Strain Name:
C57BL/6J-MtgxR3703Btlr/Mmmh
Stock Number:
040696-MU
Citation ID:
RRID:MMRRC_040696-MU
Other Names:
R3703 (G1), C57BL/6J-MtgxR3703Btlr
Major Collection:

Gene Information

Kifc3
Name: kinesin family member C3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 16582
HGNC: HGNC:6326
Homologene: 124421
Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: TonEBP, nfatz, OREBP, B130038B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Arhgap10
Name: Rho GTPase activating protein 10
Synonyms: A930033B01Rik, PSGAP-m, PSGAP-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 78514
Homologene: 12695
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Bcap29
Name: B cell receptor associated protein 29
Synonyms: Bap29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 12033
VEGA: 12
Homologene: 22411
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 64652
Homologene: 136161
Rab1a
Name: RAB1A, member RAS oncogene family
Synonyms: Rab-1, Gtbp, Rab1, ras-related YPT1 protein, Ypt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 19324
HGNC: HGNC:9758
Homologene: 36154
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, Bat2l2, Bat2d, 1810043M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226562
Homologene: 41015
4932438A13Rik
Name: RIKEN cDNA 4932438A13 gene
Synonyms: FSA, Tweek
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229227
Homologene: 52105
Nt5c3
Name: 5'-nucleotidase, cytosolic III
Synonyms: cN-III, PSN1, 1600024P05Rik, lupin, PN-1, p36, 2610206B05Rik, Umph1, Umph-1, PN-I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 107569
Homologene: 9534
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: Tg(SMN2)89Ahmb, SMN2, 6330570A01Rik, mGlu7a receptor, E130018M02Rik, Gpr1g, mGluR7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Rasa3
Name: RAS p21 protein activator 3
Synonyms: R-Ras gap, GAPIII activator 3, hlb381, GAPIII, Ras GTPase-activating protein III, scat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 19414
Homologene: 7217
Snx9
Name: sorting nexin 9
Synonyms: SDP1, SH3PX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 66616
VEGA: 17
Homologene: 49454
Dnajc19
Name: DnaJ heat shock protein family (Hsp40) member C19
Synonyms: 1810055D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 67713
Homologene: 87176
Sympk
Name: symplekin
Synonyms: 1500016F02Rik, 4632415H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 68188
Homologene: 37969
Hnrnpul2
Name: heterogeneous nuclear ribonucleoprotein U-like 2
Synonyms: 1110031M08Rik, Hnrpul2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 68693
VEGA: 19
Homologene: 28583
Asap3
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: UPLC1, Ddefl1, 9430088F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230837
Homologene: 41190
Cubn
Name: cubilin (intrinsic factor-cobalamin receptor)
Synonyms: D2Wsu88e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Col13a1
Name: collagen, type XIII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 12817
HGNC: HGNC:2190
Homologene: 22421
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Tmem63a
Name: transmembrane protein 63a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 208795
Homologene: 101673
Csrp2
Name: cysteine and glycine-rich protein 2
Synonyms: Crp2, SmLim
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 13008
VEGA: 10
HGNC: HGNC:2470
Homologene: 111061
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: Myhsf1, Myhs-f1, MyHC-IIa, MHC2A, Myhs-f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Cdh12
Name: cadherin 12
Synonyms: Br-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 215654
HGNC: HGNC:1751
Homologene: 37873
Ifi207
Name: interferon activated gene 207
Synonyms: Pyhin-A, AI607873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226691
HGNC: HGNC:5395
Homologene: 115929
Hpd
Name: 4-hydroxyphenylpyruvic acid dioxygenase
Synonyms: Fla, Flp, Laf, Hppd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 15445
HGNC: HGNC:5147
Homologene: 1620
Pklr
Name: pyruvate kinase liver and red blood cell
Synonyms: Pk1, Pk-1, R-PK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18770
HGNC: HGNC:9020
Homologene: 37286
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 17836
Homologene: 136663
Brf1
Name: BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Synonyms: TAF3C, TAFIII90, 2510002F24Rik, TFIIIB90, GTF3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 72308
VEGA: 12
Homologene: 1161
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, A130097D21Rik, Prss7, enterokinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Ifi47
Name: interferon gamma inducible protein 47
Synonyms: Iigp4, IRG-47, Igrd, 47kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 15953
Homologene: 49169
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 327963
Homologene: 88945
Gpnmb
Name: glycoprotein (transmembrane) nmb
Synonyms: Osteoactivin, Dchil, DC-HIL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 93695
HGNC: HGNC:4462
Homologene: 1880
Gtpbp3
Name: GTP binding protein 3
Synonyms: Gtpbp3, 2410009F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 70359
Homologene: 6600
Zfr2
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 103406
Homologene: 88124
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
Tas1r2
Name: taste receptor, type 1, member 2
Synonyms: TR2, Gpr71, T1r2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 83770
Homologene: 75323
Edil3
Name: EGF-like repeats and discoidin I-like domains 3
Synonyms: developmental endothelial locus-1, Del1, Del-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 13612
HGNC: HGNC:3173
Homologene: 21166
Fbxl7
Name: F-box and leucine-rich repeat protein 7
Synonyms: Fbl6, D230018M15Rik, FBL7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 448987
VEGA: 15
Homologene: 69121
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 77018
Homologene: 57111
Naa30
Name: N(alpha)-acetyltransferase 30, NatC catalytic subunit
Synonyms: 5730533P17Rik, Nat12, 4930487N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 70646
Homologene: 17947
Btnl7-ps
Name: butyrophilin-like 7, pseudogene
Synonyms: Btnl7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 195349
Spns3
Name: spinster homolog 3
Synonyms: 9830002I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 77577
Homologene: 45648
Tox3
Name: TOX high mobility group box family member 3
Synonyms: 500-9, Tnrc9, CAGF9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244579
Homologene: 18257
Ctla2a
Name: cytotoxic T lymphocyte-associated protein 2 alpha
Synonyms: Ctla-2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 13024
VEGA: 13
Homologene: 130627
Rdh8
Name: retinol dehydrogenase 8
Synonyms: prRDH, LOC235033
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235033
VEGA: 9
Homologene: 41062
Nap1l3
Name: nucleosome assembly protein 1-like 3
Synonyms: MB20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 54561
HGNC: HGNC:7639
Homologene: 3334
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 162,710,691 bp
  • A to T, chromosome 1 at 173,727,463 bp
  • G to A, chromosome 1 at 180,963,114 bp
  • T to A, chromosome 2 at 13,350,943 bp
  • T to A, chromosome 2 at 13,521,297 bp
  • A to T, chromosome 2 at 76,735,408 bp
  • A to G, chromosome 3 at 34,080,229 bp
  • T to A, chromosome 3 at 36,987,581 bp
  • C to T, chromosome 3 at 89,142,701 bp
  • A to G, chromosome 3 at 130,550,033 bp
  • TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGAGGAGGA, chromosome 4 at 136,241,241 bp
  • G to A, chromosome 4 at 139,667,418 bp
  • G to A, chromosome 5 at 123,181,846 bp
  • T to A, chromosome 6 at 49,051,865 bp
  • A to G, chromosome 6 at 56,883,667 bp
  • G to T, chromosome 6 at 110,646,348 bp
  • C to T, chromosome 6 at 121,888,556 bp
  • A to G, chromosome 7 at 19,040,561 bp
  • A to T, chromosome 8 at 13,588,972 bp
  • T to G, chromosome 8 at 71,492,135 bp
  • C to T, chromosome 8 at 77,259,056 bp
  • G to T, chromosome 8 at 90,248,905 bp
  • G to A, chromosome 8 at 95,104,028 bp
  • T to A, chromosome 8 at 107,351,421 bp
  • C to T, chromosome 9 at 20,823,333 bp
  • A to G, chromosome 10 at 61,867,829 bp
  • T to G, chromosome 10 at 81,246,079 bp
  • G to A, chromosome 10 at 110,937,874 bp
  • T to G, chromosome 11 at 20,224,506 bp
  • T to C, chromosome 11 at 49,095,525 bp
  • A to G, chromosome 11 at 67,189,601 bp
  • C to T, chromosome 11 at 72,499,530 bp
  • G to A, chromosome 11 at 74,083,319 bp
  • T to C, chromosome 12 at 31,617,152 bp
  • T to C, chromosome 12 at 112,969,371 bp
  • T to A, chromosome 13 at 60,936,007 bp
  • A to T, chromosome 13 at 89,177,298 bp
  • A to G, chromosome 14 at 31,176,745 bp
  • A to G, chromosome 14 at 49,187,602 bp
  • C to A, chromosome 15 at 21,583,826 bp
  • C to A, chromosome 15 at 26,543,755 bp
  • A to G, chromosome 15 at 66,021,739 bp
  • G to C, chromosome 16 at 32,753,919 bp
  • T to C, chromosome 16 at 79,054,142 bp
  • T to A, chromosome 17 at 5,928,200 bp
  • T to A, chromosome 17 at 34,533,967 bp
  • A to G, chromosome 19 at 8,824,409 bp
  • A to T, chromosome X at 122,395,524 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3703 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040696-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.