Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2145Btlr/Mmmh
Stock Number:
040148-MU
Citation ID:
RRID:MMRRC_040148-MU
Other Names:
R2145 (G1), C57BL/6J-MtgxR2145Btlr
Major Collection:

Strain Information

Zfa-ps
Name: zinc finger protein, autosomal, pseudogene
Synonyms: Zfa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22639
Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: roquin, 5730557L09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381305
Homologene: 19036
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 21,505,349 bp
  • A to G, chromosome 1 at 42,879,882 bp
  • T to C, chromosome 1 at 43,827,623 bp
  • A to T, chromosome 1 at 71,606,004 bp
  • C to A, chromosome 1 at 75,363,464 bp
  • T to A, chromosome 1 at 93,271,684 bp
  • C to T, chromosome 1 at 93,321,297 bp
  • T to C, chromosome 1 at 130,698,723 bp
  • C to A, chromosome 1 at 131,273,474 bp
  • T to A, chromosome 1 at 132,463,375 bp
  • T to C, chromosome 1 at 134,040,518 bp
  • T to C, chromosome 1 at 138,073,681 bp
  • G to T, chromosome 1 at 160,930,257 bp
  • A to G, chromosome 1 at 164,278,323 bp
  • A to T, chromosome 1 at 166,634,903 bp
  • C to T, chromosome 1 at 174,212,614 bp
  • A to G, chromosome 1 at 175,767,095 bp
  • T to C, chromosome 2 at 31,333,931 bp
  • C to T, chromosome 2 at 36,087,466 bp
  • T to A, chromosome 2 at 52,111,400 bp
  • T to A, chromosome 2 at 71,214,563 bp
  • A to G, chromosome 2 at 73,356,658 bp
  • T to C, chromosome 2 at 119,964,157 bp
  • T to C, chromosome 2 at 121,170,106 bp
  • C to A, chromosome 2 at 126,159,984 bp
  • T to A, chromosome 2 at 127,347,189 bp
  • T to C, chromosome 2 at 158,035,986 bp
  • C to A, chromosome 2 at 168,269,032 bp
  • T to C, chromosome 3 at 5,561,590 bp
  • A to T, chromosome 3 at 79,500,432 bp
  • T to A, chromosome 4 at 11,548,726 bp
  • T to C, chromosome 4 at 52,470,920 bp
  • T to C, chromosome 4 at 132,370,784 bp
  • A to G, chromosome 4 at 155,705,443 bp
  • G to A, chromosome 4 at 155,847,816 bp
  • A to T, chromosome 5 at 24,100,863 bp
  • A to AG, chromosome 5 at 33,769,515 bp
  • A to G, chromosome 5 at 103,556,133 bp
  • T to A, chromosome 5 at 115,552,756 bp
  • C to A, chromosome 5 at 144,743,785 bp
  • A to G, chromosome 5 at 147,530,098 bp
  • A to T, chromosome 6 at 48,976,695 bp
  • A to G, chromosome 6 at 91,028,876 bp
  • T to A, chromosome 6 at 123,779,013 bp
  • A to T, chromosome 7 at 3,844,345 bp
  • A to G, chromosome 7 at 30,105,340 bp
  • G to T, chromosome 7 at 31,291,763 bp
  • A to G, chromosome 7 at 45,887,040 bp
  • A to T, chromosome 7 at 45,998,741 bp
  • T to C, chromosome 7 at 46,066,504 bp
  • G to A, chromosome 7 at 65,655,791 bp
  • T to C, chromosome 7 at 102,555,060 bp
  • T to A, chromosome 7 at 106,603,008 bp
  • A to T, chromosome 7 at 109,475,113 bp
  • A to G, chromosome 7 at 120,354,478 bp
  • C to A, chromosome 7 at 132,883,061 bp
  • C to A, chromosome 8 at 84,921,478 bp
  • A to G, chromosome 8 at 109,724,347 bp
  • T to C, chromosome 8 at 111,282,613 bp
  • T to A, chromosome 8 at 122,479,152 bp
  • G to T, chromosome 9 at 9,748,415 bp
  • T to A, chromosome 9 at 20,937,155 bp
  • C to G, chromosome 9 at 45,044,173 bp
  • T to C, chromosome 9 at 50,764,874 bp
  • T to C, chromosome 9 at 54,415,910 bp
  • C to T, chromosome 9 at 62,732,204 bp
  • T to C, chromosome 9 at 64,909,713 bp
  • A to G, chromosome 9 at 70,934,535 bp
  • A to G, chromosome 9 at 114,464,165 bp
  • T to A, chromosome 10 at 52,543,277 bp
  • T to G, chromosome 11 at 43,490,984 bp
  • T to C, chromosome 11 at 53,632,524 bp
  • T to C, chromosome 11 at 58,220,529 bp
  • T to A, chromosome 11 at 67,091,056 bp
  • A to G, chromosome 11 at 70,671,575 bp
  • G to A, chromosome 11 at 74,425,976 bp
  • A to T, chromosome 11 at 75,647,191 bp
  • G to A, chromosome 11 at 82,917,754 bp
  • T to C, chromosome 11 at 97,373,124 bp
  • A to G, chromosome 11 at 99,006,947 bp
  • T to C, chromosome 11 at 119,415,193 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • A to G, chromosome 12 at 50,489,911 bp
  • A to G, chromosome 12 at 69,741,054 bp
  • A to T, chromosome 13 at 20,840,096 bp
  • C to T, chromosome 13 at 22,501,783 bp
  • T to C, chromosome 13 at 23,562,356 bp
  • G to A, chromosome 13 at 54,738,632 bp
  • T to C, chromosome 13 at 62,517,834 bp
  • G to T, chromosome 13 at 119,455,682 bp
  • A to G, chromosome 14 at 26,949,619 bp
  • G to A, chromosome 14 at 47,395,923 bp
  • C to T, chromosome 15 at 6,765,107 bp
  • T to A, chromosome 15 at 41,819,944 bp
  • A to T, chromosome 15 at 44,512,877 bp
  • T to A, chromosome 15 at 58,627,534 bp
  • T to A, chromosome 16 at 4,613,642 bp
  • T to C, chromosome 16 at 13,412,586 bp
  • A to T, chromosome 16 at 18,280,230 bp
  • A to T, chromosome 16 at 31,105,524 bp
  • G to T, chromosome 16 at 34,009,262 bp
  • T to C, chromosome 16 at 50,274,544 bp
  • A to T, chromosome 17 at 6,050,785 bp
  • A to G, chromosome 17 at 25,144,451 bp
  • A to T, chromosome 17 at 34,242,580 bp
  • A to G, chromosome 17 at 47,466,098 bp
  • A to T, chromosome 17 at 74,660,413 bp
  • A to T, chromosome 17 at 88,015,724 bp
  • T to G, chromosome 19 at 4,903,707 bp
  • A to G, chromosome 19 at 58,676,444 bp
  • A to G, chromosome X at 21,081,951 bp
  • A to T, chromosome X at 152,338,894 bp
  • C to A, chromosome X at 159,824,496 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2145 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040148-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.