Strain Name:
C57BL/6J-MtgxR2140Btlr/Mmmh
Stock Number:
040143-MU
Citation ID:
RRID:MMRRC_040143-MU
Other Names:
R2140 (G1), C57BL/6J-MtgxR2140Btlr
Major Collection:

Gene Information

Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Septin4
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, ARTS, Sept4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11426
Homologene: 136191
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Mcm3
Name: minichromosome maintenance complex component 3
Synonyms: p1.m, P1, Mcmd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17215
HGNC: HGNC:6945
Homologene: 1791
Xrcc6
Name: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: Ku p70, Ku70, G22p1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
R3hdm1
Name: R3H domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226412
HGNC: HGNC:9757
Homologene: 9108
Laptm4b
Name: lysosomal-associated protein transmembrane 4B
Synonyms: C330023P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 114128
VEGA: 15
Homologene: 10182
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231876
Homologene: 8948
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Tasor
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, MommeD6, Fam208a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Afdn
Name: afadin, adherens junction formation factor
Synonyms: AF6, Afadin, S-afadin, I-afadin, 5033403D15Rik, Mllt4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Eif3a
Name: eukaryotic translation initiation factor 3, subunit A
Synonyms: Csma, Eif3, A830012B05Rik, Eif3s10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13669
VEGA: 19
HGNC: HGNC:3271
Homologene: 2779
Slitrk6
Name: SLIT and NTRK-like family, member 6
Synonyms: 4832410J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239250
VEGA: 14
Homologene: 12986
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 21844
Homologene: 2443
Atp9b
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Gm14124
Name: predicted gene 14124
Synonyms: EG640962, Gm10749
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100216455
Homologene: 134546
Dars
Name: aspartyl-tRNA synthetase
Synonyms: 5730439G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226414
HGNC: HGNC:2678
Homologene: 1032
Wwc1
Name: WW, C2 and coiled-coil domain containing 1
Synonyms: Kibra
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 211652
Homologene: 69180
Hook1
Name: hook microtubule tethering protein 1
Synonyms: azh, abnormal spermatozoon head shape, A930033L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77963
Homologene: 9289
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Garem1
Name: GRB2 associated regulator of MAPK1 subtype 1
Synonyms: LOC381126, Fam59a, Garem
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381126
VEGA: 18
Homologene: 11237
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Urb, Ssg1, 2610001E17Rik, DRO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67896
Homologene: 12206
Gucy1a1
Name: guanylate cyclase 1, soluble, alpha 1
Synonyms: alpha 1 sGC, 1200016O07Rik, sGC-alpha1, Gucy1a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 60596
HGNC: HGNC:4685
Homologene: 37360
Myt1
Name: myelin transcription factor 1
Synonyms: NZF-2b, NZF-2a, Nzf2, Nztf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Plxnb2
Name: plexin B2
Synonyms: Debt, 1110007H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Cir1
Name: corepressor interacting with RBPJ, 1
Synonyms: 2810021A19Rik, CIR, 1700023B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66935
Homologene: 3589
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Nmbr
Name: neuromedin B receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18101
HGNC: HGNC:7843
Homologene: 20560
Far1
Name: fatty acyl CoA reductase 1
Synonyms: 2600011M19Rik, 3732409C05Rik, Mlstd2, 2900034E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67420
Homologene: 41718
Dck
Name: deoxycytidine kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13178
HGNC: HGNC:2704
Homologene: 616
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Cntrl
Name: centriolin
Synonyms: IB3/5, 6720467O09Rik, Ma2a8, Cep1, b2b1468Clo, Cep110
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Esco1
Name: establishment of sister chromatid cohesion N-acetyltransferase 1
Synonyms: A930014I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 77805
Homologene: 62166
Nle1
Name: notchless homolog 1
Synonyms: notchless, Nle, l11Jus4, l11Jus1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217011
Homologene: 5494
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Pram1
Name: PML-RAR alpha-regulated adaptor molecule 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 378460
Homologene: 12963
Scin
Name: scinderin
Synonyms: adseverin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20259
Homologene: 36296
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78249
Homologene: 51953
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Pcdh7
Name: protocadherin 7
Synonyms: BH-protocadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54216
HGNC: HGNC:8659
Homologene: 36101
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1203Clo, b2b1279Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Prdm1
Name: PR domain containing 1, with ZNF domain
Synonyms: PRDI-BF1, Blimp1, Blimp-1, b2b1765Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12142
HGNC: HGNC:9346
Homologene: 925
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Agfg2
Name: ArfGAP with FG repeats 2
Synonyms: A630095P14Rik, Hrbl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231801
HGNC: HGNC:5177
Homologene: 4430
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20192
Homologene: 68151
Madd
Name: MAP-kinase activating death domain
Synonyms: 9630059K23Rik, Rab3 GEP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228355
HGNC: HGNC:6766
Homologene: 14249
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56552
Homologene: 135915
Pglyrp3
Name: peptidoglycan recognition protein 3
Synonyms: LOC242100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242100
Homologene: 71559
Ptprt
Name: protein tyrosine phosphatase, receptor type, T
Synonyms: RPTPrho
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19281
HGNC: HGNC:9682
Homologene: 56924
Slc7a4
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224022
Homologene: 20883
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 214321
Homologene: 86950
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Olfr1168
Name: olfactory receptor 1168
Synonyms: GA_x6K02T2Q125-49669483-49670421, MOR174-13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258524
Homologene: 128091
4933424B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Cfap300
Name: cilia and flagella associated protein 300
Synonyms: 9230110C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 234912
VEGA: 9
Homologene: 13163
Nos1ap
Name: nitric oxide synthase 1 (neuronal) adaptor protein
Synonyms: 6330408P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70729
Homologene: 135990
Naaladl1
Name: N-acetylated alpha-linked acidic dipeptidase-like 1
Synonyms: LOC381204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381204
Homologene: 21124
Lrrk1
Name: leucine-rich repeat kinase 1
Synonyms: D130026O16Rik, C230002E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233328
Homologene: 23464
Kctd16
Name: potassium channel tetramerisation domain containing 16
Synonyms: 4930434H12Rik, LOC383347, 2900055J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 73001
VEGA: 18
Homologene: 44779
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665227
Homologene: 129751
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Rab7b
Name: RAB7B, member RAS oncogene family
Synonyms: Rab7b, 5430435G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226421
Homologene: 64833
Myot
Name: myotilin
Synonyms: 5530402I04Rik, Ttid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 58916
Homologene: 4942
Bscl2
Name: Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonyms: seipin, Gng3lg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14705
Homologene: 32032
Alppl2
Name: alkaline phosphatase, placental-like 2
Synonyms: D1Ertd816e, Akp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11650
Homologene: 129600
Cenpj
Name: centromere protein J
Synonyms: 4932437H03Rik, Sas4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219103
Homologene: 10204
Olfr1099
Name: olfactory receptor 1099
Synonyms: GA_x6K02T2Q125-48446067-48445129, MOR206-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258764
Homologene: 107003
Adgrf1
Name: adhesion G protein-coupled receptor F1
Synonyms: 5031409J19Rik, Gpr110
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 77596
Homologene: 124643
Arhgap26
Name: Rho GTPase activating protein 26
Synonyms: 1810044B20Rik, 2610010G17Rik, 4933432P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 71302
Homologene: 36349
Krt82
Name: keratin 82
Synonyms: Krt2-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 114566
VEGA: 15
HGNC: HGNC:6459
Homologene: 13200
Trim5
Name: tripartite motif-containing 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 667823
Homologene: 75345
Nostrin
Name: nitric oxide synthase trafficker
Synonyms: mDaIP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329416
Homologene: 43142
Nid1
Name: nidogen 1
Synonyms: entactin, entactin 1, nidogen-1, entactin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Cyp3a13
Name: cytochrome P450, family 3, subfamily a, polypeptide 13
Synonyms: IIIAm2, steroid inducible
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13113
HGNC: HGNC:2640
Homologene: 133564
Alkbh2
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: Abh2, mABH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231642
Homologene: 18393
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
Fmn1
Name: formin 1
Synonyms: Fmn, formin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Slc23a1
Name: solute carrier family 23 (nucleobase transporters), member 1
Synonyms: YSPL3, SVCT1, D18Ucla2, Slc23a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 20522
Homologene: 40769
Olfr1240
Name: olfactory receptor 1240
Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
Rnf144b
Name: ring finger protein 144B
Synonyms: E130105P19Rik, Ibrdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218215
VEGA: 13
Homologene: 27092
Olfr378
Name: olfactory receptor 378
Synonyms: GA_x6K02T2P1NL-3586282-3585338, MOR135-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 259026
Homologene: 74110
Tmem39b
Name: transmembrane protein 39b
Synonyms: 6330509E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230770
Homologene: 23069
Kat5
Name: K(lysine) acetyltransferase 5
Synonyms: Tip60, PLIP, mHTATIP/CPLA2, Htatip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 81601
VEGA: 19
HGNC: HGNC:5275
Homologene: 100661
Exoc8
Name: exocyst complex component 8
Synonyms: Exo84p, SEC84, EXO84
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102058
Homologene: 44545
Lrrc58
Name: leucine rich repeat containing 58
Synonyms: C330018J07Rik, 1810012N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 320184
Homologene: 14598
Foxl2
Name: forkhead box L2
Synonyms: Pfrk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 26927
HGNC: HGNC:1092
Homologene: 74992
Cnksr1
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 194231
Homologene: 4604
Olfr115
Name: olfactory receptor 115
Synonyms: MOR218-11P, GA_x6K02T2PSCP-2070203-2069271
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 257908
Homologene: 115497
Glyatl3
Name: glycine-N-acyltransferase-like 3
Synonyms: Gm5683
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 435528
VEGA: 17
Homologene: 19824
Slfn9
Name: schlafen 9
Synonyms: 9830137M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237886
Homologene: 45432
Fpr3
Name: formyl peptide receptor 3
Synonyms: Lxa4r, LXA4-R, Fprl1, Fpr-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14294
HGNC: HGNC:3828
Aqp2
Name: aquaporin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11827
VEGA: 15
HGNC: HGNC:634
Homologene: 20137
Eef1a2
Name: eukaryotic translation elongation factor 1 alpha 2
Synonyms: Eef1a, S1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13628
HGNC: HGNC:3192
Homologene: 121568
AU016765
Name: expressed sequence AU016765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100043582
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Olfr283
Name: olfactory receptor 283
Synonyms: GA_x6K02T2NBG7-5351896-5352825, MOR160-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 259038
Homologene: 64944
Rab17
Name: RAB17, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19329
Homologene: 7502
4931440P22Rik
Name: RIKEN cDNA 4931440P22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71004
2610042L04Rik
Name: RIKEN cDNA 2610042L04 gene
Synonyms: takusan, Tksn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 554327
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,813,110 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • T to A, chromosome 1 at 53,281,988 bp
  • A to G, chromosome 1 at 87,087,697 bp
  • A to G, chromosome 1 at 90,960,078 bp
  • A to G, chromosome 1 at 128,190,693 bp
  • T to A, chromosome 1 at 128,372,162 bp
  • T to A, chromosome 1 at 131,698,419 bp
  • T to C, chromosome 1 at 139,237,012 bp
  • T to A, chromosome 1 at 170,329,166 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • A to C, chromosome 2 at 69,166,003 bp
  • A to T, chromosome 2 at 73,312,437 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • A to T, chromosome 2 at 86,959,281 bp
  • A to T, chromosome 2 at 88,185,095 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • A to G, chromosome 2 at 91,152,509 bp
  • A to G, chromosome 2 at 112,875,148 bp
  • A to G, chromosome 2 at 113,595,048 bp
  • C to A, chromosome 2 at 125,343,810 bp
  • A to T, chromosome 2 at 150,269,361 bp
  • A to G, chromosome 2 at 155,620,123 bp
  • G to A, chromosome 2 at 161,811,988 bp
  • C to T, chromosome 2 at 181,148,742 bp
  • C to A, chromosome 2 at 181,825,979 bp
  • C to A, chromosome 3 at 65,529,252 bp
  • C to T, chromosome 3 at 82,118,886 bp
  • T to G, chromosome 3 at 92,026,567 bp
  • GATGAATGA to GATGA, chromosome 4 at 96,013,312 bp
  • C to T, chromosome 4 at 123,355,102 bp
  • T to C, chromosome 4 at 129,678,688 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • T to A, chromosome 5 at 58,128,996 bp
  • T to C, chromosome 5 at 88,772,723 bp
  • C to T, chromosome 5 at 114,125,716 bp
  • C to T, chromosome 5 at 124,768,784 bp
  • T to A, chromosome 5 at 137,667,116 bp
  • A to T, chromosome 5 at 137,921,454 bp
  • A to G, chromosome 5 at 144,147,615 bp
  • A to T, chromosome 6 at 124,061,237 bp
  • A to G, chromosome 6 at 146,576,431 bp
  • A to T, chromosome 7 at 66,330,750 bp
  • G to A, chromosome 7 at 104,276,791 bp
  • G to A, chromosome 7 at 113,566,460 bp
  • A to G, chromosome 7 at 135,695,592 bp
  • C to T, chromosome 8 at 124,897,415 bp
  • T to C, chromosome 9 at 8,022,477 bp
  • C to A, chromosome 9 at 98,956,487 bp
  • C to A, chromosome 10 at 14,770,442 bp
  • A to T, chromosome 10 at 27,054,694 bp
  • G to T, chromosome 10 at 44,441,049 bp
  • A to G, chromosome 11 at 35,870,528 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • A to T, chromosome 11 at 73,425,881 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to G, chromosome 11 at 82,905,568 bp
  • C to T, chromosome 11 at 82,984,655 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to T, chromosome 12 at 40,079,582 bp
  • A to G, chromosome 12 at 81,378,562 bp
  • T to C, chromosome 12 at 118,008,810 bp
  • C to T, chromosome 13 at 11,560,607 bp
  • T to A, chromosome 13 at 13,499,668 bp
  • T to A, chromosome 13 at 47,220,481 bp
  • C to T, chromosome 13 at 68,568,940 bp
  • T to C, chromosome 14 at 4,348,902 bp
  • A to C, chromosome 14 at 23,314,220 bp
  • C to T, chromosome 14 at 27,480,035 bp
  • T to C, chromosome 14 at 56,526,932 bp
  • T to G, chromosome 14 at 110,750,794 bp
  • G to T, chromosome 15 at 34,238,332 bp
  • C to A, chromosome 15 at 66,005,978 bp
  • T to C, chromosome 15 at 76,183,174 bp
  • T to A, chromosome 15 at 82,022,977 bp
  • T to C, chromosome 15 at 89,156,562 bp
  • G to A, chromosome 15 at 98,378,396 bp
  • A to G, chromosome 15 at 99,579,366 bp
  • T to A, chromosome 15 at 101,545,156 bp
  • C to A, chromosome 16 at 17,574,544 bp
  • G to A, chromosome 16 at 37,881,409 bp
  • A to T, chromosome 16 at 45,127,446 bp
  • A to G, chromosome 16 at 89,849,645 bp
  • A to G, chromosome 17 at 13,810,433 bp
  • T to A, chromosome 17 at 17,970,617 bp
  • T to A, chromosome 17 at 18,253,372 bp
  • A to T, chromosome 17 at 33,642,065 bp
  • T to G, chromosome 17 at 37,610,471 bp
  • T to C, chromosome 17 at 40,911,084 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to C, chromosome 17 at 43,300,802 bp
  • T to A, chromosome 17 at 64,520,000 bp
  • A to G, chromosome 18 at 10,574,873 bp
  • T to A, chromosome 18 at 21,129,374 bp
  • C to T, chromosome 18 at 35,626,434 bp
  • C to A, chromosome 18 at 39,245,269 bp
  • A to G, chromosome 18 at 40,259,178 bp
  • A to T, chromosome 18 at 44,354,125 bp
  • A to G, chromosome 18 at 80,736,087 bp
  • T to A, chromosome 19 at 5,605,685 bp
  • T to A, chromosome 19 at 6,106,811 bp
  • T to C, chromosome 19 at 8,845,320 bp
  • A to T, chromosome 19 at 60,775,394 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
(Deceased) Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2140 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040143-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.