Strain Name:
Stock Number:
Citation ID:
Other Names:
R2473 (G1), C57BL/6J-MtgxR2473Btlr
Major Collection:

Strain Information

Name: paired box 3
Synonyms: Pax-3, Splchl2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18505
Homologene: 22494
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, OTTMUSG00000012483, C030040A15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Name: actinin alpha 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60595
Homologene: 55857
Name: splicing factor 3b, subunit 1
Synonyms: Prp10, SAP155, 2810001M05Rik, SF3b155, Targ4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 81898
Homologene: 6696
Name: calcitonin receptor
Synonyms: Clr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12311
Homologene: 1320
Name: matrix-remodelling associated 8
Synonyms: DICAM, Asp3, 1200013A08Rik, limitrin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74761
Homologene: 11500
Name: matrix Gla protein
Synonyms: Mglap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17313
Homologene: 693
Name: MARVEL (membrane-associating) domain containing 2
Synonyms: Tric-c, Mrvldc2, Tricellulin, Tric, Tric-a, Tric-b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218518
VEGA: 13
Homologene: 27037
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
Homologene: 3217
Name: solute carrier family 16 (monocarboxylic acid transporters), member 12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240638
Homologene: 130007
Name: tetratricopeptide repeat domain 39A
Synonyms: 4922503N01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230603
Homologene: 17739
Name: calcium channel, voltage-dependent, beta 2 subunit
Synonyms: Cavbeta2, Cchb2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12296
Homologene: 75191
Name: MAM domain containing 4
Synonyms: LOC381352
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381352
Homologene: 17102
Name: olfactory receptor family 5 subfamily P member 70
Synonyms: Olfr495, MOR204-37, GA_x6K02T2PBJ9-10725148-10726140
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258361
Homologene: 133600
Name: mucin-like 2
Synonyms: Spt-1, Spt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20770
Homologene: 137219
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242702
Homologene: 19432
Name: olfactory receptor family 4 subfamily G member 16
Synonyms: Olfr1279, MOR245-12, GA_x6K02T2Q125-72357646-72358581
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258388
Homologene: 121520
Name: SEC14-like lipid binding 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103655
Homologene: 68807
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241633
Homologene: 133162
Name: solute carrier family 35, member C1
Synonyms: FUCT1, E430007K15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228368
Homologene: 41258
Name: cytochrome P450, family 3, subfamily a, polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13114
Homologene: 133568
Name: hyaluronic acid binding protein 2
Synonyms: FSAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226243
Homologene: 3050
Name: Eph receptor B4
Synonyms: MDK2, b2b2412Clo, Htk, Myk1, Tyro11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
Homologene: 20939
Name: olfactory receptor family 2 subfamily T member 46
Synonyms: MOR275-5, MOR275-11_p, Olfr325, GA_x6K02T2NKPP-844642-843680
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258261
Homologene: 133015
Name: polymerase (DNA directed), mu
Synonyms: B230309I03Rik, Tdt-N
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54125
Homologene: 41170
Name: zinc finger protein 414
Synonyms: 0610030H11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328801
Homologene: 12264
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 54,999,626 bp
  • C to T, chromosome 1 at 78,122,590 bp
  • G to A, chromosome 2 at 14,984,314 bp
  • C to A, chromosome 2 at 25,566,332 bp
  • T to A, chromosome 2 at 49,279,341 bp
  • T to A, chromosome 2 at 92,454,753 bp
  • T to C, chromosome 2 at 111,306,891 bp
  • T to G, chromosome 2 at 126,358,894 bp
  • A to T, chromosome 4 at 109,442,239 bp
  • A to T, chromosome 4 at 135,806,024 bp
  • T to C, chromosome 4 at 155,842,043 bp
  • T to A, chromosome 5 at 137,365,700 bp
  • T to A, chromosome 5 at 145,455,594 bp
  • T to A, chromosome 6 at 3,711,439 bp
  • T to C, chromosome 6 at 136,873,164 bp
  • G to A, chromosome 7 at 28,898,266 bp
  • C to T, chromosome 7 at 108,395,504 bp
  • G to A, chromosome 9 at 79,643,855 bp
  • T to A, chromosome 11 at 4,043,359 bp
  • T to C, chromosome 11 at 5,829,881 bp
  • A to G, chromosome 11 at 58,581,575 bp
  • A to G, chromosome 12 at 73,104,175 bp
  • C to T, chromosome 13 at 100,597,321 bp
  • C to G, chromosome 15 at 103,897,362 bp
  • CAAACTCTTCCGA to CAAACTCTTCCGAAACTCTTCCGA, chromosome 17 at 33,630,577 bp
  • C to T, chromosome 19 at 34,677,277 bp
  • G to A, chromosome 19 at 56,288,032 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2473 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040404-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.