Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2268Btlr/Mmmh
Stock Number:
040268-MU
Citation ID:
RRID:MMRRC_040268-MU
Other Names:
R2268 (G1), C57BL/6J-MtgxR2268Btlr
Major Collection:

Strain Information

Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72750
Homologene: 18307
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Vcp
Name: valosin containing protein
Synonyms: CDC48, p97, p97/VCP, AAA ATPase p97
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269523
Homologene: 5168
Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Fzd9
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14371
HGNC: HGNC:4047
Homologene: 2619
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Vangl1
Name: VANGL planar cell polarity 1
Synonyms: Lpp2, mStbm, stbm, KITENIN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229658
Homologene: 44540
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 25,111,817 bp
  • T to C, chromosome 1 at 59,913,630 bp
  • T to A, chromosome 1 at 60,330,878 bp
  • A to T, chromosome 1 at 93,380,439 bp
  • C to T, chromosome 1 at 93,835,435 bp
  • A to T, chromosome 1 at 135,472,236 bp
  • T to A, chromosome 1 at 136,519,748 bp
  • A to G, chromosome 1 at 150,624,598 bp
  • T to C, chromosome 1 at 158,502,099 bp
  • A to G, chromosome 1 at 158,857,271 bp
  • C to T, chromosome 1 at 162,649,056 bp
  • T to A, chromosome 1 at 182,975,035 bp
  • A to T, chromosome 2 at 27,292,655 bp
  • A to G, chromosome 2 at 120,599,312 bp
  • G to T, chromosome 2 at 125,321,741 bp
  • G to A, chromosome 2 at 155,702,217 bp
  • A to C, chromosome 2 at 174,644,241 bp
  • G to A, chromosome 3 at 20,012,935 bp
  • A to T, chromosome 3 at 58,618,839 bp
  • C to A, chromosome 3 at 100,061,866 bp
  • A to T, chromosome 3 at 102,196,844 bp
  • G to A, chromosome 3 at 104,021,066 bp
  • A to G, chromosome 3 at 108,365,001 bp
  • T to C, chromosome 3 at 116,673,636 bp
  • A to G, chromosome 3 at 135,261,636 bp
  • G to A, chromosome 4 at 42,980,833 bp
  • A to G, chromosome 4 at 81,383,391 bp
  • A to T, chromosome 4 at 118,893,874 bp
  • A to G, chromosome 5 at 36,543,217 bp
  • A to G, chromosome 5 at 72,165,422 bp
  • T to A, chromosome 5 at 73,481,275 bp
  • A to G, chromosome 5 at 109,293,207 bp
  • T to C, chromosome 5 at 114,255,601 bp
  • G to C, chromosome 5 at 116,051,458 bp
  • A to T, chromosome 5 at 119,845,109 bp
  • A to G, chromosome 5 at 135,250,294 bp
  • C to T, chromosome 6 at 61,570,843 bp
  • G to A, chromosome 6 at 90,640,871 bp
  • C to G, chromosome 6 at 124,746,240 bp
  • T to C, chromosome 6 at 131,312,576 bp
  • T to A, chromosome 7 at 31,291,776 bp
  • C to T, chromosome 7 at 81,344,998 bp
  • T to C, chromosome 7 at 86,230,499 bp
  • A to G, chromosome 8 at 4,250,506 bp
  • T to C, chromosome 8 at 11,007,586 bp
  • T to C, chromosome 8 at 24,535,252 bp
  • C to T, chromosome 8 at 43,650,610 bp
  • CAAAAA to CAAAA, chromosome 8 at 84,716,247 bp
  • A to G, chromosome 8 at 109,594,674 bp
  • T to C, chromosome 9 at 28,903,355 bp
  • T to A, chromosome 9 at 38,488,208 bp
  • T to C, chromosome 10 at 24,091,372 bp
  • T to A, chromosome 10 at 26,992,936 bp
  • A to G, chromosome 10 at 127,884,661 bp
  • G to A, chromosome 11 at 52,118,086 bp
  • A to G, chromosome 11 at 58,386,867 bp
  • A to G, chromosome 11 at 60,207,147 bp
  • G to A, chromosome 11 at 70,601,724 bp
  • G to T, chromosome 11 at 80,165,726 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • T to A, chromosome 11 at 117,871,002 bp
  • T to C, chromosome 12 at 8,015,475 bp
  • A to T, chromosome 12 at 31,327,645 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to C, chromosome 12 at 51,893,745 bp
  • T to A, chromosome 12 at 73,344,784 bp
  • T to G, chromosome 13 at 76,112,274 bp
  • A to T, chromosome 14 at 8,253,496 bp
  • A to G, chromosome 14 at 30,892,428 bp
  • A to G, chromosome 14 at 34,399,492 bp
  • A to T, chromosome 14 at 70,558,107 bp
  • G to A, chromosome 15 at 55,569,160 bp
  • A to T, chromosome 15 at 89,373,808 bp
  • A to G, chromosome 17 at 29,599,854 bp
  • G to T, chromosome 17 at 32,517,954 bp
  • C to T, chromosome 17 at 34,613,858 bp
  • G to T, chromosome 18 at 57,381,646 bp
  • G to A, chromosome 18 at 69,657,964 bp
  • C to T, chromosome 18 at 70,241,147 bp
  • C to T, chromosome 18 at 76,965,170 bp
  • T to C, chromosome 18 at 77,232,830 bp
  • A to G, chromosome 19 at 9,010,574 bp
  • G to A, chromosome 19 at 47,650,111 bp
  • A to G, chromosome X at 18,423,687 bp
  • A to G, chromosome X at 102,541,110 bp
  • A to G, chromosome X at 134,205,413 bp
  • A to G, chromosome X at 136,525,035 bp
  • T to C, chromosome X at 151,572,601 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2268 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040268-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.