Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2130Btlr/Mmmh
Stock Number:
040133-MU
Citation ID:
RRID:MMRRC_040133-MU
Other Names:
R2130 (G1), C57BL/6J-MtgxR2130Btlr
Major Collection:

Strain Information

Sort1
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20661
Homologene: 136097
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Tkfc
Name: triokinase, FMN cyclase
Synonyms: Dak
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225913
VEGA: 19
Homologene: 56710
Tacr3
Name: tachykinin receptor 3
Synonyms: neuromedin K receptor, Tac3r, Nk3r
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21338
Homologene: 824
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71517
Homologene: 10659
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain II-B, NMHC-B, SMemb, nonmuscle myosin heavy chain IIB, 9330167F11Rik, 5730504C04Rik, NMHC II-B, Myhn2, Myosin IIB, Myhn-2, myosin IIB, Fltn, Fltn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,169,843 bp
  • A to G, chromosome 1 at 74,461,656 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • G to A, chromosome 1 at 133,387,071 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • TCTTCCTTCCTTCCTT to TCTTCCTTCCTTCCTTCCTTCCTT, chromosome 1 at 134,969,213 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • T to A, chromosome 1 at 153,127,124 bp
  • T to A, chromosome 2 at 24,952,636 bp
  • A to G, chromosome 2 at 32,923,647 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • T to C, chromosome 2 at 76,742,517 bp
  • G to T, chromosome 3 at 10,335,218 bp
  • T to C, chromosome 3 at 59,865,348 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • T to A, chromosome 3 at 103,735,869 bp
  • T to A, chromosome 3 at 106,570,760 bp
  • T to A, chromosome 3 at 108,351,686 bp
  • T to A, chromosome 3 at 116,539,124 bp
  • T to C, chromosome 3 at 118,674,568 bp
  • T to C, chromosome 3 at 134,932,180 bp
  • T to C, chromosome 3 at 148,890,488 bp
  • C to T, chromosome 4 at 33,225,764 bp
  • G to A, chromosome 4 at 45,903,835 bp
  • T to C, chromosome 4 at 132,544,059 bp
  • T to A, chromosome 4 at 141,005,016 bp
  • T to C, chromosome 4 at 141,029,102 bp
  • C to T, chromosome 4 at 145,156,101 bp
  • T to C, chromosome 5 at 110,202,939 bp
  • T to A, chromosome 5 at 129,787,539 bp
  • G to A, chromosome 5 at 134,136,153 bp
  • T to A, chromosome 5 at 136,012,040 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • T to C, chromosome 5 at 151,045,168 bp
  • C to A, chromosome 6 at 12,100,187 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • G to A, chromosome 6 at 67,725,334 bp
  • T to C, chromosome 6 at 121,325,041 bp
  • C to T, chromosome 6 at 125,657,057 bp
  • T to C, chromosome 6 at 128,491,161 bp
  • T to A, chromosome 6 at 128,576,260 bp
  • A to G, chromosome 6 at 137,411,116 bp
  • A to T, chromosome 7 at 4,851,439 bp
  • T to C, chromosome 7 at 16,312,343 bp
  • T to A, chromosome 7 at 105,143,550 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • A to G, chromosome 7 at 126,390,462 bp
  • A to G, chromosome 7 at 126,587,206 bp
  • T to A, chromosome 7 at 135,704,241 bp
  • T to C, chromosome 8 at 63,927,147 bp
  • T to A, chromosome 8 at 105,092,975 bp
  • A to T, chromosome 8 at 111,297,402 bp
  • A to T, chromosome 8 at 128,498,516 bp
  • A to T, chromosome 9 at 7,011,253 bp
  • T to C, chromosome 9 at 72,308,005 bp
  • A to G, chromosome 9 at 73,013,158 bp
  • G to T, chromosome 10 at 11,609,369 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • A to T, chromosome 10 at 91,060,165 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • A to G, chromosome 11 at 29,557,663 bp
  • C to A, chromosome 11 at 48,807,592 bp
  • A to G, chromosome 11 at 49,180,696 bp
  • T to A, chromosome 11 at 62,859,857 bp
  • A to G, chromosome 11 at 68,807,289 bp
  • T to G, chromosome 11 at 68,968,965 bp
  • A to G, chromosome 11 at 80,817,522 bp
  • A to G, chromosome 11 at 87,797,361 bp
  • G to A, chromosome 11 at 97,033,309 bp
  • A to G, chromosome 11 at 97,451,561 bp
  • A to T, chromosome 11 at 99,985,776 bp
  • A to T, chromosome 11 at 100,894,149 bp
  • G to A, chromosome 11 at 115,871,643 bp
  • C to T, chromosome 11 at 116,448,417 bp
  • T to C, chromosome 12 at 69,185,294 bp
  • T to A, chromosome 12 at 79,268,434 bp
  • T to G, chromosome 12 at 87,452,703 bp
  • T to A, chromosome 13 at 63,210,149 bp
  • A to T, chromosome 13 at 67,408,276 bp
  • T to C, chromosome 13 at 81,581,727 bp
  • A to G, chromosome 13 at 94,192,049 bp
  • T to C, chromosome 14 at 7,364,194 bp
  • T to A, chromosome 14 at 27,446,388 bp
  • A to G, chromosome 14 at 27,476,614 bp
  • A to G, chromosome 14 at 30,178,744 bp
  • T to C, chromosome 14 at 56,493,354 bp
  • T to C, chromosome 14 at 70,638,487 bp
  • T to A, chromosome 15 at 35,671,400 bp
  • T to A, chromosome 15 at 98,075,967 bp
  • A to T, chromosome 15 at 99,671,875 bp
  • T to C, chromosome 17 at 74,659,154 bp
  • A to G, chromosome 19 at 10,596,041 bp
  • T to G, chromosome 19 at 53,926,326 bp
  • G to A, chromosome 19 at 57,654,994 bp
  • T to A, chromosome X at 21,119,342 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2130 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040133-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.