Strain Name:
C57BL/6J-MtgxR2269Btlr/Mmmh
Stock Number:
040269-MU
Citation ID:
RRID:MMRRC_040269-MU
Other Names:
R2269 (G1), C57BL/6J-MtgxR2269Btlr
Major Collection:

Strain Information

Vcp
Name: valosin containing protein
Synonyms: CDC48, p97/VCP, p97, AAA ATPase p97
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269523
Homologene: 5168
Fxyd6
Name: FXYD domain-containing ion transport regulator 6
Synonyms: 0610030I18Rik, Php
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 59095
VEGA: 9
Homologene: 11090
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 3110038B19Rik, 9430085A19Rik, 2310058D16Rik, 1190002C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Rtel1
Name: regulator of telomere elongation helicase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269400
Homologene: 13168
Dusp1
Name: dual specificity phosphatase 1
Synonyms: 3CH134, MKP1, Ptpn16, mkp-1, erp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19252
HGNC: HGNC:3064
Homologene: 3254
Ylpm1
Name: YLP motif containing 1
Synonyms: A930013E17Rik, ZAP, Zap3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 56531
Homologene: 87707
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Agrn
Name: agrin
Synonyms: Agrin, nmf380, NMF380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Tyw1
Name: tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms: Rsafd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100929
Homologene: 7068
Hnrnpul1
Name: heterogeneous nuclear ribonucleoprotein U-like 1
Synonyms: Hnrpul1, E130317O14Rik, Hnrnpul, E1BAP5, E1B-AP5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232989
Homologene: 31419
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Epb41
Name: erythrocyte membrane protein band 4.1
Synonyms: Elp-1, D4Ertd442e, 4.1R, Elp1, Epb4.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269587
HGNC: HGNC:3377
Homologene: 44324
Mtbp
Name: Mdm2, transformed 3T3 cell double minute p53 binding protein
Synonyms: MDM2BP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105837
HGNC: HGNC:7417
Homologene: 11102
Banp
Name: BTG3 associated nuclear protein
Synonyms: SMAR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 53325
Homologene: 9635
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 5730577I22Rik, D10Ertd625e, Mypt1, 1200015F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: Murr2, A530081C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17847
Homologene: 40978
Clec16a
Name: C-type lectin domain family 16, member A
Synonyms: 4932416N17Rik, curt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74374
Homologene: 71019
Tcf4
Name: transcription factor 4
Synonyms: E2-2, TFE, ITF-2, MITF-2A, bHLHb19, ITF-2b, ASP-I2, SEF2-1, ME2, E2.2, SEF-2, 5730422P05Rik, MITF-2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21413
Homologene: 2407
Zkscan5
Name: zinc finger with KRAB and SCAN domains 5
Synonyms: Zfp95, hKraba1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22757
Homologene: 8734
Tbc1d14
Name: TBC1 domain family, member 14
Synonyms: D5Ertd110e, 2810413P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100855
Homologene: 10809
Slc41a3
Name: solute carrier family 41, member 3
Synonyms: SLC41A1-L2, 1010001P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71699
Homologene: 23052
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19876
Homologene: 2206
Efna1
Name: ephrin A1
Synonyms: LERK-1, EFL-1, Eplg1, B61, Lerk1, Epl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13636
HGNC: HGNC:3221
Homologene: 3262
Srsf4
Name: serine and arginine-rich splicing factor 4
Synonyms: 5730499P16Rik, Sfrs4, MNCb-2616, SRp75
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 57317
Homologene: 25624
Egfl8
Name: EGF-like domain 8
Synonyms: NG3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 81701
Homologene: 36473
Gpc6
Name: glypican 6
Synonyms: 6720429C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 23888
HGNC: HGNC:4454
Homologene: 55922
Eps15
Name: epidermal growth factor receptor pathway substrate 15
Synonyms: 2410112D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13858
HGNC: HGNC:3419
Homologene: 128359
Mpdz
Name: multiple PDZ domain crumbs cell polarity complex component
Synonyms: B930003D11Rik, multiple PDZ domain protein, MUPP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17475
HGNC: HGNC:7208
Homologene: 2841
Nav1
Name: neuron navigator 1
Synonyms: unc53H1, steerin-1, 9930003A20Rik, C230080M11Rik, POMFIL3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Slc38a6
Name: solute carrier family 38, member 6
Synonyms: EG625098
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 625098
Homologene: 27550
Abca16
Name: ATP-binding cassette, sub-family A (ABC1), member 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233810
Homologene: 132942
Tbx1
Name: T-box 1
Synonyms: nmf219
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 21380
VEGA: 16
Homologene: 7966
Lama2
Name: laminin, alpha 2
Synonyms: mer, merosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Foxn4
Name: forkhead box N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 116810
Homologene: 17526
Decr2
Name: 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26378
HGNC: HGNC:2754
Homologene: 22223
Ces2a
Name: carboxylesterase 2A
Synonyms: Ces6, 9130231C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102022
HGNC: HGNC:1864
Homologene: 136396
Lrrc43
Name: leucine rich repeat containing 43
Synonyms: LOC381741
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381741
Homologene: 17662
Hdhd2
Name: haloacid dehalogenase-like hydrolase domain containing 2
Synonyms: 0610039H12Rik, 3110052N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 76987
Homologene: 12667
Astn1
Name: astrotactin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Dock3
Name: dedicator of cyto-kinesis 3
Synonyms: Moca, PBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208869
HGNC: HGNC:2989
Homologene: 21030
Cntn1
Name: contactin 1
Synonyms: usl, CNTN, F3cam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12805
HGNC: HGNC:2171
Homologene: 7274
Gbe1
Name: glucan (1,4-alpha-), branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546983
Homologene: 115466
Bcl11b
Name: B cell leukemia/lymphoma 11B
Synonyms: COUP-TF interacting protein 2, 9130430L19Rik, CTIP2, Rit1, B630002E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 58208
Homologene: 10974
Abca8a
Name: ATP-binding cassette, sub-family A (ABC1), member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
D2hgdh
Name: D-2-hydroxyglutarate dehydrogenase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98314
Homologene: 5534
Itgal
Name: integrin alpha L
Synonyms: Ly-15, Cd11a, LFA-1, Ly-21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16408
HGNC: HGNC:6148
Homologene: 1666
Pxdn
Name: peroxidasin
Synonyms: VPO1, 2310075M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 69675
Homologene: 33907
Mamdc2
Name: MAM domain containing 2
Synonyms: 1200015L10Rik, mamcan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71738
VEGA: 19
Homologene: 17722
Agap2
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
Mroh5
Name: maestro heat-like repeat family member 5
Synonyms: LOC268816, Gm628
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268816
Pappa2
Name: pappalysin 2
Synonyms: PAPP-A2, pregnancy-associated plasma protein-E, placenta-specific 3, PLAC3, pregnancy-associated plasma preproprotein-A2, Pappe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23850
Homologene: 10661
Slc6a19
Name: solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms: B0AT1, 4632401C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74338
Homologene: 52819
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, Plcl4, A930027K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269615
Homologene: 85172
Col16a1
Name: collagen, type XVI, alpha 1
Synonyms: A530052M23Rik, 2700007F12Rik, [a]1 (XVI) collagen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107581
HGNC: HGNC:2193
Homologene: 1397
Sh3bp4
Name: SH3-domain binding protein 4
Synonyms: BOG25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98402
Homologene: 8726
Klk1b21
Name: kallikrein 1-related peptidase b21
Synonyms: Klk21, mGk-21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16616
Homologene: 68141
Styk1
Name: serine/threonine/tyrosine kinase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243659
Homologene: 49545
Mrc2
Name: mannose receptor, C type 2
Synonyms: uPARAP, Endo180, novel lectin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17534
Homologene: 4408
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242702
Homologene: 19432
Cyp3a41b
Name: cytochrome P450, family 3, subfamily a, polypeptide 41B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100041375
Homologene: 133568
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22312
Homologene: 129750
Or1e23
Name: olfactory receptor family 1 subfamily E member 23
Synonyms: MOR135-14, Olfr382, GA_x6K02T2P1NL-3676608-3675670, MOR135-31_p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258435
Homologene: 17252
Gpatch3
Name: G patch domain containing 3
Synonyms: Gpatc3, D930035B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242691
Homologene: 11122
Fbxw22
Name: F-box and WD-40 domain protein 22
Synonyms: Gm5164
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382156
Homologene: 110776
Klhl31
Name: kelch-like 31
Synonyms: 9830147P19Rik, Kbtbd1, D930047P17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244923
Homologene: 27819
Or10ak16
Name: olfactory receptor family 10 subfamily AK member 16
Synonyms: GA_x6K02T2QD9B-18644371-18643424, Olfr1330, MOR259-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258331
Homologene: 121524
Arhgef16
Name: Rho guanine nucleotide exchange factor (GEF) 16
Synonyms: Neuroblastoma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230972
Homologene: 82484
Ctsm
Name: cathepsin M
Synonyms: 1600027J17Rik, Catm, Cat M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 64139
VEGA: 13
HGNC: HGNC:2537
Homologene: 75181
Mtss2
Name: MTSS I-BAR domain containing 2
Synonyms: Mtss1l, ABBA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244654
Homologene: 70926
Or51f1d
Name: olfactory receptor family 51 subfamily F member 1D
Synonyms: Olfr583, MOR14-6, GA_x6K02T2PBJ9-5762668-5763618
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258752
Homologene: 133721
Taar8b
Name: trace amine-associated receptor 8B
Synonyms: LOC382348
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 382348
Homologene: 77586
Adh6a
Name: alcohol dehydrogenase 6A (class V)
Synonyms: 1810009C16Rik, Adh5a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69117
Homologene: 66291
Srd5a2
Name: steroid 5 alpha-reductase 2
Synonyms: 5ART2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 94224
VEGA: 17
Homologene: 37292
Coasy
Name: Coenzyme A synthase
Synonyms: Dpck, Ppat, Ukr1, 1300003G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71743
Homologene: 11889
Tmem233
Name: transmembrane protein 233
Synonyms: Gm13843
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 545798
Homologene: 54444
Dcun1d4
Name: DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100737
Homologene: 22867
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Ager
Name: advanced glycosylation end product-specific receptor
Synonyms: RAGE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 11596
HGNC: HGNC:320
Homologene: 883
Slc2a10
Name: solute carrier family 2 (facilitated glucose transporter), member 10
Synonyms: Glut10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 170441
Homologene: 38551
Cflar
Name: CASP8 and FADD-like apoptosis regulator
Synonyms: Cash, 2310024N18Rik, Flip, c-Flip, A430105C05Rik, Casper
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12633
HGNC: HGNC:1876
Homologene: 7652
Commd8
Name: COMM domain containing 8
Synonyms: IMAGE:1958590, D5Buc26e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27784
Homologene: 9873
Tmem252
Name: transmembrane protein 252
Synonyms: E030010A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226040
VEGA: 19
Homologene: 17717
Zbp1
Name: Z-DNA binding protein 1
Synonyms: mZaDLM, 2010010H03Rik, Dai
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58203
Homologene: 10972
Defb11
Name: defensin beta 11
Synonyms: Defb8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 246081
Mrpl28
Name: mitochondrial ribosomal protein L28
Synonyms: MAAT1, 1110015G04Rik, p15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68611
Homologene: 4693
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 20,534,535 bp
  • G to A, chromosome 1 at 58,741,047 bp
  • G to A, chromosome 1 at 89,145,592 bp
  • C to T, chromosome 1 at 93,835,435 bp
  • A to T, chromosome 1 at 135,472,236 bp
  • T to C, chromosome 1 at 158,502,099 bp
  • A to G, chromosome 1 at 158,857,271 bp
  • T to A, chromosome 2 at 165,514,781 bp
  • T to A, chromosome 2 at 173,218,823 bp
  • G to T, chromosome 2 at 181,336,003 bp
  • G to A, chromosome 3 at 89,276,339 bp
  • A to T, chromosome 3 at 138,329,096 bp
  • G to A, chromosome 4 at 42,980,833 bp
  • A to G, chromosome 4 at 81,383,391 bp
  • C to T, chromosome 4 at 109,370,687 bp
  • A to T, chromosome 4 at 118,893,874 bp
  • C to A, chromosome 4 at 130,052,918 bp
  • T to C, chromosome 4 at 131,897,682 bp
  • T to A, chromosome 4 at 131,964,147 bp
  • C to T, chromosome 4 at 133,583,807 bp
  • C to A, chromosome 4 at 135,796,443 bp
  • T to A, chromosome 4 at 154,285,033 bp
  • T to C, chromosome 4 at 154,993,004 bp
  • C to T, chromosome 4 at 156,179,218 bp
  • A to G, chromosome 5 at 36,543,217 bp
  • A to G, chromosome 5 at 72,165,422 bp
  • T to A, chromosome 5 at 73,481,275 bp
  • T to C, chromosome 5 at 114,255,601 bp
  • G to C, chromosome 5 at 116,051,458 bp
  • A to T, chromosome 5 at 123,503,291 bp
  • T to C, chromosome 5 at 130,276,977 bp
  • A to G, chromosome 5 at 145,205,467 bp
  • A to T, chromosome 5 at 145,578,166 bp
  • G to A, chromosome 6 at 90,640,871 bp
  • T to C, chromosome 6 at 131,312,576 bp
  • A to G, chromosome 7 at 25,750,874 bp
  • T to C, chromosome 7 at 44,104,439 bp
  • T to C, chromosome 7 at 86,811,689 bp
  • G to A, chromosome 7 at 103,052,137 bp
  • A to G, chromosome 7 at 120,431,160 bp
  • A to G, chromosome 7 at 127,306,701 bp
  • A to G, chromosome 8 at 21,905,428 bp
  • A to T, chromosome 8 at 104,740,190 bp
  • A to G, chromosome 8 at 110,728,730 bp
  • A to G, chromosome 8 at 121,975,923 bp
  • T to C, chromosome 9 at 45,391,546 bp
  • T to C, chromosome 9 at 67,920,947 bp
  • C to A, chromosome 9 at 72,301,770 bp
  • A to G, chromosome 9 at 77,650,158 bp
  • C to A, chromosome 9 at 106,941,326 bp
  • C to T, chromosome 9 at 109,383,994 bp
  • T to C, chromosome 10 at 24,091,372 bp
  • T to A, chromosome 10 at 26,992,936 bp
  • T to A, chromosome 10 at 108,240,878 bp
  • T to A, chromosome 10 at 127,082,428 bp
  • T to C, chromosome 11 at 23,432,466 bp
  • A to G, chromosome 11 at 73,516,483 bp
  • A to G, chromosome 11 at 101,085,882 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • A to C, chromosome 11 at 110,026,892 bp
  • T to A, chromosome 12 at 30,005,775 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to C, chromosome 12 at 51,893,745 bp
  • T to A, chromosome 12 at 73,344,784 bp
  • T to A, chromosome 12 at 85,015,050 bp
  • T to C, chromosome 12 at 107,915,651 bp
  • T to C, chromosome 13 at 61,539,542 bp
  • A to G, chromosome 13 at 73,682,167 bp
  • A to T, chromosome 14 at 117,888,520 bp
  • G to A, chromosome 15 at 55,569,160 bp
  • T to C, chromosome 15 at 73,793,148 bp
  • A to G, chromosome 15 at 92,294,982 bp
  • G to A, chromosome 16 at 10,644,786 bp
  • T to C, chromosome 16 at 18,581,994 bp
  • C to A, chromosome 16 at 32,754,529 bp
  • C to T, chromosome 16 at 70,436,952 bp
  • T to A, chromosome 16 at 72,978,772 bp
  • T to C, chromosome 17 at 20,375,555 bp
  • C to A, chromosome 17 at 26,083,884 bp
  • T to C, chromosome 17 at 26,126,311 bp
  • A to T, chromosome 17 at 26,507,119 bp
  • A to T, chromosome 17 at 34,599,150 bp
  • C to T, chromosome 17 at 34,613,858 bp
  • T to C, chromosome 17 at 74,024,490 bp
  • G to T, chromosome 18 at 57,381,646 bp
  • G to A, chromosome 18 at 69,657,964 bp
  • C to T, chromosome 18 at 76,965,170 bp
  • A to T, chromosome 19 at 23,303,903 bp
  • T to C, chromosome 19 at 24,674,091 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2269 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040269-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.