Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2140Btlr/Mmmh
Stock Number:
040143-MU
Citation ID:
RRID:MMRRC_040143-MU
Other Names:
R2140 (G1), C57BL/6J-MtgxR2140Btlr
Major Collection:

Strain Information

Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Septin4
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Mcm3
Name: minichromosome maintenance complex component 3
Synonyms: p1.m, P1, Mcmd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17215
HGNC: HGNC:6945
Homologene: 1791
Xrcc6
Name: X-ray repair cross complementing 6
Synonyms: Ku p70, Ku70, G22p1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
R3hdm1
Name: R3H domain containing 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226412
HGNC: HGNC:9757
Homologene: 9108
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,813,110 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • T to A, chromosome 1 at 53,281,988 bp
  • A to G, chromosome 1 at 87,087,697 bp
  • A to G, chromosome 1 at 90,960,078 bp
  • A to G, chromosome 1 at 128,190,693 bp
  • T to A, chromosome 1 at 128,372,162 bp
  • T to A, chromosome 1 at 131,698,419 bp
  • T to C, chromosome 1 at 139,237,012 bp
  • T to A, chromosome 1 at 170,329,166 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • A to C, chromosome 2 at 69,166,003 bp
  • A to T, chromosome 2 at 73,312,437 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • A to T, chromosome 2 at 86,959,281 bp
  • A to T, chromosome 2 at 88,185,095 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • A to G, chromosome 2 at 91,152,509 bp
  • A to G, chromosome 2 at 112,875,148 bp
  • A to G, chromosome 2 at 113,595,048 bp
  • C to A, chromosome 2 at 125,343,810 bp
  • A to T, chromosome 2 at 150,269,361 bp
  • A to G, chromosome 2 at 155,620,123 bp
  • G to A, chromosome 2 at 161,811,988 bp
  • C to T, chromosome 2 at 181,148,742 bp
  • C to A, chromosome 2 at 181,825,979 bp
  • C to A, chromosome 3 at 65,529,252 bp
  • C to T, chromosome 3 at 82,118,886 bp
  • T to G, chromosome 3 at 92,026,567 bp
  • GATGAATGA to GATGA, chromosome 4 at 96,013,312 bp
  • C to T, chromosome 4 at 123,355,102 bp
  • T to C, chromosome 4 at 129,678,688 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • T to A, chromosome 5 at 58,128,996 bp
  • T to C, chromosome 5 at 88,772,723 bp
  • C to T, chromosome 5 at 114,125,716 bp
  • C to T, chromosome 5 at 124,768,784 bp
  • T to A, chromosome 5 at 137,667,116 bp
  • A to T, chromosome 5 at 137,921,454 bp
  • A to G, chromosome 5 at 144,147,615 bp
  • A to T, chromosome 6 at 124,061,237 bp
  • A to G, chromosome 6 at 146,576,431 bp
  • A to T, chromosome 7 at 66,330,750 bp
  • G to A, chromosome 7 at 104,276,791 bp
  • G to A, chromosome 7 at 113,566,460 bp
  • A to G, chromosome 7 at 135,695,592 bp
  • C to T, chromosome 8 at 124,897,415 bp
  • T to C, chromosome 9 at 8,022,477 bp
  • C to A, chromosome 9 at 98,956,487 bp
  • C to A, chromosome 10 at 14,770,442 bp
  • A to T, chromosome 10 at 27,054,694 bp
  • G to T, chromosome 10 at 44,441,049 bp
  • A to G, chromosome 11 at 35,870,528 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • A to T, chromosome 11 at 73,425,881 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to G, chromosome 11 at 82,905,568 bp
  • C to T, chromosome 11 at 82,984,655 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to T, chromosome 12 at 40,079,582 bp
  • A to G, chromosome 12 at 81,378,562 bp
  • T to C, chromosome 12 at 118,008,810 bp
  • C to T, chromosome 13 at 11,560,607 bp
  • T to A, chromosome 13 at 13,499,668 bp
  • T to A, chromosome 13 at 47,220,481 bp
  • C to T, chromosome 13 at 68,568,940 bp
  • T to C, chromosome 14 at 4,348,902 bp
  • A to C, chromosome 14 at 23,314,220 bp
  • C to T, chromosome 14 at 27,480,035 bp
  • T to C, chromosome 14 at 56,526,932 bp
  • T to G, chromosome 14 at 110,750,794 bp
  • G to T, chromosome 15 at 34,238,332 bp
  • C to A, chromosome 15 at 66,005,978 bp
  • T to C, chromosome 15 at 76,183,174 bp
  • T to A, chromosome 15 at 82,022,977 bp
  • T to C, chromosome 15 at 89,156,562 bp
  • G to A, chromosome 15 at 98,378,396 bp
  • A to G, chromosome 15 at 99,579,366 bp
  • T to A, chromosome 15 at 101,545,156 bp
  • C to A, chromosome 16 at 17,574,544 bp
  • G to A, chromosome 16 at 37,881,409 bp
  • A to T, chromosome 16 at 45,127,446 bp
  • A to G, chromosome 16 at 89,849,645 bp
  • A to G, chromosome 17 at 13,810,433 bp
  • T to A, chromosome 17 at 17,970,617 bp
  • T to A, chromosome 17 at 18,253,372 bp
  • A to T, chromosome 17 at 33,642,065 bp
  • T to G, chromosome 17 at 37,610,471 bp
  • T to C, chromosome 17 at 40,911,084 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to C, chromosome 17 at 43,300,802 bp
  • T to A, chromosome 17 at 64,520,000 bp
  • A to G, chromosome 18 at 10,574,873 bp
  • T to A, chromosome 18 at 21,129,374 bp
  • C to T, chromosome 18 at 35,626,434 bp
  • C to A, chromosome 18 at 39,245,269 bp
  • A to G, chromosome 18 at 40,259,178 bp
  • A to T, chromosome 18 at 44,354,125 bp
  • A to G, chromosome 18 at 80,736,087 bp
  • T to A, chromosome 19 at 5,605,685 bp
  • T to A, chromosome 19 at 6,106,811 bp
  • T to C, chromosome 19 at 8,845,320 bp
  • A to T, chromosome 19 at 60,775,394 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2140 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040143-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.