Strain Name:
Stock Number:
Citation ID:
Other Names:
R2267 (G1), C57BL/6J-MtgxR2267Btlr
Major Collection:

Strain Information

Name: fibrinogen alpha chain
Synonyms: Fib, ENSMUSG00000059807
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14161
Homologene: 428
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
Homologene: 7294
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72750
Homologene: 18307
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
Homologene: 21132
Name: ess-2 splicing factor
Synonyms: ES2, Dgsi, D16H22S1269E, Es2el, Dgcr14
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27886
VEGA: 16
Homologene: 11184
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
Homologene: 136716
Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms: 2610205E22Rik, Mettl11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66617
Homologene: 5439
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
Homologene: 22866
Name: protein tyrosine phosphatase, non-receptor type 12
Synonyms: P19-PTP, PTP-PEST, PTP-P19
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19248
Homologene: 37691
Name: lectin, galactose binding, soluble 9
Synonyms: LGALS35, galectin-9, gal-9, Lgals5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16859
Homologene: 134662
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, Tiul1, AIP5, 8030445B08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107568
Homologene: 21385
Name: TATA-box binding protein associated factor 15
Synonyms: TAFII68, 2610111C21Rik, Taf2n, 68kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70439
Homologene: 131088
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74206
Homologene: 77938
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Name: Mdm2, transformed 3T3 cell double minute p53 binding protein
Synonyms: MDM2BP
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105837
Homologene: 11102
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17931
VEGA: 10
Homologene: 1855
Name: protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
Synonyms: PP2A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19052
Homologene: 37660
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Name: exosome component 5
Synonyms: D7Wsu180e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27998
Homologene: 5981
Name: transcriptional repressor GATA binding 1
Synonyms: D15Ertd586e, trichorhinophalangeal syndrome I (human)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83925
Homologene: 8556
Name: mahogunin, ring finger 1
Synonyms: nc, 2610042J20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17237
VEGA: 16
Homologene: 41020
Name: mutL homolog 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217716
VEGA: 12
Homologene: 91153
Name: L3MBTL3 histone methyl-lysine binding protein
Synonyms: MBT-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237339
Homologene: 18226
Name: TBC1 domain family, member 14
Synonyms: 2810413P16Rik, D5Ertd110e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100855
Homologene: 10809
Name: solute carrier family 41, member 3
Synonyms: SLC41A1-L2, 1010001P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71699
Homologene: 23052
Name: glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonyms: delphilin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170935
Homologene: 15781
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
Homologene: 328
Name: lysine demethylase and nuclear receptor corepressor
Synonyms: N, ba, rh, rh-bmh, bldy
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15460
Homologene: 3774
Name: adenylate kinase 7
Synonyms: 4930502N02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78801
VEGA: 12
Homologene: 14268
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74342
Homologene: 41763
Name: LY6/PLAUR domain containing 8
Synonyms: 2210415F13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70163
Homologene: 52815
Name: glypican 6
Synonyms: 6720429C22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 23888
Homologene: 55922
Name: sterol regulatory element binding transcription factor 1
Synonyms: SREBP-1, ADD-1, SREBP-1c, SREBP-1a, SREBP1, SREBP1c, bHLHd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20787
Homologene: 3079
Name: diacylglycerol kinase, epsilon
Synonyms: DAGK6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56077
Homologene: 2705
Name: TatD DNase domain containing 1
Synonyms: CDA11, 2310079P03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69694
VEGA: 15
Homologene: 57158
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99470
Homologene: 26431
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Name: solute carrier family 38, member 6
Synonyms: EG625098
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 625098
Homologene: 27550
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Name: nuclear receptor subfamily 4, group A, member 2
Synonyms: HZF-3, RNR-1, Nurr1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18227
Homologene: 4509
Name: microsomal glutathione S-transferase 3
Synonyms: GST-III, 2010306B17Rik, 2010012L10Rik, 2700004G04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66447
Homologene: 3327
Name: T-box 1
Synonyms: nmf219
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21380
VEGA: 16
Homologene: 7966
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
Homologene: 37306
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Name: multimerin 2
Synonyms: EndoGlyx-1, ENDOGLYX1, Emilin3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105450
VEGA: 14
Homologene: 11697
Name: mutated in colorectal cancers
Synonyms: D18Ertd451e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328949
Homologene: 20539
Name: carboxylesterase 2A
Synonyms: 9130231C15Rik, Ces6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102022
Homologene: 136396
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Name: tetratricopeptide repeat domain 22
Synonyms: 4732467L16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230576
Homologene: 89253
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51938
Homologene: 12149
Name: golgi coiled coil 1
Synonyms: 4932417P04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74375
Homologene: 11567
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27404
Homologene: 56029
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Name: D-2-hydroxyglutarate dehydrogenase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98314
Homologene: 5534
Name: integrin alpha L
Synonyms: LFA-1, Cd11a, Ly-21, Ly-15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16408
Homologene: 1666
Name: MAM domain containing 2
Synonyms: 1200015L10Rik, mamcan
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71738
VEGA: 19
Homologene: 17722
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 632671
Name: purinergic receptor P2Y, G-protein coupled, 14
Synonyms: A330108O13Rik, P2Y14, Gpr105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140795
Homologene: 15769
Name: DExH-box helicase 30
Synonyms: Ddx30, 2810477H02Rik, C130058C04Rik, helG, DEAH (Asp-Glu-Ala-His) box polypeptide 30
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Name: gasdermin C
Synonyms: Mlze, Gsdmc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83492
Homologene: 69487
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Name: kallikrein 1-related peptidase b21
Synonyms: mGk-21, Klk21
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16616
Homologene: 68141
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Name: Spi-B transcription factor (Spi-1/PU.1 related)
Synonyms: Spi-B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272382
Homologene: 79220
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms: M-Sema D, semF, Semaf, 9130201M22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20356
VEGA: 15
Homologene: 2949
Name: myosin binding protein H-like
Synonyms: 1110037P11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68753
Homologene: 19221
Name: serine/threonine/tyrosine kinase 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243659
Homologene: 49545
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16427
Homologene: 1670
Name: ubiquitin-conjugating enzyme E2J 1
Synonyms: 0710008M05Rik, Ncube, Ubc6p, 1110030I22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56228
Homologene: 41090
Name: purinergic receptor P2Y, G-protein coupled 13
Synonyms: 2010001L06Rik, P2Y13, SP174, Gpr86
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74191
Homologene: 12543
Name: olfactory receptor family 8 subfamily D member 2D
Synonyms: GA_x6K02T2PVTD-32573036-32573962, MOR171-8, Olfr926
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258811
Homologene: 128215
Name: arylacetamide deacetylase
Synonyms: Aada, 5033417E09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67758
Homologene: 37436
Name: killer cell lectin-like receptor subfamily B member 1
Synonyms: Ly-55, Ly55, Gm4696, 4930431A04Rik, Nkrp1g
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100043861
Homologene: 135763
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Ido2, Indol1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209176
Homologene: 48830
Name: acyl-CoA thioesterase 2
Synonyms: MTE-I, Mte1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 171210
Homologene: 25661
Name: transmembrane protease, serine 11d
Synonyms: AsP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231382
Homologene: 74519
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Name: maestro
Synonyms: 4933435E20Rik, 4930507C04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71263
Homologene: 41729
Name: glycerol-3-phosphate acyltransferase, mitochondrial
Synonyms: GPAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14732
Homologene: 7343
Name: transforming growth factor, beta receptor III-like
Synonyms: LOC100039590, Gm14378
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100044509
Homologene: 130375
Name: cathepsin M
Synonyms: Cat M, Catm, 1600027J17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 64139
VEGA: 13
Homologene: 75181
Name: MTSS I-BAR domain containing 2
Synonyms: ABBA, Mtss1l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244654
Homologene: 70926
Name: phosphorylase kinase alpha 1
Synonyms: Phka, 9830108K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 18679
Homologene: 1981
Name: divergent protein kinase domain 2B
Synonyms: 4930578C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 75905
Homologene: 23469
Name: olfactory receptor family 51 subfamily F member 1D
Synonyms: GA_x6K02T2PBJ9-5762668-5763618, MOR14-6, Olfr583
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258752
Homologene: 133721
Name: trace amine-associated receptor 8B
Synonyms: LOC382348
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 382348
Homologene: 77586
Name: thymidine phosphorylase
Synonyms: PDECGF, PD-ECGF, gliostatin, Pdgfec, 2900072D10Rik, Ecgf1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72962
VEGA: 15
Homologene: 1474
Name: taste receptor, type 2, member 134
Synonyms: Tas2r34, T2R134
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 387511
Homologene: 66001
Name: adipocyte plasma membrane associated protein
Synonyms: 2310001A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71881
Homologene: 41380
Name: neurogenic differentiation 2
Synonyms: Ndrf, bHLHa1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18013
Homologene: 4489
Name: electron transferring flavoprotein, alpha polypeptide
Synonyms: 2010200I21Rik, D9Ertd394e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110842
Homologene: 100
Name: transmembrane protein 233
Synonyms: Gm13843
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545798
Homologene: 54444
Name: defective in cullin neddylation 1 domain containing 4
Synonyms: DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100737
Homologene: 22867
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Name: olfactory receptor family 7 subfamily G member 21
Synonyms: GA_x6K02T2PVTD-12857805-12858749, MOR152-3, Olfr836
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258557
Homologene: 115507
Name: solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
Synonyms: 2310050P13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229782
Homologene: 40826
Name: gap junction protein, delta 3
Synonyms: Gja11, connexin-30.2, cx30.2, connexin 30.2, Gjc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353155
Homologene: 17530
Name: SCY1-like 1 (S. cerevisiae)
Synonyms: p105, mfd, 2810011O19Rik, Ntkl, mdf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78891
VEGA: 19
Homologene: 6947
Name: COMM domain containing 8
Synonyms: IMAGE:1958590, D5Buc26e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27784
Homologene: 9873
Name: eukaryotic elongation factor 2 lysine methyltransferase
Synonyms: 5730409G15Rik, Fam86
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70511
Homologene: 45719
Name: predicted gene 16548
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100503816
Name: H2B clustered histone 9
Synonyms: Hist1h2bh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319182
Homologene: 138447
Name: dehydrogenase/reductase 9
Synonyms: C730025I08Rik, Rdh15, dehydrogenase/reductase (SDR family) member 9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241452
Homologene: 26079
Name: glycoprotein hormone beta 5
Synonyms: Zlut1, OGH
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217674
VEGA: 12
Homologene: 18476
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 34,295,466 bp
  • T to A, chromosome 1 at 46,233,915 bp
  • T to C, chromosome 1 at 59,913,630 bp
  • T to A, chromosome 1 at 60,330,878 bp
  • T to C, chromosome 1 at 75,505,698 bp
  • C to T, chromosome 1 at 93,835,435 bp
  • G to A, chromosome 1 at 140,573,683 bp
  • T to C, chromosome 1 at 150,599,010 bp
  • G to C, chromosome 1 at 164,151,844 bp
  • T to A, chromosome 1 at 167,373,799 bp
  • C to A, chromosome 2 at 30,820,460 bp
  • A to G, chromosome 2 at 51,628,237 bp
  • T to A, chromosome 2 at 57,112,006 bp
  • G to A, chromosome 2 at 59,837,219 bp
  • A to G, chromosome 2 at 69,392,853 bp
  • A to G, chromosome 2 at 150,588,901 bp
  • T to A, chromosome 3 at 33,815,484 bp
  • T to C, chromosome 3 at 59,115,571 bp
  • T to C, chromosome 3 at 59,210,028 bp
  • T to A, chromosome 3 at 60,037,316 bp
  • T to C, chromosome 3 at 83,032,950 bp
  • C to A, chromosome 3 at 100,061,866 bp
  • G to A, chromosome 3 at 104,021,066 bp
  • A to G, chromosome 3 at 108,365,001 bp
  • T to C, chromosome 3 at 116,673,636 bp
  • T to C, chromosome 4 at 19,638,618 bp
  • T to A, chromosome 4 at 33,049,943 bp
  • T to A, chromosome 4 at 100,949,069 bp
  • T to C, chromosome 4 at 106,639,085 bp
  • T to C, chromosome 4 at 112,842,822 bp
  • A to T, chromosome 5 at 20,998,411 bp
  • A to G, chromosome 5 at 36,543,217 bp
  • A to G, chromosome 5 at 72,165,422 bp
  • T to A, chromosome 5 at 73,481,275 bp
  • A to G, chromosome 5 at 86,373,349 bp
  • A to G, chromosome 5 at 111,226,003 bp
  • T to C, chromosome 5 at 114,255,601 bp
  • G to C, chromosome 5 at 116,051,458 bp
  • A to T, chromosome 5 at 125,287,375 bp
  • C to T, chromosome 5 at 143,386,092 bp
  • T to C, chromosome 5 at 151,586,662 bp
  • A to G, chromosome 6 at 28,418,499 bp
  • T to C, chromosome 6 at 35,241,349 bp
  • C to A, chromosome 6 at 77,244,013 bp
  • G to A, chromosome 6 at 90,640,871 bp
  • A to G, chromosome 6 at 115,962,743 bp
  • A to T, chromosome 6 at 128,722,974 bp
  • T to C, chromosome 6 at 131,312,576 bp
  • T to C, chromosome 7 at 25,664,384 bp
  • T to A, chromosome 7 at 29,399,602 bp
  • T to C, chromosome 7 at 44,104,439 bp
  • T to A, chromosome 7 at 44,528,924 bp
  • G to A, chromosome 7 at 103,052,137 bp
  • A to G, chromosome 7 at 120,431,160 bp
  • A to G, chromosome 7 at 127,306,701 bp
  • A to G, chromosome 8 at 4,250,506 bp
  • T to C, chromosome 8 at 24,535,252 bp
  • A to T, chromosome 8 at 104,740,190 bp
  • A to G, chromosome 8 at 110,728,730 bp
  • A to T, chromosome 9 at 19,121,441 bp
  • A to G, chromosome 9 at 38,878,063 bp
  • A to T, chromosome 9 at 55,486,731 bp
  • C to T, chromosome 9 at 110,087,034 bp
  • T to C, chromosome 10 at 24,091,372 bp
  • C to T, chromosome 10 at 26,331,857 bp
  • T to A, chromosome 10 at 26,992,936 bp
  • T to A, chromosome 10 at 108,240,878 bp
  • T to A, chromosome 10 at 127,082,428 bp
  • G to A, chromosome 11 at 52,118,086 bp
  • A to G, chromosome 11 at 58,386,867 bp
  • A to G, chromosome 11 at 60,207,147 bp
  • G to A, chromosome 11 at 70,601,724 bp
  • A to G, chromosome 11 at 78,963,554 bp
  • T to G, chromosome 11 at 83,497,262 bp
  • T to A, chromosome 11 at 89,052,469 bp
  • C to A, chromosome 11 at 98,327,756 bp
  • C to T, chromosome 11 at 98,982,401 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • G to A, chromosome 11 at 109,955,148 bp
  • T to A, chromosome 12 at 3,897,551 bp
  • T to C, chromosome 12 at 8,015,475 bp
  • T to C, chromosome 12 at 51,893,745 bp
  • T to A, chromosome 12 at 73,344,784 bp
  • C to G, chromosome 12 at 75,412,946 bp
  • C to T, chromosome 12 at 83,990,560 bp
  • G to T, chromosome 12 at 85,260,811 bp
  • T to C, chromosome 12 at 105,747,214 bp
  • T to C, chromosome 13 at 23,542,992 bp
  • T to C, chromosome 13 at 61,539,542 bp
  • A to G, chromosome 14 at 30,892,428 bp
  • A to G, chromosome 14 at 34,399,492 bp
  • A to T, chromosome 14 at 70,558,107 bp
  • A to T, chromosome 14 at 117,888,520 bp
  • C to A, chromosome 15 at 32,574,919 bp
  • G to A, chromosome 15 at 50,822,398 bp
  • G to A, chromosome 15 at 55,569,160 bp
  • A to T, chromosome 15 at 58,905,752 bp
  • T to C, chromosome 15 at 63,776,798 bp
  • A to T, chromosome 15 at 89,373,808 bp
  • T to G, chromosome 15 at 99,285,643 bp
  • T to C, chromosome 16 at 4,934,250 bp
  • G to A, chromosome 16 at 5,255,940 bp
  • T to C, chromosome 16 at 17,909,995 bp
  • T to C, chromosome 16 at 18,581,994 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to C, chromosome 18 at 44,519,541 bp
  • T to C, chromosome 18 at 73,873,297 bp
  • C to T, chromosome 19 at 5,761,721 bp
  • A to T, chromosome 19 at 23,303,903 bp
  • A to T, chromosome 19 at 55,072,710 bp
  • A to G, chromosome X at 18,423,687 bp
  • A to G, chromosome X at 102,541,110 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2267 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040267-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.