Strain Name:
C57BL/6J-MtgxR2130Btlr/Mmmh
Stock Number:
040133-MU
Citation ID:
RRID:MMRRC_040133-MU
Other Names:
R2130 (G1), C57BL/6J-MtgxR2130Btlr
Major Collection:

Gene Information

Sort1
Name: sortilin 1
Synonyms: Ntr3, Ntsr3, neurotensin receptor 3, 2900053A11Rik, sortilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20661
Homologene: 136097
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11287
Homologene: 104112
Aopep
Name: aminopeptidase O
Synonyms: 2010111I01Rik, ApO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Tkfc
Name: triokinase, FMN cyclase
Synonyms: Dak
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225913
VEGA: 19
Homologene: 56710
Tacr3
Name: tachykinin receptor 3
Synonyms: Tac3r, neuromedin K receptor, Nk3r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 21338
Homologene: 824
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: Vsp35l, 9030624J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71517
Homologene: 10659
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: Myosin IIB, nonmuscle myosin heavy chain IIB, Fltn, Myhn-2, SMemb, NMHC-B, nonmuscle myosin heavy chain II-B, 5730504C04Rik, 9330167F11Rik, Fltn, myosin IIB, NMHC II-B, Myhn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lphn2, Lec1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99633
Homologene: 22712
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: A430032G04Rik, D630005A10Rik, A430040A19Rik, Bruce, apollon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12211
Homologene: 7248
Cct6a
Name: chaperonin containing Tcp1, subunit 6a (zeta)
Synonyms: chaperonin containing TCP-1, Cct6, Cctz-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12466
HGNC: HGNC:1620
Homologene: 1336
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Stat3
Name: signal transducer and activator of transcription 3
Synonyms: 1110034C02Rik, Aprf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20848
Homologene: 7960
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: BREK, KPI-2, cprk, KPI2, AATYK2, A330101P12Rik, 2900041G10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231876
Homologene: 8948
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Tasor
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, Fam208a, MommeD6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: 6230400I06Rik, Apaf1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: E330036L07Rik, D15Ertd528e, 2310046A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223870
Homologene: 8731
Niban2
Name: niban apoptosis regulator 2
Synonyms: Fam129b, 9130404D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227737
Homologene: 11269
Snw1
Name: SNW domain containing 1
Synonyms: Skiip, SKIP, NCoA-62, 2310008B08Rik, SNW1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 66354
VEGA: 12
Homologene: 56557
Rnf17
Name: ring finger protein 17
Synonyms: MMIP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 30054
VEGA: 14
Homologene: 23727
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Dnajc8
Name: DnaJ heat shock protein family (Hsp40) member C8
Synonyms: 1110021D09Rik, 2010009J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68598
Homologene: 40935
Arhgap23
Name: Rho GTPase activating protein 23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 58996
Homologene: 104145
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: Coh1, C330002D13Rik, 2310042E16Rik, 1810042B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Golga3
Name: golgi autoantigen, golgin subfamily a, 3
Synonyms: G1-499-14, Mea2, 5430416E01Rik, Mea-2, repro27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269682
HGNC: HGNC:4426
Homologene: 4308
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230895
Homologene: 15583
Rfwd3
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234736
Homologene: 41230
Clhc1
Name: clathrin heavy chain linker domain containing 1
Synonyms: 1700034F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 73324
Homologene: 17569
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Btnl9
Name: butyrophilin-like 9
Synonyms: D330012D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237754
Homologene: 68540
Dram2
Name: DNA-damage regulated autophagy modulator 2
Synonyms: 2610318G18Rik, Tmem77, 2010305N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67171
Homologene: 23565
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: D330044F14Rik, b2b414Clo, Dnchc2, m152Asp, D030010H02Rik, m407Asp, DHC2, DHC1b, 4432416O06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: LOC380767, 9330197E15Rik, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Usp37
Name: ubiquitin specific peptidase 37
Synonyms: C330008N13Rik, 4932415L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319651
Homologene: 10858
Zfp459
Name: zinc finger protein 459
Synonyms: 9930025G17Rik, Rslcan-14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 328274
Tmem98
Name: transmembrane protein 98
Synonyms: Rwhs, 6530411B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103743
Homologene: 9185
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Avil
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11567
Homologene: 38200
Fgf17
Name: fibroblast growth factor 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14171
VEGA: 14
HGNC: HGNC:3673
Homologene: 2872
Ttn
Name: titin
Synonyms: 2310036G12Rik, mdm, 1100001C23Rik, shru, D830007G01Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, L56, connectin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: Cchl1a2, 8430418G19Rik, D-LTCC, Cchl1a, C79217, Cav1.3alpha1, Cacnl1a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Kif5c
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16574
HGNC: HGNC:6325
Homologene: 56234
Ptpro
Name: protein tyrosine phosphatase, receptor type, O
Synonyms: D28, Ptpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, PTPROt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Gpr98, VLGR1, Mgr1, Mass1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Dbt
Name: dihydrolipoamide branched chain transacylase E2
Synonyms: dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, D3Wsu60e, BCKAD E2, dihydrolipoyl transacylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13171
HGNC: HGNC:2698
Homologene: 1444
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22371
Homologene: 466
Nrp1
Name: neuropilin 1
Synonyms: NPN-1, Neuropilin-1, Npn1, NP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18186
HGNC: HGNC:8004
Homologene: 2876
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381522
Homologene: 117988
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232400
Homologene: 45969
Aox3
Name: aldehyde oxidase 3
Synonyms: 1200011D03Rik, AOH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71724
Homologene: 90899
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM25H2, Fbw10, SM2SH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 213980
Homologene: 32757
Mpo
Name: myeloperoxidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17523
HGNC: HGNC:7218
Homologene: 55450
Myo15b
Name: myosin XVB
Synonyms: E330039G21Rik, LOC380737, LOC217328
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217328
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Atrnl1
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Asic1
Name: acid-sensing (proton-gated) ion channel 1
Synonyms: ASIC1 beta, ASICalpha, ASIC1a, Accn2, BNaC2, ASIC, B530003N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70381
Homologene: 9120
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217341
Homologene: 12951
Slc25a35
Name: solute carrier family 25, member 35
Synonyms: 1810012H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71998
Homologene: 6343
Olfml3
Name: olfactomedin-like 3
Synonyms: mONT3, HNOEL-iso, 2810002E22Rik, ONT3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99543
Homologene: 10613
Nfatc2ip
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 interacting protein
Synonyms: NIP45, D7Ertd304e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18020
Homologene: 7862
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230872
Homologene: 16811
AC149051.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Srsf12
Name: serine and arginine-rich splicing factor 12
Synonyms: Sfrs13b, Srrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 272009
Krtap16-1
Name: keratin associated protein 16-1
Synonyms: AI450886
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100504183
Homologene: 99988
Slc6a13
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms: Gabt3, Gat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14412
Homologene: 9592
Olfr683
Name: olfactory receptor 683
Synonyms: GA_x6K02T2PBJ9-7773007-7772066, MOR40-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259047
Homologene: 133645
Ces3b
Name: carboxylesterase 3B
Synonyms: ES31L, Gm4738
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13909
HGNC: HGNC:1865
Homologene: 84407
Ren1
Name: renin 1 structural
Synonyms: Ren-1, Ren1c, Rn-1, Ren-A, Ren1d, Rnr, Ren
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
AC165412.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Lhfpl2
Name: lipoma HMGIC fusion partner-like 2
Synonyms: vgim
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218454
HGNC: HGNC:6588
Homologene: 4222
Lamc2
Name: laminin, gamma 2
Synonyms: nicein, 100kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16782
HGNC: HGNC:6493
Homologene: 4062
Trim41
Name: tripartite motif-containing 41
Synonyms: RINCK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 211007
Homologene: 14140
Gm9797
Name: predicted pseudogene 9797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 100039343
VEGA: 10
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: Ssa2, Trove2, 1810007I17Rik, Ssa, SS-A/Ro, A530054J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Zmynd19
Name: zinc finger, MYND domain containing 19
Synonyms: 2700064H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67187
Homologene: 12093
Gm6578
Name: predicted gene 6578
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 625347
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Stard13
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: DLC2, GT650
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243362
Homologene: 64844
Dtx2
Name: deltex 2, E3 ubiquitin ligase
Synonyms: 2610524D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74198
Homologene: 56904
Sox13
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20668
Homologene: 4159
Scrn2
Name: secernin 2
Synonyms: D11Moh48, SES2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217140
Homologene: 26698
Mgat2
Name: mannoside acetylglucosaminyltransferase 2
Synonyms: GNT2, GNT-II, CDGS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217664
HGNC: HGNC:7045
Homologene: 1806
Slc10a5
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 5
Synonyms: LOC241877
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 241877
Homologene: 78106
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Ccpg1
Name: cell cycle progression 1
Synonyms: 1810073J13Rik, D9Ertd392e, 9430028F23Rik, 1700030B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72278
Homologene: 3487
Apobr
Name: apolipoprotein B receptor
Synonyms: Apob-48r, Apob48r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171504
Homologene: 26695
Atp13a2
Name: ATPase type 13A2
Synonyms: 1110012E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74772
Homologene: 56940
Castor2
Name: cytosolic arginine sensor for mTORC1 subunit 2
Synonyms: Gatsl2, Gats
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80909
Homologene: 84866
Tnnt2
Name: troponin T2, cardiac
Synonyms: cardiac TnT, cTnT, Tnt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Pdcd4
Name: programmed cell death 4
Synonyms: MA-3, TIS, D19Ucla1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18569
VEGA: 19
HGNC: HGNC:8763
Homologene: 7879
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
Olfr341
Name: olfactory receptor 341
Synonyms: MOR136-2, GA_x6K02T2NLDC-33174915-33173974
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258952
Homologene: 74160
Olfr453
Name: olfactory receptor 453
Synonyms: MOR257-8P, GA_x6K02T2P3E9-4815856-4814903
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
HGNC: HGNC:8246
Homologene: 128151
Golim4
Name: golgi integral membrane protein 4
Synonyms: GPP130, 3110027H23Rik, Golph4, P138
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73124
Homologene: 8716
Gm8374
Name: predicted gene 8374
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Kiss1
Name: KiSS-1 metastasis-suppressor
Synonyms: metastin, kisspeptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 280287
HGNC: HGNC:6341
Homologene: 1701
Isoc2b
Name: isochorismatase domain containing 2b
Synonyms: 0610042E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67441
Homologene: 85975
AC171501.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Bbc3
Name: BCL2 binding component 3
Synonyms: PUMA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 170770
Homologene: 8679
Ssxa1
Name: synovial sarcoma, X member A1
Synonyms: LOC385338
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 385338
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,169,843 bp
  • A to G, chromosome 1 at 74,461,656 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • G to A, chromosome 1 at 133,387,071 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • TCTTCCTTCCTTCCTT to TCTTCCTTCCTTCCTTCCTTCCTT, chromosome 1 at 134,969,213 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • T to A, chromosome 1 at 153,127,124 bp
  • T to A, chromosome 2 at 24,952,636 bp
  • A to G, chromosome 2 at 32,923,647 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • T to C, chromosome 2 at 76,742,517 bp
  • G to T, chromosome 3 at 10,335,218 bp
  • T to C, chromosome 3 at 59,865,348 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • T to A, chromosome 3 at 103,735,869 bp
  • T to A, chromosome 3 at 106,570,760 bp
  • T to A, chromosome 3 at 108,351,686 bp
  • T to A, chromosome 3 at 116,539,124 bp
  • T to C, chromosome 3 at 118,674,568 bp
  • T to C, chromosome 3 at 134,932,180 bp
  • T to C, chromosome 3 at 148,890,488 bp
  • C to T, chromosome 4 at 33,225,764 bp
  • G to A, chromosome 4 at 45,903,835 bp
  • T to C, chromosome 4 at 132,544,059 bp
  • T to A, chromosome 4 at 141,005,016 bp
  • T to C, chromosome 4 at 141,029,102 bp
  • C to T, chromosome 4 at 145,156,101 bp
  • T to C, chromosome 5 at 110,202,939 bp
  • T to A, chromosome 5 at 129,787,539 bp
  • G to A, chromosome 5 at 134,136,153 bp
  • T to A, chromosome 5 at 136,012,040 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • T to C, chromosome 5 at 151,045,168 bp
  • C to A, chromosome 6 at 12,100,187 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • G to A, chromosome 6 at 67,725,334 bp
  • T to C, chromosome 6 at 121,325,041 bp
  • C to T, chromosome 6 at 125,657,057 bp
  • T to C, chromosome 6 at 128,491,161 bp
  • T to A, chromosome 6 at 128,576,260 bp
  • A to G, chromosome 6 at 137,411,116 bp
  • A to T, chromosome 7 at 4,851,439 bp
  • T to C, chromosome 7 at 16,312,343 bp
  • T to A, chromosome 7 at 105,143,550 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • A to G, chromosome 7 at 126,390,462 bp
  • A to G, chromosome 7 at 126,587,206 bp
  • T to A, chromosome 7 at 135,704,241 bp
  • T to C, chromosome 8 at 63,927,147 bp
  • T to A, chromosome 8 at 105,092,975 bp
  • A to T, chromosome 8 at 111,297,402 bp
  • A to T, chromosome 8 at 128,498,516 bp
  • A to T, chromosome 9 at 7,011,253 bp
  • T to C, chromosome 9 at 72,308,005 bp
  • A to G, chromosome 9 at 73,013,158 bp
  • G to T, chromosome 10 at 11,609,369 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • A to T, chromosome 10 at 91,060,165 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • A to G, chromosome 11 at 29,557,663 bp
  • C to A, chromosome 11 at 48,807,592 bp
  • A to G, chromosome 11 at 49,180,696 bp
  • T to A, chromosome 11 at 62,859,857 bp
  • A to G, chromosome 11 at 68,807,289 bp
  • T to G, chromosome 11 at 68,968,965 bp
  • A to G, chromosome 11 at 80,817,522 bp
  • A to G, chromosome 11 at 87,797,361 bp
  • G to A, chromosome 11 at 97,033,309 bp
  • A to G, chromosome 11 at 97,451,561 bp
  • A to T, chromosome 11 at 99,985,776 bp
  • A to T, chromosome 11 at 100,894,149 bp
  • G to A, chromosome 11 at 115,871,643 bp
  • C to T, chromosome 11 at 116,448,417 bp
  • T to C, chromosome 12 at 69,185,294 bp
  • T to A, chromosome 12 at 79,268,434 bp
  • T to G, chromosome 12 at 87,452,703 bp
  • T to A, chromosome 13 at 63,210,149 bp
  • A to T, chromosome 13 at 67,408,276 bp
  • T to C, chromosome 13 at 81,581,727 bp
  • A to G, chromosome 13 at 94,192,049 bp
  • T to C, chromosome 14 at 7,364,194 bp
  • T to A, chromosome 14 at 27,446,388 bp
  • A to G, chromosome 14 at 27,476,614 bp
  • A to G, chromosome 14 at 30,178,744 bp
  • T to C, chromosome 14 at 56,493,354 bp
  • T to C, chromosome 14 at 70,638,487 bp
  • T to A, chromosome 15 at 35,671,400 bp
  • T to A, chromosome 15 at 98,075,967 bp
  • A to T, chromosome 15 at 99,671,875 bp
  • T to C, chromosome 17 at 74,659,154 bp
  • A to G, chromosome 19 at 10,596,041 bp
  • T to G, chromosome 19 at 53,926,326 bp
  • G to A, chromosome 19 at 57,654,994 bp
  • T to A, chromosome X at 21,119,342 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2130 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040133-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.