Strain Name:
C57BL/6J-MtgxR2859Btlr/Mmmh
Stock Number:
040449-MU
Citation ID:
RRID:MMRRC_040449-MU
Other Names:
R2859 (G1), C57BL/6J-MtgxR2859Btlr
Major Collection:

Strain Information

Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Mthfd1
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: E430024A07Rik, Mthfd, DCS
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108156
VEGA: 12
HGNC: HGNC:7432
Homologene: 55940
Ntmt1
Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms: 2610205E22Rik, Mettl11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66617
Homologene: 5439
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
Mastl
Name: microtubule associated serine/threonine kinase-like
Synonyms: THC2, 2700091H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67121
Homologene: 12086
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig1, Robo3a, Rig-1, Rbig1, Robo3b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Iqgap3
Name: IQ motif containing GTPase activating protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 404710
Homologene: 26400
Ppp4r3a
Name: protein phosphatase 4 regulatory subunit 3A
Synonyms: Smek1, 1110034C04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68734
VEGA: 12
Homologene: 69510
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Cadm3
Name: cell adhesion molecule 3
Synonyms: BIgR, Igsf4b, Necl1, SynCAM3, Necl-1, Tsll1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94332
Homologene: 10919
Cuzd1
Name: CUB and zona pellucida-like domains 1
Synonyms: UTCZP, UO-44, ERG-1, Itmap1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16433
Homologene: 7389
Patl1
Name: protein associated with topoisomerase II homolog 1 (yeast)
Synonyms: Pat1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225929
VEGA: 19
Homologene: 82269
Parm1
Name: prostate androgen-regulated mucin-like protein 1
Synonyms: 9130213B05Rik, 2210012L08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231440
Homologene: 41036
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: nmf181, 4930542A03Rik, nmf112, bob, nmf252, mdfw, USH1D, sals, ahl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Amfr
Name: autocrine motility factor receptor
Synonyms: gp78
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23802
HGNC: HGNC:463
Homologene: 888
Ism2
Name: isthmin 2
Synonyms: Thsd3, LOC217738
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217738
Homologene: 83509
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: Shn-2, Gm20114, Schnurri-2, MIBP1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Garin3
Name: golgi associated RAB2 interactor 3
Synonyms: Fam71b, OTTMUSG00000005491
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432552
Homologene: 51067
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, Ysk2, MINK, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Trim34b
Name: tripartite motif-containing 34B
Synonyms: Trim34-2, Gm15134
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434218
Homologene: 128238
Alox5ap
Name: arachidonate 5-lipoxygenase activating protein
Synonyms: Flap, arachidonate 5 lipoxygenase activating protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11690
HGNC: HGNC:436
Homologene: 1231
Cd109
Name: CD109 antigen
Synonyms: 9930012E15Rik, Gov platelet alloantigens
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Fmo9
Name: flavin containing monooxygenase 9
Synonyms: 4831428F09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240894
Homologene: 134192
Or1j12
Name: olfactory receptor family 1 subfamily J member 12
Synonyms: GA_x6K02T2NLDC-33147742-33148680, Olfr340, MOR136-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258953
Homologene: 74159
Vmn2r104
Name: vomeronasal 2, receptor 104
Synonyms: V2r7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22313
Homologene: 129751
Vrk2
Name: vaccinia related kinase 2
Synonyms: 2810003O05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69922
Homologene: 55966
Rbm17
Name: RNA binding motif protein 17
Synonyms: 2700027J02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76938
Homologene: 13162
Or3a10
Name: olfactory receptor family 3 subfamily A member 10
Synonyms: MOR255-2, M5, GA_x6K02T2P1NL-4202012-4201065, Olfr139
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259005
Homologene: 77386
Zswim3
Name: zinc finger SWIM-type containing 3
Synonyms: 4921517A06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67538
Homologene: 15436
Samhd1
Name: SAM domain and HD domain, 1
Synonyms: E330031J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56045
Homologene: 9160
Ceacam1
Name: CEA cell adhesion molecule 1
Synonyms: Hv2, C-CAM, Cea1, mmCGM2, Mhv-1, Bgp1, Cc1, mmCGM1, mCEA1, Cea7, Cea-7, MHVR1, Bgp, CD66a, Hv-2, Cea-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26365
Homologene: 128630
Fibin
Name: fin bud initiation factor homolog (zebrafish)
Synonyms: 1110018M03Rik, Fibin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67606
Homologene: 12163
Ehd2
Name: EH-domain containing 2
Synonyms: C130052H20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259300
HGNC: HGNC:3243
Homologene: 22825
Or3a1b
Name: olfactory receptor family 3 subfamily A member 1B
Synonyms: GA_x6K02T2P1NL-4278037-4278984, Olfr401, MOR255-6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258701
HGNC: HGNC:8282
Homologene: 73922
Or9e1
Name: olfactory receptor family 9 subfamily E member 1
Synonyms: GA_x6K02T2NKPP-565870-564944, MOR222-1, Olfr311
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258530
Homologene: 77375
Pramel29
Name: PRAME like 29
Synonyms: C87977
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 97187
Homologene: 103830
Phospho2
Name: phosphatase, orphan 2
Synonyms: Phos2, 1700048E23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73373
Homologene: 41756
Mrgprb4
Name: MAS-related GPR, member B4
Synonyms: MrgB4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233230
Homologene: 115575
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 166,673,667 bp
  • A to G, chromosome 1 at 173,346,545 bp
  • A to G, chromosome 2 at 11,590,704 bp
  • C to A, chromosome 2 at 23,139,967 bp
  • GTGGCT to GT, chromosome 2 at 29,154,061 bp
  • A to G, chromosome 2 at 30,822,365 bp
  • T to C, chromosome 2 at 36,453,130 bp
  • T to C, chromosome 2 at 69,795,851 bp
  • C to T, chromosome 2 at 110,362,197 bp
  • A to G, chromosome 2 at 157,106,229 bp
  • T to C, chromosome 2 at 164,820,389 bp
  • C to A, chromosome 3 at 88,107,596 bp
  • A to G, chromosome 4 at 144,209,622 bp
  • A to G, chromosome 5 at 91,594,306 bp
  • A to G, chromosome 5 at 110,794,629 bp
  • T to C, chromosome 5 at 149,285,439 bp
  • A to T, chromosome 7 at 15,964,129 bp
  • T to A, chromosome 7 at 25,474,017 bp
  • T to A, chromosome 7 at 48,198,336 bp
  • A to T, chromosome 7 at 104,336,232 bp
  • C to T, chromosome 7 at 131,316,134 bp
  • A to T, chromosome 8 at 94,005,214 bp
  • C to A, chromosome 9 at 37,428,104 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • C to T, chromosome 10 at 60,382,653 bp
  • C to A, chromosome 11 at 26,483,324 bp
  • T to C, chromosome 11 at 46,405,212 bp
  • T to A, chromosome 11 at 58,841,882 bp
  • T to C, chromosome 11 at 70,612,508 bp
  • C to T, chromosome 11 at 74,044,827 bp
  • T to C, chromosome 11 at 74,121,982 bp
  • T to C, chromosome 12 at 76,288,925 bp
  • T to C, chromosome 12 at 87,299,663 bp
  • T to C, chromosome 12 at 101,042,647 bp
  • A to G, chromosome 13 at 92,790,708 bp
  • T to C, chromosome 17 at 3,193,004 bp
  • T to A, chromosome 17 at 20,048,193 bp
  • T to C, chromosome 17 at 24,281,314 bp
  • T to C, chromosome 19 at 11,923,831 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2859 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040449-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.