Strain Name:
C57BL/6J-MtgxR2567Btlr/Mmmh
Stock Number:
040426-MU
Citation ID:
RRID:MMRRC_040426-MU
Other Names:
R2567 (G1), C57BL/6J-MtgxR2567Btlr
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Cdk4
Name: cyclin dependent kinase 4
Synonyms: p34PSK-J3/cdk4, Crk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Fn1
Name: fibronectin 1
Synonyms: Fn-1, Fn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14268
HGNC: HGNC:3778
Homologene: 1533
Lamb1
Name: laminin B1
Synonyms: C81607, C80098, Lamb-1, Lamb1-1, D130003D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Sparcl1
Name: SPARC-like 1
Synonyms: hevin, Ecm2, Sc1, mast9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13602
Homologene: 3438
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: 2900019G14Rik, 1700091C19Rik, GLT1, MGLT1, Eaat2, GLT-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20511
Homologene: 3075
Dock1
Name: dedicator of cytokinesis 1
Synonyms: Dock180, b2b3190Clo, D630004B07Rik, 9130006G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Nup188
Name: nucleoporin 188
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227699
Homologene: 45683
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Gck
Name: glucokinase
Synonyms: HK4, MODY2, Gls006, hexokinase 4, Hlb62
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103988
HGNC: HGNC:4195
Homologene: 55440
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100763
Homologene: 8783
Pabpc4
Name: poly(A) binding protein, cytoplasmic 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230721
HGNC: HGNC:8557
Homologene: 37855
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, Mcpr, 2610021O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17222
Homologene: 7414
Cog3
Name: component of oligomeric golgi complex 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 338337
VEGA: 14
Homologene: 5854
Nusap1
Name: nucleolar and spindle associated protein 1
Synonyms: NuSAP, 2610201A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 108907
Homologene: 10207
Ccdc191
Name: coiled-coil domain containing 191
Synonyms: 2610015P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212153
Homologene: 19484
Dmbx1
Name: diencephalon/mesencephalon homeobox 1
Synonyms: Dmbx1, Atx, Cdmx, Otx3, Mbx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 140477
Homologene: 15639
Phldb1
Name: pleckstrin homology like domain, family B, member 1
Synonyms: D330037A14Rik, LL5A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102693
Homologene: 15903
Slc25a40
Name: solute carrier family 25, member 40
Synonyms: B230315F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319653
Homologene: 6040
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 277939
Homologene: 19524
Chrna10
Name: cholinergic receptor, nicotinic, alpha polypeptide 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 504186
Homologene: 56886
Igfbp5
Name: insulin-like growth factor binding protein 5
Synonyms: IGFBP-5P, IGFBP-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16011
HGNC: HGNC:5474
Homologene: 56489
Mrpl2
Name: mitochondrial ribosomal protein L2
Synonyms: CGI-22, MRP-L14, Rpml14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 27398
Homologene: 69198
Fat1
Name: FAT atypical cadherin 1
Synonyms: 2310038E12Rik, mFat1, Fath
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Rhpn2
Name: rhophilin, Rho GTPase binding protein 2
Synonyms: D7Ertd784e, 1300002E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 52428
Homologene: 12407
Xrcc4
Name: X-ray repair complementing defective repair in Chinese hamster cells 4
Synonyms: 2310057B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 108138
Homologene: 2555
Foxo1
Name: forkhead box O1
Synonyms: Afxh, Foxo1a, FKHR, Fkhr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56458
HGNC: HGNC:3819
Homologene: 1527
Plxdc2
Name: plexin domain containing 2
Synonyms: 5430431D22Rik, 1200007L24Rik, Tem7r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67448
Homologene: 41666
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: 5830435C13Rik, D2Ertd794e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Pcdh12
Name: protocadherin 12
Synonyms: VE-cadherin-2, vascular endothelial cadherin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 53601
HGNC: HGNC:8657
Homologene: 9574
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: LTRPC2, 9830168K16Rik, Trrp7, TRPC7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 28240
Homologene: 20709
Cd209d
Name: CD209d antigen
Synonyms: SIGN-R3, mSIGNR3, SIGNR3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170779
HGNC: HGNC:1641
Homologene: 8603
Clec10a
Name: C-type lectin domain family 10, member A
Synonyms: Mgl1, CD301a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17312
Homologene: 7836
Mgat4c
Name: MGAT4 family, member C
Synonyms: 9130411I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67569
Homologene: 8297
Pirt
Name: phosphoinositide-interacting regulator of transient receptor potential channels
Synonyms: A530088H08Rik, Pirt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 193003
Homologene: 77645
Atp12a
Name: ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Synonyms: Atp1al1, HKalpha2, ATPase H+K+-transporting, alpha 2, cHKA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 192113
VEGA: 14
Homologene: 68197
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: alpha1A, Ccha1a, SCA6, Cacnl1a4, nmf352, smrl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Cubn
Name: cubilin (intrinsic factor-cobalamin receptor)
Synonyms: D2Wsu88e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Akap6
Name: A kinase (PRKA) anchor protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Tns2
Name: tensin 2
Synonyms: Tenc1, nep, nph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zfp648
Name: zinc finger protein 648
Synonyms: LOC207678, Gm10178
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100503355
Homologene: 18996
Enpp4
Name: ectonucleotide pyrophosphatase/phosphodiesterase 4
Synonyms: 4933413N07Rik, LOC224794
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224794
HGNC: HGNC:3359
Homologene: 28264
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Galnt18
Name: polypeptide N-acetylgalactosaminyltransferase 18
Synonyms: Galntl4, 2900011G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233733
Homologene: 18347
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239420
Homologene: 65982
Sh3pxd2a
Name: SH3 and PX domains 2A
Synonyms: Sh3md1, 2310014D11Rik, Tks5, Fish
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14218
VEGA: 19
Homologene: 7317
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381522
Homologene: 117988
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74183
Homologene: 135954
Mmab
Name: methylmalonic aciduria (cobalamin deficiency) cblB type homolog (human)
Synonyms: 9130222L19Rik, ATP:Cob(I)alamin Adenosyltransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77697
Homologene: 12680
Aadacl2fm1
Name: AADACL2 family member 1
Synonyms: C130079G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229333
Ssc5d
Name: scavenger receptor cysteine rich family, 5 domains
Synonyms: A430110N23Rik, s5d-srcrb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269855
Homologene: 77555
Nrxn1
Name: neurexin I
Synonyms: neurexin I beta, neurexin I alpha, neurexin I beta, neurexin I alpha, 9330127H16Rik, alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, A230068P09Rik, neurexin I alpha, 1700062G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Mfsd2b
Name: MFSD2 lysolipid transporter B, sphingolipid
Synonyms: major facilitator superfamily domain containing 2B, Gm1964
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432628
Homologene: 47753
Ybx2
Name: Y box protein 2
Synonyms: MSY2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53422
Homologene: 22942
Clpx
Name: caseinolytic mitochondrial matrix peptidase chaperone subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270166
HGNC: HGNC:2088
Homologene: 4851
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Rpusd2
Name: RNA pseudouridylate synthase domain containing 2
Synonyms: 4921503C21Rik, BB231107
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271842
Homologene: 5588
Dhx34
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 34
Synonyms: 1200013B07Rik, 1810012L18Rik, Ddx34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71723
Homologene: 69171
Vmn2r68
Name: vomeronasal 2, receptor 68
Synonyms: EG620697, Vmn2r68-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 620697
Homologene: 115466
Cdh15
Name: cadherin 15
Synonyms: Cdh14, M cadherin, Mcad
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Fhl4
Name: four and a half LIM domains 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14202
VEGA: 10
HGNC: HGNC:3702
Haus6
Name: HAUS augmin-like complex, subunit 6
Synonyms: D4Ertd27e, 6230416J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230376
Homologene: 9760
H2-M11
Name: histocompatibility 2, M region locus 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224754
Homologene: 52241
Creb3l3
Name: cAMP responsive element binding protein 3-like 3
Synonyms: CREB-H, D10Bur1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 208677
Homologene: 13080
Aebp1
Name: AE binding protein 1
Synonyms: ACLP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11568
HGNC: HGNC:303
Homologene: 878
Npy6r
Name: neuropeptide Y receptor Y6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 18169
VEGA: 18
HGNC: HGNC:7959
Homologene: 134692
CT485612.2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Smoc1
Name: SPARC related modular calcium binding 1
Synonyms: SRG, SPARC-related protein, 2600002F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 64075
Homologene: 56943
Serpinb5
Name: serine (or cysteine) peptidase inhibitor, clade B, member 5
Synonyms: 1110036M19Rik, Spi7, ovalbumin, Maspin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20724
HGNC: HGNC:8949
Homologene: 20580
Carns1
Name: carnosine synthase 1
Synonyms: Atpgd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107239
VEGA: 19
Homologene: 26439
Or8b12c
Name: olfactory receptor family 8 subfamily B member 12C
Synonyms: GA_x6K02T2PVTD-31489645-31490577, Olfr876, MOR161-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258883
Homologene: 74154
Kdelr3
Name: KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105785
VEGA: 15
HGNC: HGNC:6306
Homologene: 68533
AC113533.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Larp7-ps
Name: La ribonucleoprotein 7, transcriptional regulator, pseudogene
Synonyms: Gm12666
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68280
Cygb
Name: cytoglobin
Synonyms: 3110001K20Rik, Staap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 114886
Homologene: 12706
Ap1s3
Name: adaptor-related protein complex AP-1, sigma 3
Synonyms: Jr2, [s]3A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 252903
Homologene: 65622
Ifna5
Name: interferon alpha 5
Synonyms: Ifa5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15968
Homologene: 68536
Naa11
Name: N(alpha)-acetyltransferase 11, NatA catalytic subunit
Synonyms: Ard1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 97243
Homologene: 39206
Sds
Name: serine dehydratase
Synonyms: SDH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231691
Homologene: 38235
Trav5-1
Name: T cell receptor alpha variable 5-1
Synonyms: Gm7124, Trav5-1 T-cell receptor alpha chain V region 5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 633740
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 71,597,736 bp
  • A to G, chromosome 1 at 72,864,095 bp
  • T to C, chromosome 1 at 79,625,204 bp
  • A to G, chromosome 1 at 106,875,146 bp
  • A to G, chromosome 1 at 154,204,949 bp
  • A to G, chromosome 2 at 13,278,356 bp
  • A to G, chromosome 2 at 16,712,184 bp
  • A to T, chromosome 2 at 30,341,782 bp
  • A to T, chromosome 2 at 59,913,911 bp
  • T to C, chromosome 2 at 76,744,328 bp
  • C to T, chromosome 2 at 102,767,010 bp
  • T to A, chromosome 2 at 119,037,075 bp
  • T to A, chromosome 2 at 119,643,830 bp
  • T to G, chromosome 2 at 128,652,837 bp
  • T to A, chromosome 3 at 52,269,334 bp
  • A to G, chromosome 3 at 59,929,054 bp
  • G to T, chromosome 4 at 45,927,931 bp
  • C to A, chromosome 4 at 86,585,885 bp
  • T to C, chromosome 4 at 88,835,910 bp
  • T to C, chromosome 4 at 92,191,323 bp
  • T to C, chromosome 4 at 115,920,292 bp
  • T to A, chromosome 4 at 123,297,951 bp
  • T to C, chromosome 4 at 156,217,118 bp
  • T to C, chromosome 5 at 8,430,459 bp
  • ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT, chromosome 5 at 29,637,586 bp
  • C to T, chromosome 5 at 97,391,759 bp
  • A to T, chromosome 5 at 104,085,088 bp
  • A to T, chromosome 5 at 114,433,317 bp
  • G to T, chromosome 5 at 120,481,581 bp
  • A to G, chromosome 5 at 138,820,185 bp
  • A to T, chromosome 7 at 4,936,335 bp
  • A to T, chromosome 7 at 16,198,716 bp
  • G to A, chromosome 7 at 35,381,532 bp
  • T to C, chromosome 7 at 85,234,595 bp
  • T to C, chromosome 7 at 100,374,252 bp
  • C to A, chromosome 7 at 102,112,069 bp
  • C to T, chromosome 7 at 111,554,616 bp
  • T to A, chromosome 7 at 119,952,697 bp
  • T to G, chromosome 7 at 135,145,484 bp
  • T to A, chromosome 8 at 3,876,327 bp
  • G to A, chromosome 8 at 45,037,486 bp
  • T to A, chromosome 8 at 84,549,725 bp
  • G to A, chromosome 8 at 122,862,024 bp
  • T to C, chromosome 9 at 26,920,696 bp
  • T to A, chromosome 9 at 37,804,213 bp
  • T to C, chromosome 9 at 44,726,025 bp
  • T to A, chromosome 9 at 53,457,470 bp
  • T to C, chromosome 9 at 65,324,311 bp
  • C to T, chromosome 10 at 77,941,174 bp
  • T to C, chromosome 10 at 81,086,049 bp
  • T to C, chromosome 10 at 85,098,780 bp
  • T to A, chromosome 10 at 102,378,262 bp
  • T to G, chromosome 10 at 127,064,276 bp
  • A to G, chromosome 11 at 5,870,251 bp
  • T to A, chromosome 11 at 5,904,354 bp
  • C to T, chromosome 11 at 66,926,159 bp
  • T to C, chromosome 11 at 69,940,577 bp
  • T to C, chromosome 11 at 70,169,532 bp
  • T to C, chromosome 11 at 116,649,866 bp
  • G to T, chromosome 12 at 4,869,685 bp
  • A to G, chromosome 12 at 31,269,055 bp
  • G to T, chromosome 12 at 52,938,373 bp
  • G to A, chromosome 12 at 81,167,590 bp
  • A to T, chromosome 12 at 88,285,472 bp
  • A to T, chromosome 13 at 90,062,142 bp
  • T to G, chromosome 14 at 52,622,630 bp
  • A to T, chromosome 14 at 56,386,927 bp
  • A to G, chromosome 14 at 75,754,290 bp
  • CCTTTGCGCTT to CCTT, chromosome 15 at 47,741,236 bp
  • A to G, chromosome 15 at 79,522,831 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • A to C, chromosome 16 at 43,943,967 bp
  • C to T, chromosome 17 at 36,548,150 bp
  • A to C, chromosome 17 at 44,101,845 bp
  • A to G, chromosome 17 at 46,647,501 bp
  • A to T, chromosome 17 at 90,597,644 bp
  • T to A, chromosome 18 at 38,282,096 bp
  • T to C, chromosome 18 at 44,275,821 bp
  • C to A, chromosome 19 at 4,172,137 bp
  • G to T, chromosome 19 at 41,041,336 bp
  • A to G, chromosome 19 at 47,424,569 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2567 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040426-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.