Strain Name:
C57BL/6J-MtgxR2145Btlr/Mmmh
Stock Number:
040148-MU
Citation ID:
RRID:MMRRC_040148-MU
Other Names:
R2145 (G1), C57BL/6J-MtgxR2145Btlr
Major Collection:

Strain Information

Fn1
Name: fibronectin 1
Synonyms: Fn-1, Fn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14268
HGNC: HGNC:3778
Homologene: 1533
Zfa-ps
Name: zinc finger protein, autosomal, pseudogene
Synonyms: Zfa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22639
Mrtfb
Name: myocardin related transcription factor B
Synonyms: Mrtfb, Mkl2, MRTF-B, Gt4-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239719
Homologene: 40917
Lhx6
Name: LIM homeobox protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16874
Homologene: 7401
Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: 5730557L09Rik, roquin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381305
Homologene: 19036
Pxn
Name: paxillin
Synonyms: Pax
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19303
HGNC: HGNC:9718
Homologene: 37697
Mga
Name: MAX gene associated
Synonyms: D030062C11Rik, Mga, Mad5, C130042M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 29808
Homologene: 49351
Ssu72
Name: Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)
Synonyms: 1190002E22Rik, 1500011L16Rik, 2610101M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68991
Homologene: 6754
Zfp934
Name: zinc finger protein 934
Synonyms: 6720457D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 77117
VEGA: 13
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: D530039E11Rik, 4921505C17Rik, 6030405M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Dnmt1
Name: DNA methyltransferase (cytosine-5) 1
Synonyms: MTase, MommeD2, Dnmt1o, Cxxc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: Smc2l1, Fin16, CAP-E, 5730502P04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14211
Homologene: 4705
Inpp5k
Name: inositol polyphosphate 5-phosphatase K
Synonyms: putative PI-5-phosphatase, C62, PI-5-phosphatase related, Pps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19062
Homologene: 75059
Bbx
Name: bobby sox HMG box containing
Synonyms: 5530401J07Rik, 5730403O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70508
Homologene: 10634
Paip1
Name: polyadenylate binding protein-interacting protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218693
Homologene: 4709
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66185
Homologene: 41043
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430040A19Rik, Bruce, A430032G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12211
Homologene: 7248
Nomo1
Name: nodal modulator 1
Synonyms: PM5, D7Ertd156e, Nomo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 211548
Homologene: 13810
Dlgap5
Name: DLG associated protein 5
Synonyms: Hurp, Dlg7, C86398
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218977
Homologene: 8840
Clcn7
Name: chloride channel, voltage-sensitive 7
Synonyms: ClC-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26373
HGNC: HGNC:2025
Homologene: 56546
Top2a
Name: topoisomerase (DNA) II alpha
Synonyms: Top-2, DNA Topoisomerase II alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21973
Homologene: 830
Klhl7
Name: kelch-like 7
Synonyms: 2700038B03Rik, D5Ertd363e, SBBI26, Klhl6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 52323
Homologene: 10317
Rprd1b
Name: regulation of nuclear pre-mRNA domain containing 1B
Synonyms: 2810446G03Rik, 2610304G08Rik, Crept
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70470
Homologene: 41426
Socs7
Name: suppressor of cytokine signaling 7
Synonyms: 2310063P06Rik, Nap4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192157
Homologene: 16331
Rif1
Name: replication timing regulatory factor 1
Synonyms: 6530403D07Rik, 5730435J01Rik, D2Ertd145e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 51869
Homologene: 41231
Trim66
Name: tripartite motif-containing 66
Synonyms: D7H11orf29, Tif1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330627
Homologene: 28044
Sh3kbp1
Name: SH3-domain kinase binding protein 1
Synonyms: 5830464D22Rik, Ruk, 1700125L08Rik, IN85, 1200007H22Rik, Seta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 58194
Homologene: 10971
Letm1
Name: leucine zipper-EF-hand containing transmembrane protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56384
HGNC: HGNC:6556
Homologene: 56320
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Pan3
Name: PAN3 poly(A) specific ribonuclease subunit
Synonyms: A430027N15Rik, 2700050F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72587
Homologene: 6372
Lipc
Name: lipase, hepatic
Synonyms: Hpl, HL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 15450
VEGA: 9
HGNC: HGNC:6619
Homologene: 199
Ptprc
Name: protein tyrosine phosphatase receptor type C
Synonyms: Lyt-4, CD45, Ly-5, B220, T200
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Mpzl2
Name: myelin protein zero-like 2
Synonyms: Eva1, Eva
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14012
HGNC: HGNC:3496
Homologene: 7309
Rfwd3
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234736
Homologene: 41230
C1qtnf2
Name: C1q and tumor necrosis factor related protein 2
Synonyms: CTRP2, 1810033K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69183
Homologene: 12899
Glb1
Name: galactosidase, beta 1
Synonyms: Bgl-e, Bge, Bgl-s, Bgt, Bgs, Bgl, C130097A14Rik, Bgl-t
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12091
VEGA: 9
HGNC: HGNC:4298
Homologene: 47922
Dync1i2
Name: dynein cytoplasmic 1 intermediate chain 2
Synonyms: 3110079H08Rik, Dncic2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13427
HGNC: HGNC:2964
Homologene: 37921
Dtwd1
Name: DTW domain containing 1
Synonyms: 1810033A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69185
Homologene: 10633
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 2900057D21Rik, 7330406P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 72993
Homologene: 32143
Glis2
Name: GLIS family zinc finger 2
Synonyms: Nkl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 83396
Homologene: 12821
Phactr4
Name: phosphatase and actin regulator 4
Synonyms: 3110001B12Rik, C330013F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100169
Homologene: 41537
Dgcr8
Name: DGCR8, microprocessor complex subunit
Synonyms: DiGeorge syndrome critical region gene 8, D16H22S1742E, Gy1, D16Wis2, Vo59c07, D16H22S788E, N41
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 94223
HGNC: HGNC:2847
Homologene: 11223
Pask
Name: PAS domain containing serine/threonine kinase
Synonyms: Paskin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269224
Homologene: 9038
Tars3
Name: threonyl-tRNA synthetase 3
Synonyms: A530046H20Rik, Tarsl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 272396
Homologene: 65036
H3c6
Name: H3 clustered histone 6
Synonyms: H3-f, H3.1, Hist1h3e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319151
Homologene: 134496
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, E530005C20Rik, Hapip, 2210407G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Tmem130
Name: transmembrane protein 130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243339
Homologene: 17680
Uxs1
Name: UDP-glucuronate decarboxylase 1
Synonyms: 1600025I13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67883
Homologene: 41609
Gpr155
Name: G protein-coupled receptor 155
Synonyms: DEPDC3, F730029F15Rik, 1110017O10Rik, PGR22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68526
Homologene: 16584
Astl
Name: astacin-like metalloendopeptidase (M12 family)
Synonyms: C87576, Ovastacin, Sas1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 215095
Homologene: 128191
Pex2
Name: peroxisomal biogenesis factor 2
Synonyms: PMP35, Zellweger syndrome homolog, D3Ertd138e, Pxmp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19302
HGNC: HGNC:9717
Homologene: 269
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Ccdc181
Name: coiled-coil domain containing 181
Synonyms: 4930455F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74895
Homologene: 10912
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Rap1gap2
Name: RAP1 GTPase activating protein 2
Synonyms: LOC380710, Garnl4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380711
Homologene: 56695
Bbs1
Name: Bardet-Biedl syndrome 1 (human)
Synonyms: D19Ertd609e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 52028
VEGA: 19
HGNC: HGNC:966
Homologene: 11641
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: Ptpri, PTP-BL, PTPL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Camta2
Name: calmodulin binding transcription activator 2
Synonyms: Kiaa0909-hp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216874
Homologene: 9021
Ctu2
Name: cytosolic thiouridylase subunit 2
Synonyms: 2310061F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66965
Homologene: 79815
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: ihj, Spna1, erythroid, Spna-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20739
Homologene: 74460
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, fibrocystin L, PKHDL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 672511
Homologene: 45439
Gm4847
Name: predicted gene 4847
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226604
Homologene: 101040
Fer1l6
Name: fer-1-like 6 (C. elegans)
Synonyms: EG631797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 631797
Homologene: 53396
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Gvin3
Name: GTPase, very large interferon inducible, family member 3
Synonyms: Gm1966
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434223
Homologene: 32708
Abca15
Name: ATP-binding cassette, sub-family A (ABC1), member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320631
Homologene: 87255
Des
Name: desmin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13346
HGNC: HGNC:2770
Homologene: 56469
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75820
Homologene: 51634
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: Myhse, Myhs-e, MyHC-emb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Abcc6
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms: DCC, Mrp6, Dyscalc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Serac1
Name: serine active site containing 1
Synonyms: 4930511N22Rik, D17Ertd141e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 321007
Homologene: 41900
AI661453
Name: expressed sequence AI661453
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224833
Homologene: 138294
Pfkfb2
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms: PFK-2/FBPase-2 gene B, 4930568D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18640
HGNC: HGNC:8873
Homologene: 88554
Nup210
Name: nucleoporin 210
Synonyms: gp210, Pom210, gp190
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54563
Homologene: 41286
Kcng1
Name: potassium voltage-gated channel, subfamily G, member 1
Synonyms: OTTMUSG00000016048
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241794
HGNC: HGNC:6248
Homologene: 20515
Abraxas2
Name: BRISC complex subunit
Synonyms: KIAA0157, C430003P19Rik, Fam175b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 109359
Homologene: 12970
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: C430014H23Rik, A930019K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Il13
Name: interleukin 13
Synonyms: Il-13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16163
HGNC: HGNC:5973
Homologene: 1649
Fbxo11
Name: F-box protein 11
Synonyms: Jf, GENA 104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 225055
Homologene: 11843
Unc45b
Name: unc-45 myosin chaperone B
Synonyms: D230041A13Rik, UNC45, Cmya4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217012
Homologene: 14666
Scgb1b2
Name: secretoglobin, family 1B, member 2
Synonyms: Scgb1b1, LGP, lacrimal gland protein, Mja1l, Apbh, Abph, Abpa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57426
Homologene: 114479
Cntn5
Name: contactin 5
Synonyms: 6720426O10Rik, NB-2, LOC244683, A830025P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244682
HGNC: HGNC:2175
Homologene: 28447
Mast1
Name: microtubule associated serine/threonine kinase 1
Synonyms: SAST, 9430008B02Rik, SAST170
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56527
Homologene: 10543
Aoah
Name: acyloxyacyl hydrolase
Synonyms: 4930433E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 27052
VEGA: 13
HGNC: HGNC:548
Homologene: 1238
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: 6720455I24Rik, D430044C15Rik, Snep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208777
Homologene: 14708
Irgm2
Name: immunity-related GTPase family M member 2
Synonyms: Gtpi, Iigp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 54396
Homologene: 78363
Zscan29
Name: zinc finger SCAN domains 29
Synonyms: Zfp690
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99334
Homologene: 17586
Zfp821
Name: zinc finger protein 821
Synonyms: 4930566A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 75871
Homologene: 32345
Aoc1l1
Name: amine oxidase copper containing 1-like 1
Synonyms: Doxl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243376
HGNC: HGNC:80
Homologene: 19443
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329679
Homologene: 46417
Dmac2l
Name: distal membrane arm assembly component 2 like
Synonyms: facyor B, Atp5s, 1110015E18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68055
VEGA: 12
Homologene: 12232
Prkd1
Name: protein kinase D1
Synonyms: PKD1, Prkcm, Pkcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Vmn2r24
Name: vomeronasal 2, receptor 24
Synonyms: EG243628
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243628
Homologene: 135915
Ikbke
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
H2-Ob
Name: histocompatibility 2, O region beta locus
Synonyms: vic1, H-2I, H2-IAb2, Ob, H2-Ab, A-beta-2, H2-Ab2, H-2Ob, A-beta2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15002
HGNC: HGNC:4937
Homologene: 1602
Fmod
Name: fibromodulin
Synonyms: SLRR2E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14264
HGNC: HGNC:3774
Homologene: 1530
Pira2
Name: paired-Ig-like receptor A2
Synonyms: 6M23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18725
Homologene: 134028
Dvl1
Name: dishevelled segment polarity protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13542
HGNC: HGNC:3084
Homologene: 20926
Mrps9
Name: mitochondrial ribosomal protein S9
Synonyms: 2310002A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69527
Homologene: 32565
Vmn1r202
Name: vomeronasal 1 receptor 202
Synonyms: V1ri7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171258
Homologene: 110880
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: 9230107O05Rik, D1Mgi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Or52b3
Name: olfactory receptor family 52 subfamily B member 3
Synonyms: MOR31-3, Olfr549, GA_x6K02T2PBJ9-5274337-5275287
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259105
Homologene: 86245
Zfp300
Name: zinc finger protein 300
Synonyms: D930016N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245368
Homologene: 65054
Gprin1
Name: G protein-regulated inducer of neurite outgrowth 1
Synonyms: GRIN1, Z16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 26913
Homologene: 8072
Pnlip
Name: pancreatic lipase
Synonyms: pancreatic triglyceride lipase, 1810007A24Rik, PTL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 69060
VEGA: 19
HGNC: HGNC:9155
Homologene: 30999
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Cfap68
Name: cilia and flagella associated protein 68
Synonyms: 1110032A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68721
HGNC: HGNC:1163
Homologene: 11242
Zfp260
Name: zinc finger protein 260
Synonyms: PEX1, Zfp63, Ozrf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26466
Homologene: 40802
Syngr4
Name: synaptogyrin 4
Synonyms: 1700016O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 58867
Homologene: 8258
Tspyl2
Name: TSPY-like 2
Synonyms: DXBwg1396e, DXHXS1008E, DENTT, E130307F10Rik, CINAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 52808
Homologene: 11140
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 21,505,349 bp
  • A to G, chromosome 1 at 42,879,882 bp
  • T to C, chromosome 1 at 43,827,623 bp
  • A to T, chromosome 1 at 71,606,004 bp
  • C to A, chromosome 1 at 75,363,464 bp
  • T to A, chromosome 1 at 93,271,684 bp
  • C to T, chromosome 1 at 93,321,297 bp
  • T to C, chromosome 1 at 130,698,723 bp
  • C to A, chromosome 1 at 131,273,474 bp
  • T to A, chromosome 1 at 132,463,375 bp
  • T to C, chromosome 1 at 134,040,518 bp
  • T to C, chromosome 1 at 138,073,681 bp
  • G to T, chromosome 1 at 160,930,257 bp
  • A to G, chromosome 1 at 164,278,323 bp
  • A to T, chromosome 1 at 166,634,903 bp
  • C to T, chromosome 1 at 174,212,614 bp
  • A to G, chromosome 1 at 175,767,095 bp
  • T to C, chromosome 2 at 31,333,931 bp
  • C to T, chromosome 2 at 36,087,466 bp
  • T to A, chromosome 2 at 52,111,400 bp
  • T to A, chromosome 2 at 71,214,563 bp
  • A to G, chromosome 2 at 73,356,658 bp
  • T to C, chromosome 2 at 119,964,157 bp
  • T to C, chromosome 2 at 121,170,106 bp
  • C to A, chromosome 2 at 126,159,984 bp
  • T to A, chromosome 2 at 127,347,189 bp
  • T to C, chromosome 2 at 158,035,986 bp
  • C to A, chromosome 2 at 168,269,032 bp
  • T to C, chromosome 3 at 5,561,590 bp
  • A to T, chromosome 3 at 79,500,432 bp
  • T to A, chromosome 4 at 11,548,726 bp
  • T to C, chromosome 4 at 52,470,920 bp
  • T to C, chromosome 4 at 132,370,784 bp
  • A to G, chromosome 4 at 155,705,443 bp
  • G to A, chromosome 4 at 155,847,816 bp
  • A to T, chromosome 5 at 24,100,863 bp
  • A to AG, chromosome 5 at 33,769,515 bp
  • A to G, chromosome 5 at 103,556,133 bp
  • T to A, chromosome 5 at 115,552,756 bp
  • C to A, chromosome 5 at 144,743,785 bp
  • A to G, chromosome 5 at 147,530,098 bp
  • A to T, chromosome 6 at 48,976,695 bp
  • A to G, chromosome 6 at 91,028,876 bp
  • T to A, chromosome 6 at 123,779,013 bp
  • A to T, chromosome 7 at 3,844,345 bp
  • A to G, chromosome 7 at 30,105,340 bp
  • G to T, chromosome 7 at 31,291,763 bp
  • A to G, chromosome 7 at 45,887,040 bp
  • A to T, chromosome 7 at 45,998,741 bp
  • T to C, chromosome 7 at 46,066,504 bp
  • G to A, chromosome 7 at 65,655,791 bp
  • T to C, chromosome 7 at 102,555,060 bp
  • T to A, chromosome 7 at 106,603,008 bp
  • A to T, chromosome 7 at 109,475,113 bp
  • A to G, chromosome 7 at 120,354,478 bp
  • C to A, chromosome 7 at 132,883,061 bp
  • C to A, chromosome 8 at 84,921,478 bp
  • A to G, chromosome 8 at 109,724,347 bp
  • T to C, chromosome 8 at 111,282,613 bp
  • T to A, chromosome 8 at 122,479,152 bp
  • G to T, chromosome 9 at 9,748,415 bp
  • T to A, chromosome 9 at 20,937,155 bp
  • C to G, chromosome 9 at 45,044,173 bp
  • T to C, chromosome 9 at 50,764,874 bp
  • T to C, chromosome 9 at 54,415,910 bp
  • C to T, chromosome 9 at 62,732,204 bp
  • T to C, chromosome 9 at 64,909,713 bp
  • A to G, chromosome 9 at 70,934,535 bp
  • A to G, chromosome 9 at 114,464,165 bp
  • T to A, chromosome 10 at 52,543,277 bp
  • T to G, chromosome 11 at 43,490,984 bp
  • T to C, chromosome 11 at 53,632,524 bp
  • T to C, chromosome 11 at 58,220,529 bp
  • T to A, chromosome 11 at 67,091,056 bp
  • A to G, chromosome 11 at 70,671,575 bp
  • G to A, chromosome 11 at 74,425,976 bp
  • A to T, chromosome 11 at 75,647,191 bp
  • G to A, chromosome 11 at 82,917,754 bp
  • T to C, chromosome 11 at 97,373,124 bp
  • A to G, chromosome 11 at 99,006,947 bp
  • T to C, chromosome 11 at 119,415,193 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • A to G, chromosome 12 at 50,489,911 bp
  • A to G, chromosome 12 at 69,741,054 bp
  • A to T, chromosome 13 at 20,840,096 bp
  • C to T, chromosome 13 at 22,501,783 bp
  • T to C, chromosome 13 at 23,562,356 bp
  • G to A, chromosome 13 at 54,738,632 bp
  • T to C, chromosome 13 at 62,517,834 bp
  • G to T, chromosome 13 at 119,455,682 bp
  • A to G, chromosome 14 at 26,949,619 bp
  • G to A, chromosome 14 at 47,395,923 bp
  • C to T, chromosome 15 at 6,765,107 bp
  • T to A, chromosome 15 at 41,819,944 bp
  • A to T, chromosome 15 at 44,512,877 bp
  • T to A, chromosome 15 at 58,627,534 bp
  • T to A, chromosome 16 at 4,613,642 bp
  • T to C, chromosome 16 at 13,412,586 bp
  • A to T, chromosome 16 at 18,280,230 bp
  • A to T, chromosome 16 at 31,105,524 bp
  • G to T, chromosome 16 at 34,009,262 bp
  • T to C, chromosome 16 at 50,274,544 bp
  • A to T, chromosome 17 at 6,050,785 bp
  • A to G, chromosome 17 at 25,144,451 bp
  • A to T, chromosome 17 at 34,242,580 bp
  • A to G, chromosome 17 at 47,466,098 bp
  • A to T, chromosome 17 at 74,660,413 bp
  • A to T, chromosome 17 at 88,015,724 bp
  • T to G, chromosome 19 at 4,903,707 bp
  • A to G, chromosome 19 at 58,676,444 bp
  • A to G, chromosome X at 21,081,951 bp
  • A to T, chromosome X at 152,338,894 bp
  • C to A, chromosome X at 159,824,496 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2145 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040148-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.