Strain Name:
Stock Number:
Citation ID:
Other Names:
R2130 (G1), C57BL/6J-MtgxR2130Btlr
Major Collection:

Strain Information

Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20661
Homologene: 136097
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
Homologene: 66273
Name: triokinase, FMN cyclase
Synonyms: Dak
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225913
VEGA: 19
Homologene: 56710
Name: tachykinin receptor 3
Synonyms: neuromedin K receptor, Tac3r, Nk3r
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21338
Homologene: 824
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71517
Homologene: 10659
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain II-B, NMHC-B, SMemb, nonmuscle myosin heavy chain IIB, 9330167F11Rik, 5730504C04Rik, NMHC II-B, Myhn2, Myosin IIB, Myhn-2, myosin IIB, Fltn, Fltn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
Homologene: 55941
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Name: chaperonin containing TCP1 subunit 6A
Synonyms: Cctz-1, chaperonin containing TCP-1, Cct6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12466
Homologene: 1336
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235469
Homologene: 17151
Name: signal transducer and activator of transcription 3
Synonyms: Aprf, 1110034C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20848
Homologene: 7960
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231876
Homologene: 8948
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
Homologene: 1814
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, MommeD6, Fam208a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11783
Homologene: 7626
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223870
Homologene: 8731
Name: niban apoptosis regulator 2
Synonyms: 9130404D14Rik, Fam129b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227737
Homologene: 11269
Name: SNW domain containing 1
Synonyms: SKIP, NCoA-62, SNW1, 2310008B08Rik, Skiip
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66354
VEGA: 12
Homologene: 56557
Name: ring finger protein 17
Synonyms: MMIP-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30054
VEGA: 14
Homologene: 23727
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226432
Homologene: 5874
Name: DnaJ heat shock protein family (Hsp40) member C8
Synonyms: 1110021D09Rik, 2010009J04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68598
Homologene: 40935
Name: Rho GTPase activating protein 23
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58996
Homologene: 104145
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
Homologene: 49516
Name: golgin A3
Synonyms: Mea-2, Mea2, 5430416E01Rik, G1-499-14, repro27
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269682
Homologene: 4308
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234736
Homologene: 41230
Name: clathrin heavy chain linker domain containing 1
Synonyms: 1700034F02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73324
Homologene: 17569
Name: synaptotagmin II
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20980
Homologene: 22516
Name: butyrophilin-like 9
Synonyms: D330012D11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237754
Homologene: 68540
Name: DNA-damage regulated autophagy modulator 2
Synonyms: 2010305N14Rik, 2610318G18Rik, Tmem77
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67171
Homologene: 23565
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
Homologene: 14468
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Name: ubiquitin specific peptidase 37
Synonyms: 4932415L06Rik, C330008N13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319651
Homologene: 10858
Name: zinc finger protein 459
Synonyms: Rslcan-14, 9930025G17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328274
Name: transmembrane protein 98
Synonyms: 6530411B15Rik, Rwhs
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103743
Homologene: 9185
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67196
Homologene: 40929
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11567
Homologene: 38200
Name: fibroblast growth factor 17
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14171
VEGA: 14
Homologene: 2872
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: insulin receptor-related receptor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23920
Homologene: 56539
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99586
Homologene: 85
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
Homologene: 578
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16574
Homologene: 56234
Name: protein tyrosine phosphatase receptor type O
Synonyms: D28, PTPROt, PTP-phi, PTP-BK, PTP-U2, GLEPP1, PTP-oc, Ptpn15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19277
Homologene: 21564
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Name: dihydrolipoamide branched chain transacylase E2
Synonyms: BCKAD E2, D3Wsu60e, dihydrolipoyl transacylase, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13171
Homologene: 1444
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18186
Homologene: 2876
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71724
Homologene: 90899
Name: F-box and WD-40 domain protein 10
Synonyms: SM2SH2, SM25H2, Fbw10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 213980
Homologene: 32757
Name: myeloperoxidase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17523
Homologene: 55450
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240753
Homologene: 135779
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Name: acid-sensing ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11419
VEGA: 15
Homologene: 121755
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70381
Homologene: 9120
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Name: solute carrier family 25, member 35
Synonyms: 1810012H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71998
Homologene: 6343
Name: olfactomedin-like 3
Synonyms: HNOEL-iso, 2810002E22Rik, mONT3, ONT3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99543
Homologene: 10613
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 interacting protein
Synonyms: NIP45, D7Ertd304e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18020
Homologene: 7862
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230872
Homologene: 16811
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Name: serine and arginine-rich splicing factor 12
Synonyms: Srrp, Sfrs13b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 272009
Name: keratin associated protein 16-1
Synonyms: AI450886
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100504183
Homologene: 99988
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms: Gabt3, Gat2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14412
Homologene: 9592
Name: olfactory receptor family 56 subfamily A member 5
Synonyms: GA_x6K02T2PBJ9-7773007-7772066, MOR40-1, Olfr683
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259047
Homologene: 133645
Name: carboxylesterase 3B
Synonyms: ES31L, Gm4738
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13909
Homologene: 84407
Name: renin 1 structural
Synonyms: Ren1d, Ren, Rnr, Ren-A, Rn-1, Ren-1, Ren1c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19701
Homologene: 20151
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Name: lipoma HMGIC fusion partner-like 2
Synonyms: vgim
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218454
Homologene: 4222
Name: laminin, gamma 2
Synonyms: nicein, 100kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16782
Homologene: 4062
Name: tripartite motif-containing 41
Synonyms: RINCK
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 211007
Homologene: 14140
Name: predicted pseudogene 9797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 100039343
VEGA: 10
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20822
Homologene: 3383
Name: zinc finger, MYND domain containing 19
Synonyms: 2700064H14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67187
Homologene: 12093
Name: predicted gene 6578
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 625347
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545366
Homologene: 134349
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
Name: deltex 2, E3 ubiquitin ligase
Synonyms: 2610524D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74198
Homologene: 56904
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20668
Homologene: 4159
Name: secernin 2
Synonyms: SES2, D11Moh48
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217140
Homologene: 26698
Name: mannoside acetylglucosaminyltransferase 2
Synonyms: GNT-II, CDGS2, GNT2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217664
Homologene: 1806
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 5
Synonyms: LOC241877
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241877
Homologene: 78106
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Name: cell cycle progression 1
Synonyms: 1700030B06Rik, 1810073J13Rik, D9Ertd392e, 9430028F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72278
Homologene: 3487
Name: apolipoprotein B receptor
Synonyms: Apob-48r, Apob48r
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171504
Homologene: 26695
Name: ATPase type 13A2
Synonyms: 1110012E06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74772
Homologene: 56940
Name: cytosolic arginine sensor for mTORC1 subunit 2
Synonyms: Gats, Gatsl2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80909
Homologene: 84866
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21956
Homologene: 68050
Name: opticin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269120
Homologene: 8652
Name: programmed cell death 4
Synonyms: MA-3, TIS, D19Ucla1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18569
VEGA: 19
Homologene: 7879
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116847
Homologene: 2041
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258952
Homologene: 74160
Name: olfactory receptor family 2 subfamily F member 1
Synonyms: GA_x6K02T2P3E9-4815856-4814903, MOR257-8P, Olfr453
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258016
Homologene: 128151
Name: golgi integral membrane protein 4
Synonyms: GPP130, P138, 3110027H23Rik, Golph4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73124
Homologene: 8716
Name: predicted gene 8374
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Name: KiSS-1 metastasis-suppressor
Synonyms: metastin, kisspeptin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 280287
Homologene: 1701
Name: isochorismatase domain containing 2b
Synonyms: 0610042E07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67441
Homologene: 85975
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Name: BCL2 binding component 3
Synonyms: PUMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170770
Homologene: 8679
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,169,843 bp
  • A to G, chromosome 1 at 74,461,656 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • G to A, chromosome 1 at 133,387,071 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • TCTTCCTTCCTTCCTT to TCTTCCTTCCTTCCTTCCTTCCTT, chromosome 1 at 134,969,213 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • T to A, chromosome 1 at 153,127,124 bp
  • T to A, chromosome 2 at 24,952,636 bp
  • A to G, chromosome 2 at 32,923,647 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • T to C, chromosome 2 at 76,742,517 bp
  • G to T, chromosome 3 at 10,335,218 bp
  • T to C, chromosome 3 at 59,865,348 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • T to A, chromosome 3 at 103,735,869 bp
  • T to A, chromosome 3 at 106,570,760 bp
  • T to A, chromosome 3 at 108,351,686 bp
  • T to A, chromosome 3 at 116,539,124 bp
  • T to C, chromosome 3 at 118,674,568 bp
  • T to C, chromosome 3 at 134,932,180 bp
  • T to C, chromosome 3 at 148,890,488 bp
  • C to T, chromosome 4 at 33,225,764 bp
  • G to A, chromosome 4 at 45,903,835 bp
  • T to C, chromosome 4 at 132,544,059 bp
  • T to A, chromosome 4 at 141,005,016 bp
  • T to C, chromosome 4 at 141,029,102 bp
  • C to T, chromosome 4 at 145,156,101 bp
  • T to C, chromosome 5 at 110,202,939 bp
  • T to A, chromosome 5 at 129,787,539 bp
  • G to A, chromosome 5 at 134,136,153 bp
  • T to A, chromosome 5 at 136,012,040 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • T to C, chromosome 5 at 151,045,168 bp
  • C to A, chromosome 6 at 12,100,187 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • G to A, chromosome 6 at 67,725,334 bp
  • T to C, chromosome 6 at 121,325,041 bp
  • C to T, chromosome 6 at 125,657,057 bp
  • T to C, chromosome 6 at 128,491,161 bp
  • T to A, chromosome 6 at 128,576,260 bp
  • A to G, chromosome 6 at 137,411,116 bp
  • A to T, chromosome 7 at 4,851,439 bp
  • T to C, chromosome 7 at 16,312,343 bp
  • T to A, chromosome 7 at 105,143,550 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • A to G, chromosome 7 at 126,390,462 bp
  • A to G, chromosome 7 at 126,587,206 bp
  • T to A, chromosome 7 at 135,704,241 bp
  • T to C, chromosome 8 at 63,927,147 bp
  • T to A, chromosome 8 at 105,092,975 bp
  • A to T, chromosome 8 at 111,297,402 bp
  • A to T, chromosome 8 at 128,498,516 bp
  • A to T, chromosome 9 at 7,011,253 bp
  • T to C, chromosome 9 at 72,308,005 bp
  • A to G, chromosome 9 at 73,013,158 bp
  • G to T, chromosome 10 at 11,609,369 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • A to T, chromosome 10 at 91,060,165 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • A to G, chromosome 11 at 29,557,663 bp
  • C to A, chromosome 11 at 48,807,592 bp
  • A to G, chromosome 11 at 49,180,696 bp
  • T to A, chromosome 11 at 62,859,857 bp
  • A to G, chromosome 11 at 68,807,289 bp
  • T to G, chromosome 11 at 68,968,965 bp
  • A to G, chromosome 11 at 80,817,522 bp
  • A to G, chromosome 11 at 87,797,361 bp
  • G to A, chromosome 11 at 97,033,309 bp
  • A to G, chromosome 11 at 97,451,561 bp
  • A to T, chromosome 11 at 99,985,776 bp
  • A to T, chromosome 11 at 100,894,149 bp
  • G to A, chromosome 11 at 115,871,643 bp
  • C to T, chromosome 11 at 116,448,417 bp
  • T to C, chromosome 12 at 69,185,294 bp
  • T to A, chromosome 12 at 79,268,434 bp
  • T to G, chromosome 12 at 87,452,703 bp
  • T to A, chromosome 13 at 63,210,149 bp
  • A to T, chromosome 13 at 67,408,276 bp
  • T to C, chromosome 13 at 81,581,727 bp
  • A to G, chromosome 13 at 94,192,049 bp
  • T to C, chromosome 14 at 7,364,194 bp
  • T to A, chromosome 14 at 27,446,388 bp
  • A to G, chromosome 14 at 27,476,614 bp
  • A to G, chromosome 14 at 30,178,744 bp
  • T to C, chromosome 14 at 56,493,354 bp
  • T to C, chromosome 14 at 70,638,487 bp
  • T to A, chromosome 15 at 35,671,400 bp
  • T to A, chromosome 15 at 98,075,967 bp
  • A to T, chromosome 15 at 99,671,875 bp
  • T to C, chromosome 17 at 74,659,154 bp
  • A to G, chromosome 19 at 10,596,041 bp
  • T to G, chromosome 19 at 53,926,326 bp
  • G to A, chromosome 19 at 57,654,994 bp
  • T to A, chromosome X at 21,119,342 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2130 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040133-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.