Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2847Btlr/Mmmh
Stock Number:
040440-MU
Citation ID:
RRID:MMRRC_040440-MU
Other Names:
R2847 (G1), C57BL/6J-MtgxR2847Btlr
Major Collection:

Strain Information

Htr4
Name: 5 hydroxytryptamine (serotonin) receptor 4
Synonyms: 5-HT4L, 5-HT4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15562
VEGA: 18
HGNC: HGNC:5299
Homologene: 20243
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Dennd2b
Name: DENN domain containing 2B
Synonyms: 2610305K15Rik, 2010004M01Rik, St5, Denn2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76954
Homologene: 3951
Cib4
Name: calcium and integrin binding family member 4
Synonyms: 1700041E20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73259
Homologene: 18990
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Nln
Name: neurolysin (metallopeptidase M3 family)
Synonyms: 4930472G13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75805
VEGA: 13
Homologene: 69315
Sec23ip
Name: Sec23 interacting protein
Synonyms: D7Ertd373e, p125
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: ORP-8, D330025H14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237542
VEGA: 10
Homologene: 68813
Bub3
Name: BUB3 mitotic checkpoint protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12237
HGNC: HGNC:1151
Homologene: 3470
Cobl
Name: cordon-bleu WH2 repeat
Synonyms: C530045F18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12808
Homologene: 9058
Zfp985
Name: zinc finger protein 985
Synonyms: Gm13154
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433804
Homologene: 133076
Naa16
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms: 1300019C06Rik, Narg1l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66897
Homologene: 134838
Foxk2
Name: forkhead box K2
Synonyms: 5730434B08Rik, 1110054H05Rik, Ilf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68837
HGNC: HGNC:6036
Homologene: 18748
Gna12
Name: guanine nucleotide binding protein, alpha 12
Synonyms: Galpha12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14673
HGNC: HGNC:4380
Homologene: 22398
Utp25
Name: UTP25 small subunit processome component
Synonyms: AA408296, Diexf, mDef
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215193
Homologene: 6170
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Fbf1
Name: Fas binding factor 1
Synonyms: 1110033G01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217335
Homologene: 16531
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Crispld2
Name: cysteine-rich secretory protein LCCL domain containing 2
Synonyms: 1810049K24Rik, coffeecrisp, Lgl1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78892
Homologene: 41792
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Erc2
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: D14Ertd171e, ELKS2alpha, CAST
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 238988
Homologene: 69188
Asph
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Pax7
Name: paired box 7
Synonyms: Pax-7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18509
HGNC: HGNC:8621
Homologene: 55665
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83771
Homologene: 12890
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Adgrf5
Name: adhesion G protein-coupled receptor F5
Synonyms: 8430401C09Rik, Gpr116
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224792
VEGA: 17
Homologene: 9065
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Ankrd69
Name: ankyrin repeat domain 69
Synonyms: 4930456F22Rik, 4921537P18Rik, Poteg
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70952
Homologene: 134158
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: NMDAR2B, NR2B, Nmdar2b, GluRepsilon2, GluN2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Grin2a
Name: glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Synonyms: NR2A, NMDAR2A, GluRepsilon1, GluN2A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14811
HGNC: HGNC:4585
Homologene: 645
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Ksr1
Name: kinase suppressor of ras 1
Synonyms: D11Bhm183e, B-KSR1, D11Bhm184e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16706
HGNC: HGNC:6465
Homologene: 8410
Or1n1b
Name: olfactory receptor family 1 subfamily N member 1B
Synonyms: GA_x6K02T2NLDC-33585366-33584431, MOR127-3, Olfr353
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258943
HGNC: HGNC:8221
Homologene: 115503
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 666002
Homologene: 86604
Mmp1b
Name: matrix metallopeptidase 1b (interstitial collagenase)
Synonyms: Mcol-B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83996
HGNC: HGNC:7155
Homologene: 130791
Atxn1
Name: ataxin 1
Synonyms: Atx1, Sca1, 2900016G23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20238
VEGA: 13
Homologene: 281
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230872
Homologene: 16811
Or8b53
Name: olfactory receptor family 8 subfamily B member 53
Synonyms: GA_x6K02T2PVTD-32458442-32459374, MOR165-6, Olfr920
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258783
VEGA: 9
Xlr4b
Name: X-linked lymphocyte-regulated 4B
Synonyms: Xlr4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 27083
Homologene: 83298
Rnf43
Name: ring finger protein 43
Synonyms: 4732452J19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207742
Homologene: 37742
Vmn1r181
Name: vomeronasal 1 receptor 181
Synonyms: V1rd20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404289
Homologene: 104166
Slc2a4
Name: solute carrier family 2 (facilitated glucose transporter), member 4
Synonyms: Glut-4, Glut4, twgy
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20528
Homologene: 74381
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Casr-rs3, EG637898, Gprc2a-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Defb39
Name: defensin beta 39
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 360214
Homologene: 86857
Itgb6
Name: integrin beta 6
Synonyms: 4831415H04Rik, 2210409C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16420
HGNC: HGNC:6161
Homologene: 685
Cd151
Name: CD151 antigen
Synonyms: SFA-1, PETA-3, Tspan24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12476
HGNC: HGNC:1630
Homologene: 20916
Zfp773
Name: zinc finger protein 773
Synonyms: 2810409K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76373
Homologene: 137393
Zfp964
Name: zinc finger protein 964
Synonyms: Gm7187
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 636741
Homologene: 130114
Fndc9
Name: fibronectin type III domain containing 9
Synonyms: C030019I05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320116
Homologene: 37404
Cyp4f37
Name: cytochrome P450, family 4, subfamily f, polypeptide 37
Synonyms: Gm9705
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 677156
VEGA: 17
Homologene: 135840
Zdhhc22
Name: zinc finger, DHHC-type containing 22
Synonyms: LOC238331
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238331
VEGA: 12
Homologene: 45486
Tox3
Name: TOX high mobility group box family member 3
Synonyms: CAGF9, Tnrc9, 500-9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244579
Homologene: 18257
Tstd3
Name: thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
Synonyms: 2610029I01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77032
Homologene: 123813
4930510E17Rik
Name: RIKEN cDNA 4930510E17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
AC122260.2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to C, chromosome 1 at 135,450,644 bp
  • G to T, chromosome 1 at 150,563,599 bp
  • A to T, chromosome 1 at 193,128,451 bp
  • A to G, chromosome 2 at 36,890,524 bp
  • T to C, chromosome 2 at 60,600,535 bp
  • T to A, chromosome 3 at 63,345,199 bp
  • A to G, chromosome 4 at 9,598,729 bp
  • A to T, chromosome 4 at 21,759,375 bp
  • T to C, chromosome 4 at 43,180,404 bp
  • T to C, chromosome 4 at 139,779,643 bp
  • G to A, chromosome 4 at 141,018,756 bp
  • G to A, chromosome 4 at 147,583,011 bp
  • T to A, chromosome 4 at 155,860,202 bp
  • T to C, chromosome 5 at 30,488,588 bp
  • T to A, chromosome 5 at 140,785,593 bp
  • C to T, chromosome 6 at 4,756,912 bp
  • C to A, chromosome 6 at 40,652,715 bp
  • T to A, chromosome 6 at 68,050,144 bp
  • T to C, chromosome 6 at 73,129,331 bp
  • G to T, chromosome 6 at 110,646,348 bp
  • C to A, chromosome 6 at 135,740,953 bp
  • AGCTGCTGCTGCTGCTGCTGCTGCTGC to AGCTGCTGCTGCTGCTGCTGCTGC, chromosome 7 at 7,133,093 bp
  • G to T, chromosome 7 at 23,984,518 bp
  • A to T, chromosome 7 at 42,136,433 bp
  • A to G, chromosome 7 at 45,310,598 bp
  • T to C, chromosome 7 at 109,525,337 bp
  • G to A, chromosome 7 at 128,754,073 bp
  • C to T, chromosome 7 at 131,570,884 bp
  • T to C, chromosome 7 at 141,469,550 bp
  • C to T, chromosome 8 at 19,052,893 bp
  • A to T, chromosome 8 at 27,481,676 bp
  • G to C, chromosome 8 at 69,663,854 bp
  • G to A, chromosome 8 at 90,248,390 bp
  • C to A, chromosome 8 at 120,015,259 bp
  • C to T, chromosome 9 at 7,370,763 bp
  • C to T, chromosome 9 at 37,404,476 bp
  • C to T, chromosome 9 at 38,756,036 bp
  • T to C, chromosome 9 at 53,264,789 bp
  • T to A, chromosome 10 at 111,269,436 bp
  • T to C, chromosome 11 at 9,294,584 bp
  • A to G, chromosome 11 at 12,378,342 bp
  • C to T, chromosome 11 at 46,238,041 bp
  • C to T, chromosome 11 at 54,620,078 bp
  • T to C, chromosome 11 at 61,824,729 bp
  • T to A, chromosome 11 at 69,946,171 bp
  • C to T, chromosome 11 at 79,020,822 bp
  • T to A, chromosome 11 at 87,732,267 bp
  • T to C, chromosome 11 at 110,042,105 bp
  • T to C, chromosome 11 at 115,344,558 bp
  • C to T, chromosome 11 at 116,157,688 bp
  • CGGGGGG to CGGGGGGGGG, chromosome 11 at 121,260,491 bp
  • T to A, chromosome 12 at 86,988,562 bp
  • A to T, chromosome 13 at 45,566,699 bp
  • A to G, chromosome 13 at 104,025,025 bp
  • T to C, chromosome 14 at 28,040,488 bp
  • G to T, chromosome 14 at 78,947,142 bp
  • A to G, chromosome 14 at 79,335,883 bp
  • A to T, chromosome 15 at 76,602,851 bp
  • A to G, chromosome 16 at 9,761,965 bp
  • A to T, chromosome 17 at 23,290,974 bp
  • T to A, chromosome 17 at 32,629,125 bp
  • C to A, chromosome 17 at 43,422,640 bp
  • A to T, chromosome 17 at 57,876,392 bp
  • G to T, chromosome 17 at 84,597,966 bp
  • T to C, chromosome 18 at 62,428,126 bp
  • A to G, chromosome 19 at 16,703,599 bp
  • A to T, chromosome X at 73,215,332 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2847 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040440-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.