Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2267Btlr/Mmmh
Stock Number:
040267-MU
Citation ID:
RRID:MMRRC_040267-MU
Other Names:
R2267 (G1), C57BL/6J-MtgxR2267Btlr
Major Collection:

Strain Information

Fga
Name: fibrinogen alpha chain
Synonyms: Fib, ENSMUSG00000059807
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14161
HGNC: HGNC:3661
Homologene: 428
Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72750
Homologene: 18307
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Ess2
Name: ess-2 splicing factor
Synonyms: ES2, Dgsi, D16H22S1269E, Es2el, Dgcr14
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27886
VEGA: 16
Homologene: 11184
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Ntmt1
Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms: 2610205E22Rik, Mettl11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66617
Homologene: 5439
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 34,295,466 bp
  • T to A, chromosome 1 at 46,233,915 bp
  • T to C, chromosome 1 at 59,913,630 bp
  • T to A, chromosome 1 at 60,330,878 bp
  • T to C, chromosome 1 at 75,505,698 bp
  • C to T, chromosome 1 at 93,835,435 bp
  • G to A, chromosome 1 at 140,573,683 bp
  • T to C, chromosome 1 at 150,599,010 bp
  • G to C, chromosome 1 at 164,151,844 bp
  • T to A, chromosome 1 at 167,373,799 bp
  • C to A, chromosome 2 at 30,820,460 bp
  • A to G, chromosome 2 at 51,628,237 bp
  • T to A, chromosome 2 at 57,112,006 bp
  • G to A, chromosome 2 at 59,837,219 bp
  • A to G, chromosome 2 at 69,392,853 bp
  • A to G, chromosome 2 at 150,588,901 bp
  • T to A, chromosome 3 at 33,815,484 bp
  • T to C, chromosome 3 at 59,115,571 bp
  • T to C, chromosome 3 at 59,210,028 bp
  • T to A, chromosome 3 at 60,037,316 bp
  • T to C, chromosome 3 at 83,032,950 bp
  • C to A, chromosome 3 at 100,061,866 bp
  • G to A, chromosome 3 at 104,021,066 bp
  • A to G, chromosome 3 at 108,365,001 bp
  • T to C, chromosome 3 at 116,673,636 bp
  • T to C, chromosome 4 at 19,638,618 bp
  • T to A, chromosome 4 at 33,049,943 bp
  • T to A, chromosome 4 at 100,949,069 bp
  • T to C, chromosome 4 at 106,639,085 bp
  • T to C, chromosome 4 at 112,842,822 bp
  • A to T, chromosome 5 at 20,998,411 bp
  • A to G, chromosome 5 at 36,543,217 bp
  • A to G, chromosome 5 at 72,165,422 bp
  • T to A, chromosome 5 at 73,481,275 bp
  • A to G, chromosome 5 at 86,373,349 bp
  • A to G, chromosome 5 at 111,226,003 bp
  • T to C, chromosome 5 at 114,255,601 bp
  • G to C, chromosome 5 at 116,051,458 bp
  • A to T, chromosome 5 at 125,287,375 bp
  • C to T, chromosome 5 at 143,386,092 bp
  • T to C, chromosome 5 at 151,586,662 bp
  • A to G, chromosome 6 at 28,418,499 bp
  • T to C, chromosome 6 at 35,241,349 bp
  • C to A, chromosome 6 at 77,244,013 bp
  • G to A, chromosome 6 at 90,640,871 bp
  • A to G, chromosome 6 at 115,962,743 bp
  • A to T, chromosome 6 at 128,722,974 bp
  • T to C, chromosome 6 at 131,312,576 bp
  • T to C, chromosome 7 at 25,664,384 bp
  • T to A, chromosome 7 at 29,399,602 bp
  • T to C, chromosome 7 at 44,104,439 bp
  • T to A, chromosome 7 at 44,528,924 bp
  • G to A, chromosome 7 at 103,052,137 bp
  • A to G, chromosome 7 at 120,431,160 bp
  • A to G, chromosome 7 at 127,306,701 bp
  • A to G, chromosome 8 at 4,250,506 bp
  • T to C, chromosome 8 at 24,535,252 bp
  • A to T, chromosome 8 at 104,740,190 bp
  • A to G, chromosome 8 at 110,728,730 bp
  • A to T, chromosome 9 at 19,121,441 bp
  • A to G, chromosome 9 at 38,878,063 bp
  • A to T, chromosome 9 at 55,486,731 bp
  • C to T, chromosome 9 at 110,087,034 bp
  • T to C, chromosome 10 at 24,091,372 bp
  • C to T, chromosome 10 at 26,331,857 bp
  • T to A, chromosome 10 at 26,992,936 bp
  • T to A, chromosome 10 at 108,240,878 bp
  • T to A, chromosome 10 at 127,082,428 bp
  • G to A, chromosome 11 at 52,118,086 bp
  • A to G, chromosome 11 at 58,386,867 bp
  • A to G, chromosome 11 at 60,207,147 bp
  • G to A, chromosome 11 at 70,601,724 bp
  • A to G, chromosome 11 at 78,963,554 bp
  • T to G, chromosome 11 at 83,497,262 bp
  • T to A, chromosome 11 at 89,052,469 bp
  • C to A, chromosome 11 at 98,327,756 bp
  • C to T, chromosome 11 at 98,982,401 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • G to A, chromosome 11 at 109,955,148 bp
  • T to A, chromosome 12 at 3,897,551 bp
  • T to C, chromosome 12 at 8,015,475 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to C, chromosome 12 at 51,893,745 bp
  • T to A, chromosome 12 at 73,344,784 bp
  • C to G, chromosome 12 at 75,412,946 bp
  • C to T, chromosome 12 at 83,990,560 bp
  • G to T, chromosome 12 at 85,260,811 bp
  • T to C, chromosome 12 at 105,747,214 bp
  • T to C, chromosome 13 at 23,542,992 bp
  • T to C, chromosome 13 at 61,539,542 bp
  • A to G, chromosome 14 at 30,892,428 bp
  • A to G, chromosome 14 at 34,399,492 bp
  • A to T, chromosome 14 at 70,558,107 bp
  • A to T, chromosome 14 at 117,888,520 bp
  • C to A, chromosome 15 at 32,574,919 bp
  • G to A, chromosome 15 at 50,822,398 bp
  • G to A, chromosome 15 at 55,569,160 bp
  • A to T, chromosome 15 at 58,905,752 bp
  • T to C, chromosome 15 at 63,776,798 bp
  • A to T, chromosome 15 at 89,373,808 bp
  • T to G, chromosome 15 at 99,285,643 bp
  • T to C, chromosome 16 at 4,934,250 bp
  • G to A, chromosome 16 at 5,255,940 bp
  • T to C, chromosome 16 at 17,909,995 bp
  • T to C, chromosome 16 at 18,581,994 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to C, chromosome 18 at 44,519,541 bp
  • T to C, chromosome 18 at 73,873,297 bp
  • C to T, chromosome 19 at 5,761,721 bp
  • A to T, chromosome 19 at 23,303,903 bp
  • A to T, chromosome 19 at 55,072,710 bp
  • A to G, chromosome X at 18,423,687 bp
  • A to G, chromosome X at 102,541,110 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2267 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040267-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.