Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2567Btlr/Mmmh
Stock Number:
040426-MU
Citation ID:
RRID:MMRRC_040426-MU
Other Names:
R2567 (G1), C57BL/6J-MtgxR2567Btlr
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Cdk4
Name: cyclin dependent kinase 4
Synonyms: p34PSK-J3/cdk4, Crk3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Sparcl1
Name: SPARC-like 1
Synonyms: Sc1, hevin, mast9, Ecm2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13602
Homologene: 3438
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 71,597,736 bp
  • A to G, chromosome 1 at 72,864,095 bp
  • T to C, chromosome 1 at 79,625,204 bp
  • A to G, chromosome 1 at 106,875,146 bp
  • A to G, chromosome 1 at 154,204,949 bp
  • A to G, chromosome 2 at 13,278,356 bp
  • A to G, chromosome 2 at 16,712,184 bp
  • A to T, chromosome 2 at 30,341,782 bp
  • A to T, chromosome 2 at 59,913,911 bp
  • T to C, chromosome 2 at 76,744,328 bp
  • C to T, chromosome 2 at 102,767,010 bp
  • T to A, chromosome 2 at 119,037,075 bp
  • T to A, chromosome 2 at 119,643,830 bp
  • T to G, chromosome 2 at 128,652,837 bp
  • T to A, chromosome 3 at 52,269,334 bp
  • A to G, chromosome 3 at 59,929,054 bp
  • G to T, chromosome 4 at 45,927,931 bp
  • C to A, chromosome 4 at 86,585,885 bp
  • T to C, chromosome 4 at 88,835,910 bp
  • T to C, chromosome 4 at 92,191,323 bp
  • T to C, chromosome 4 at 115,920,292 bp
  • T to A, chromosome 4 at 123,297,951 bp
  • T to C, chromosome 4 at 156,217,118 bp
  • T to C, chromosome 5 at 8,430,459 bp
  • ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT, chromosome 5 at 29,637,586 bp
  • C to T, chromosome 5 at 97,391,759 bp
  • A to T, chromosome 5 at 104,085,088 bp
  • A to T, chromosome 5 at 114,433,317 bp
  • G to T, chromosome 5 at 120,481,581 bp
  • A to G, chromosome 5 at 138,820,185 bp
  • A to T, chromosome 7 at 4,936,335 bp
  • A to T, chromosome 7 at 16,198,716 bp
  • G to A, chromosome 7 at 35,381,532 bp
  • T to C, chromosome 7 at 85,234,595 bp
  • T to C, chromosome 7 at 100,374,252 bp
  • C to A, chromosome 7 at 102,112,069 bp
  • C to T, chromosome 7 at 111,554,616 bp
  • T to A, chromosome 7 at 119,952,697 bp
  • T to G, chromosome 7 at 135,145,484 bp
  • T to A, chromosome 8 at 3,876,327 bp
  • G to A, chromosome 8 at 45,037,486 bp
  • T to A, chromosome 8 at 84,549,725 bp
  • G to A, chromosome 8 at 122,862,024 bp
  • T to C, chromosome 9 at 26,920,696 bp
  • T to A, chromosome 9 at 37,804,213 bp
  • T to C, chromosome 9 at 44,726,025 bp
  • T to A, chromosome 9 at 53,457,470 bp
  • T to C, chromosome 9 at 65,324,311 bp
  • C to T, chromosome 10 at 77,941,174 bp
  • T to C, chromosome 10 at 81,086,049 bp
  • T to C, chromosome 10 at 85,098,780 bp
  • T to A, chromosome 10 at 102,378,262 bp
  • T to G, chromosome 10 at 127,064,276 bp
  • A to G, chromosome 11 at 5,870,251 bp
  • T to A, chromosome 11 at 5,904,354 bp
  • C to T, chromosome 11 at 66,926,159 bp
  • T to C, chromosome 11 at 69,940,577 bp
  • T to C, chromosome 11 at 70,169,532 bp
  • T to C, chromosome 11 at 116,649,866 bp
  • G to T, chromosome 12 at 4,869,685 bp
  • A to G, chromosome 12 at 31,269,055 bp
  • G to T, chromosome 12 at 52,938,373 bp
  • G to A, chromosome 12 at 81,167,590 bp
  • A to T, chromosome 12 at 88,285,472 bp
  • A to T, chromosome 13 at 90,062,142 bp
  • T to G, chromosome 14 at 52,622,630 bp
  • A to T, chromosome 14 at 56,386,927 bp
  • A to G, chromosome 14 at 75,754,290 bp
  • CCTTTGCGCTT to CCTT, chromosome 15 at 47,741,236 bp
  • A to G, chromosome 15 at 79,522,831 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • A to C, chromosome 16 at 43,943,967 bp
  • C to T, chromosome 17 at 36,548,150 bp
  • A to C, chromosome 17 at 44,101,845 bp
  • A to G, chromosome 17 at 46,647,501 bp
  • A to T, chromosome 17 at 90,597,644 bp
  • T to A, chromosome 18 at 38,282,096 bp
  • T to C, chromosome 18 at 44,275,821 bp
  • C to A, chromosome 19 at 4,172,137 bp
  • G to T, chromosome 19 at 41,041,336 bp
  • A to G, chromosome 19 at 47,424,569 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2567 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040426-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.