Strain Name:
C57BL/6J-MtgxR2268Btlr/Mmmh
Stock Number:
040268-MU
Citation ID:
RRID:MMRRC_040268-MU
Other Names:
R2268 (G1), C57BL/6J-MtgxR2268Btlr
Major Collection:

Strain Information

Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72750
Homologene: 18307
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Vcp
Name: valosin containing protein
Synonyms: CDC48, p97, p97/VCP, AAA ATPase p97
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269523
Homologene: 5168
Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Fzd9
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14371
HGNC: HGNC:4047
Homologene: 2619
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Vangl1
Name: VANGL planar cell polarity 1
Synonyms: Lpp2, mStbm, stbm, KITENIN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229658
Homologene: 44540
Mtbp
Name: Mdm2, transformed 3T3 cell double minute p53 binding protein
Synonyms: MDM2BP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105837
HGNC: HGNC:7417
Homologene: 11102
Ppp2ca
Name: protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
Synonyms: PP2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19052
HGNC: HGNC:9299
Homologene: 37660
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Tcf4
Name: transcription factor 4
Synonyms: SEF-2, ITF-2, MITF-2B, MITF-2A, ME2, E2.2, TFE, E2-2, SEF2-1, ASP-I2, ITF-2b, 5730422P05Rik, bHLHb19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21413
Homologene: 2407
Phf8
Name: PHD finger protein 8
Synonyms: 9830141C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 320595
Homologene: 49405
Tbc1d14
Name: TBC1 domain family, member 14
Synonyms: 2810413P16Rik, D5Ertd110e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100855
Homologene: 10809
Slc41a3
Name: solute carrier family 41, member 3
Synonyms: SLC41A1-L2, 1010001P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71699
Homologene: 23052
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Hr
Name: lysine demethylase and nuclear receptor corepressor
Synonyms: N, ba, rh, rh-bmh, bldy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 15460
HGNC: HGNC:5172
Homologene: 3774
Rps17
Name: ribosomal protein S17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20068
Homologene: 110867
Nfix
Name: nuclear factor I/X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18032
HGNC: HGNC:7788
Homologene: 1872
St8sia5
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Synonyms: ST8SiaV, Siat8e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225742
Homologene: 8331
Arl13a
Name: ADP-ribosylation factor-like 13A
Synonyms: 4933422M21Rik, Arl13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 74448
Homologene: 78051
Lypd8
Name: LY6/PLAUR domain containing 8
Synonyms: 2210415F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70163
Homologene: 52815
Egfl8
Name: EGF-like domain 8
Synonyms: NG3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 81701
Homologene: 36473
Vav2
Name: vav 2 oncogene
Synonyms: 2810040F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22325
Homologene: 2530
Srebf1
Name: sterol regulatory element binding transcription factor 1
Synonyms: SREBP-1, ADD-1, SREBP-1c, SREBP-1a, SREBP1, SREBP1c, bHLHd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20787
Homologene: 3079
Cenpe
Name: centromere protein E
Synonyms: N-7 kinesin, CENP-E, 312kDa, Kif10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Mpdz
Name: multiple PDZ domain crumbs cell polarity complex component
Synonyms: MUPP1, B930003D11Rik, multiple PDZ domain protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17475
HGNC: HGNC:7208
Homologene: 2841
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269198
Homologene: 16453
Slc38a6
Name: solute carrier family 38, member 6
Synonyms: EG625098
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 625098
Homologene: 27550
Dhodh
Name: dihydroorotate dehydrogenase
Synonyms: 2810417D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56749
HGNC: HGNC:2867
Homologene: 1043
Hps3
Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms: Hermansky-Pudlak syndrome 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12807
Homologene: 13019
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Zfp831
Name: zinc finger protein 831
Synonyms: ENSMUSG00000050600, OTTMUSG00000017459
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100043757
Homologene: 19013
Mmrn2
Name: multimerin 2
Synonyms: EndoGlyx-1, ENDOGLYX1, Emilin3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105450
VEGA: 14
Homologene: 11697
Foxn4
Name: forkhead box N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 116810
Homologene: 17526
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Ccser1
Name: coiled-coil serine rich 1
Synonyms: 6230405M12Rik, C130092O11Rik, Fam190a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232035
Homologene: 28086
Hdhd2
Name: haloacid dehalogenase-like hydrolase domain containing 2
Synonyms: 0610039H12Rik, 3110052N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 76987
Homologene: 12667
Astn1
Name: astrotactin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 50932
Homologene: 56762
Myoc
Name: myocilin
Synonyms: TIGR, GLC1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17926
HGNC: HGNC:7610
Homologene: 220
Vmn2r15
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 211223
Homologene: 129606
Dynap
Name: dynactin associated protein
Synonyms: 2310002L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 75577
VEGA: 18
Homologene: 82463
Ahnak
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Adam34
Name: a disintegrin and metallopeptidase domain 34
Synonyms: testase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 252866
Homologene: 78104
Irs2
Name: insulin receptor substrate 2
Synonyms: Irs-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 384783
HGNC: HGNC:6126
Homologene: 2778
D2hgdh
Name: D-2-hydroxyglutarate dehydrogenase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98314
Homologene: 5534
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 545527
Homologene: 65043
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23850
Homologene: 10661
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74362
Homologene: 52601
Adap2
Name: ArfGAP with dual PH domains 2
Synonyms: centaurin alpha 2, Centa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216991
Homologene: 10179
Mybphl
Name: myosin binding protein H-like
Synonyms: 1110037P11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68753
Homologene: 19221
Styk1
Name: serine/threonine/tyrosine kinase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243659
Homologene: 49545
Col17a1
Name: collagen, type XVII, alpha 1
Synonyms: BPAg2, BP180, Bpag, Bpag2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12821
HGNC: HGNC:2194
Homologene: 7276
Scgb1b2
Name: secretoglobin, family 1B, member 2
Synonyms: lacrimal gland protein, LGP, Scgb1b1, Mja1l, Apbh, Abph, Abpa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57426
Homologene: 114479
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17534
Homologene: 4408
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Rdh7
Name: retinol dehydrogenase 7
Synonyms: CRAD2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 54150
Homologene: 137324
Ano7
Name: anoctamin 7
Synonyms: IPCA-5, NGEP, NGEP-L, Pcanap5, Tmem16g
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 404545
Homologene: 45787
Opcml
Name: opioid binding protein/cell adhesion molecule-like
Synonyms: Obcam, LOC235104, 2900075O15Rik, B930023M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330908
HGNC: HGNC:8143
Homologene: 55663
Or10ak16
Name: olfactory receptor family 10 subfamily AK member 16
Synonyms: GA_x6K02T2QD9B-18644371-18643424, MOR259-8, Olfr1330
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258331
Homologene: 121524
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Ido2, Indol1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 209176
Homologene: 48830
Acox2
Name: acyl-Coenzyme A oxidase 2, branched chain
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 93732
HGNC: HGNC:120
Homologene: 74473
Tha1
Name: threonine aldolase 1
Synonyms: GLY1, 1300017K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71776
Homologene: 57081
Tlr5
Name: toll-like receptor 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53791
Homologene: 20698
Tbx5
Name: T-box 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21388
Homologene: 160
Vmn2r76
Name: vomeronasal 2, receptor 76
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 675969
Homologene: 104330
Cyp4f17
Name: cytochrome P450, family 4, subfamily f, polypeptide 17
Synonyms: EG208285
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 208285
VEGA: 17
Homologene: 129713
Edem2
Name: ER degradation enhancer, mannosidase alpha-like 2
Synonyms: 9530090G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 108687
Homologene: 10075
Tgfbr3l
Name: transforming growth factor, beta receptor III-like
Synonyms: LOC100039590, Gm14378
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100044509
Homologene: 130375
Phka1
Name: phosphorylase kinase alpha 1
Synonyms: Phka, 9830108K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 18679
HGNC: HGNC:8925
Homologene: 1981
Kir3dl1
Name: killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Synonyms: Kirl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245616
Homologene: 77448
Dipk2b
Name: divergent protein kinase domain 2B
Synonyms: 4930578C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 75905
Homologene: 23469
Taar8b
Name: trace amine-associated receptor 8B
Synonyms: LOC382348
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 382348
Homologene: 77586
Tymp
Name: thymidine phosphorylase
Synonyms: PDECGF, PD-ECGF, gliostatin, Pdgfec, 2900072D10Rik, Ecgf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72962
VEGA: 15
HGNC: HGNC:3148
Homologene: 1474
Or8b1
Name: olfactory receptor family 8 subfamily B member 1
Synonyms: GA_x6K02T2PVTD-32194085-32195020, MOR167-2, Olfr906
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258799
VEGA: 9
Homologene: 132439
Tmem233
Name: transmembrane protein 233
Synonyms: Gm13843
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 545798
Homologene: 54444
Dcun1d4
Name: DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100737
Homologene: 22867
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Slc35a3
Name: solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
Synonyms: 2310050P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229782
Homologene: 40826
Tbc1d22b
Name: TBC1 domain family, member 22B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381085
Homologene: 23043
Snap23
Name: synaptosomal-associated protein 23
Synonyms: Syndet, SNAP-23, Sndt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20619
Homologene: 37857
Commd8
Name: COMM domain containing 8
Synonyms: IMAGE:1958590, D5Buc26e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27784
Homologene: 9873
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 25,111,817 bp
  • T to C, chromosome 1 at 59,913,630 bp
  • T to A, chromosome 1 at 60,330,878 bp
  • A to T, chromosome 1 at 93,380,439 bp
  • C to T, chromosome 1 at 93,835,435 bp
  • A to T, chromosome 1 at 135,472,236 bp
  • T to A, chromosome 1 at 136,519,748 bp
  • A to G, chromosome 1 at 150,624,598 bp
  • T to C, chromosome 1 at 158,502,099 bp
  • A to G, chromosome 1 at 158,857,271 bp
  • C to T, chromosome 1 at 162,649,056 bp
  • T to A, chromosome 1 at 182,975,035 bp
  • A to T, chromosome 2 at 27,292,655 bp
  • A to G, chromosome 2 at 120,599,312 bp
  • G to T, chromosome 2 at 125,321,741 bp
  • G to A, chromosome 2 at 155,702,217 bp
  • A to C, chromosome 2 at 174,644,241 bp
  • G to A, chromosome 3 at 20,012,935 bp
  • A to T, chromosome 3 at 58,618,839 bp
  • C to A, chromosome 3 at 100,061,866 bp
  • A to T, chromosome 3 at 102,196,844 bp
  • G to A, chromosome 3 at 104,021,066 bp
  • A to G, chromosome 3 at 108,365,001 bp
  • T to C, chromosome 3 at 116,673,636 bp
  • A to G, chromosome 3 at 135,261,636 bp
  • G to A, chromosome 4 at 42,980,833 bp
  • A to G, chromosome 4 at 81,383,391 bp
  • A to T, chromosome 4 at 118,893,874 bp
  • A to G, chromosome 5 at 36,543,217 bp
  • A to G, chromosome 5 at 72,165,422 bp
  • T to A, chromosome 5 at 73,481,275 bp
  • A to G, chromosome 5 at 109,293,207 bp
  • T to C, chromosome 5 at 114,255,601 bp
  • G to C, chromosome 5 at 116,051,458 bp
  • A to T, chromosome 5 at 119,845,109 bp
  • A to G, chromosome 5 at 135,250,294 bp
  • C to T, chromosome 6 at 61,570,843 bp
  • G to A, chromosome 6 at 90,640,871 bp
  • C to G, chromosome 6 at 124,746,240 bp
  • T to C, chromosome 6 at 131,312,576 bp
  • T to A, chromosome 7 at 31,291,776 bp
  • C to T, chromosome 7 at 81,344,998 bp
  • T to C, chromosome 7 at 86,230,499 bp
  • A to G, chromosome 8 at 4,250,506 bp
  • T to C, chromosome 8 at 11,007,586 bp
  • T to C, chromosome 8 at 24,535,252 bp
  • C to T, chromosome 8 at 43,650,610 bp
  • CAAAAA to CAAAA, chromosome 8 at 84,716,247 bp
  • A to G, chromosome 8 at 109,594,674 bp
  • T to C, chromosome 9 at 28,903,355 bp
  • T to A, chromosome 9 at 38,488,208 bp
  • T to C, chromosome 10 at 24,091,372 bp
  • T to A, chromosome 10 at 26,992,936 bp
  • A to G, chromosome 10 at 127,884,661 bp
  • G to A, chromosome 11 at 52,118,086 bp
  • A to G, chromosome 11 at 58,386,867 bp
  • A to G, chromosome 11 at 60,207,147 bp
  • G to A, chromosome 11 at 70,601,724 bp
  • G to T, chromosome 11 at 80,165,726 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • T to A, chromosome 11 at 117,871,002 bp
  • T to C, chromosome 12 at 8,015,475 bp
  • A to T, chromosome 12 at 31,327,645 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to C, chromosome 12 at 51,893,745 bp
  • T to A, chromosome 12 at 73,344,784 bp
  • T to G, chromosome 13 at 76,112,274 bp
  • A to T, chromosome 14 at 8,253,496 bp
  • A to G, chromosome 14 at 30,892,428 bp
  • A to G, chromosome 14 at 34,399,492 bp
  • A to T, chromosome 14 at 70,558,107 bp
  • G to A, chromosome 15 at 55,569,160 bp
  • A to T, chromosome 15 at 89,373,808 bp
  • A to G, chromosome 17 at 29,599,854 bp
  • G to T, chromosome 17 at 32,517,954 bp
  • C to T, chromosome 17 at 34,613,858 bp
  • G to T, chromosome 18 at 57,381,646 bp
  • G to A, chromosome 18 at 69,657,964 bp
  • C to T, chromosome 18 at 70,241,147 bp
  • C to T, chromosome 18 at 76,965,170 bp
  • T to C, chromosome 18 at 77,232,830 bp
  • A to G, chromosome 19 at 9,010,574 bp
  • G to A, chromosome 19 at 47,650,111 bp
  • A to G, chromosome X at 18,423,687 bp
  • A to G, chromosome X at 102,541,110 bp
  • A to G, chromosome X at 134,205,413 bp
  • A to G, chromosome X at 136,525,035 bp
  • T to C, chromosome X at 151,572,601 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2268 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040268-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.