosome 6 at 55,218,265 bp
  • T to A, chromosome 6 at 66,553,549 bp
  • A to G, chromosome 6 at 113,760,650 bp
  • A to C, chromosome 6 at 128,558,437 bp
  • A to C, chromosome 6 at 135,778,700 bp
  • G to T, chromosome 7 at 13,915,260 bp
  • T to G, chromosome 7 at 18,682,718 bp
  • T to C, chromosome 7 at 25,364,582 bp
  • A to G, chromosome 7 at 28,796,743 bp
  • T to C, chromosome 7 at 29,185,040 bp
  • T to C, chromosome 7 at 29,537,140 bp
  • A to T, chromosome 7 at 43,530,275 bp
  • G to T, chromosome 7 at 76,419,880 bp
  • A to G, chromosome 7 at 79,464,928 bp
  • C to A, chromosome 7 at 84,110,662 bp
  • C to T, chromosome 7 at 105,693,721 bp
  • C to T, chromosome 7 at 128,140,035 bp
  • A to G, chromosome 7 at 130,784,308 bp
  • A to G, chromosome 7 at 145,273,975 bp
  • T to C, chromosome 8 at 15,917,392 bp
  • G to T, chromosome 8 at 22,218,289 bp
  • A to T, chromosome 8 at 95,323,763 bp
  • C to T, chromosome 8 at 121,785,142 bp
  • T to C, chromosome 9 at 21,149,847 bp
  • T to C, chromosome 9 at 44,340,707 bp
  • A to G, chromosome 9 at 52,069,732 bp
  • T to A, chromosome 9 at 59,520,200 bp
  • T to G, chromosome 9 at 92,488,630 bp
  • G to A, chromosome 9 at 104,008,243 bp
  • A to G, chromosome 9 at 108,811,733 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 10 at 23,786,878 bp
  • T to C, chromosome 10 at 82,226,042 bp
  • C to A, chromosome 10 at 117,774,475 bp
  • T to A, chromosome 10 at 120,224,753 bp
  • A to G, chromosome 11 at 43,705,318 bp
  • A to G, chromosome 11 at 64,435,403 bp
  • A to T, chromosome 11 at 69,458,185 bp
  • C to G, chromosome 11 at 73,602,805 bp
  • G to A, chromosome 11 at 79,033,313 bp
  • A to G, chromosome 11 at 83,030,342 bp
  • A to T, chromosome 11 at 99,772,501 bp
  • A to G, chromosome 11 at 103,812,648 bp
  • A to G, chromosome 11 at 110,219,649 bp
  • A to G, chromosome 11 at 113,369,803 bp
  • A to G, chromosome 11 at 117,869,774 bp
  • T to A, chromosome 12 at 4,867,659 bp
  • T to A, chromosome 12 at 44,308,057 bp
  • A to T, chromosome 13 at 8,034,975 bp
  • G to A, chromosome 13 at 11,712,195 bp
  • T to G, chromosome 13 at 13,635,262 bp
  • T to A, chromosome 13 at 73,265,476 bp
  • A to G, chromosome 13 at 76,824,822 bp
  • A to T, chromosome 13 at 81,557,080 bp
  • A to T, chromosome 13 at 107,733,944 bp
  • T to C, chromosome 13 at 119,893,746 bp
  • C to A, chromosome 14 at 20,724,893 bp
  • C to A, chromosome 14 at 47,530,106 bp
  • T to G, chromosome 14 at 70,139,651 bp
  • T to C, chromosome 15 at 9,729,661 bp
  • C to T, chromosome 16 at 43,908,635 bp
  • T to C, chromosome 16 at 57,121,871 bp
  • A to G, chromosome 16 at 58,718,255 bp
  • A to G, chromosome 17 at 24,158,308 bp
  • T to C, chromosome 17 at 24,496,996 bp
  • A to G, chromosome 17 at 25,723,560 bp
  • C to T, chromosome 17 at 32,819,498 bp
  • C to T, chromosome 17 at 80,273,048 bp
  • C to T, chromosome 18 at 19,968,354 bp
  • A to T, chromosome 18 at 46,212,337 bp
  • A to G, chromosome 18 at 46,465,664 bp
  • G to A, chromosome 18 at 60,691,208 bp
  • G to A, chromosome 19 at 4,871,675 bp
  • A to T, chromosome 19 at 20,642,915 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2127 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040130-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.