Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3704Btlr/Mmmh
Stock Number:
040697-MU
Citation ID:
RRID:MMRRC_040697-MU
Other Names:
R3704 (G1), C57BL/6J-MtgxR3704Btlr
Major Collection:

Strain Information

Bcap29
Name: B cell receptor associated protein 29
Synonyms: Bap29
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12033
VEGA: 12
Homologene: 22411
Jarid2
Name: jumonji and AT-rich interaction domain containing 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: 4933425K22Rik, Gtar, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Reps1
Name: RalBP1 associated Eps domain containing protein
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19707
Homologene: 7515
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Brwd3
Name: bromodomain and WD repeat domain containing 3
Synonyms: LOC236955, Brodl, D030064D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 382236
Homologene: 18736
Nemf
Name: nuclear export mediator factor
Synonyms: 4933405E14Rik, 1500011I12Rik, Sdccag1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66244
VEGA: 12
Homologene: 3458
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Paip2
Name: polyadenylate-binding protein-interacting protein 2
Synonyms: 2310050K10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67869
Homologene: 22978
Asap3
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: UPLC1, 9430088F20Rik, Ddefl1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230837
Homologene: 41190
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Col13a1
Name: collagen, type XIII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12817
HGNC: HGNC:2190
Homologene: 22421
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Or8b101
Name: olfactory receptor family 8 subfamily B member 101
Synonyms: GA_x6K02T2PVTD-31787920-31788864, MOR162-4, Olfr888
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258416
Homologene: 84577
Pde5a
Name: phosphodiesterase 5A, cGMP-specific
Synonyms: PDE5A1, Pde5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242202
HGNC: HGNC:8784
Homologene: 842
Alox15
Name: arachidonate 15-lipoxygenase
Synonyms: 12-LO, L-12LO, Alox12l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11687
HGNC: HGNC:433
Homologene: 44935
Tmem63a
Name: transmembrane protein 63a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208795
Homologene: 101673
Cdh12
Name: cadherin 12
Synonyms: Br-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 215654
HGNC: HGNC:1751
Homologene: 37873
Capn1
Name: calpain 1
Synonyms: mu-calpin, Capa-1, Capa1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12333
VEGA: 19
HGNC: HGNC:1476
Homologene: 3800
Raet1c
Name: retinoic acid early transcript gamma
Synonyms: RAE-1gamma, Rae1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Ugt2b37
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 112417
Homologene: 137225
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Zmat4
Name: zinc finger, matrin type 4
Synonyms: 9630048M01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320158
Homologene: 81899
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Zfr2
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103406
Homologene: 88124
Xirp1
Name: xin actin-binding repeat containing 1
Synonyms: Xin, mXin alpha, Cmya1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22437
VEGA: 9
Homologene: 7998
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
Ifi35
Name: interferon-induced protein 35
Synonyms: IFP35, 2010008K16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70110
HGNC: HGNC:5399
Homologene: 4040
Plcd1
Name: phospholipase C, delta 1
Synonyms: PLC-delta 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18799
VEGA: 9
HGNC: HGNC:9060
Homologene: 21252
Fbxl7
Name: F-box and leucine-rich repeat protein 7
Synonyms: Fbl6, FBL7, D230018M15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 448987
VEGA: 15
Homologene: 69121
9930111J21Rik1
Name: RIKEN cDNA 9930111J21 gene 1
Synonyms: 9930111J21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 667214
Homologene: 83188
Mill1
Name: MHC I like leukocyte 1
Synonyms: 5530400I18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 266815
HGNC: HGNC:7090
Homologene: 105329
Akr1b10
Name: aldo-keto reductase family 1, member B10
Synonyms: 2310005E10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67861
Homologene: 128412
Prl2c2
Name: prolactin family 2, subfamily c, member 2
Synonyms: MRP-1, PLF-1, Plf, Plf1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18811
VEGA: 13
Homologene: 40763
Mosmo
Name: modulator of smoothened
Synonyms: BC030336
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233812
Homologene: 16600
Eci2
Name: enoyl-Coenzyme A delta isomerase 2
Synonyms: HCA88, DRS1, ACBD2, Peci
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 23986
Homologene: 38145
Cd27
Name: CD27 antigen
Synonyms: Cd27, S152, Tp55, Tnfrsf7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21940
Homologene: 74386
Crisp3
Name: cysteine-rich secretory protein 3
Synonyms: CRISP-3, SGP28, CRS3, Aeg2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11572
Homologene: 135665
Srgn
Name: serglycin
Synonyms: Sgc, Prg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19073
HGNC: HGNC:9361
Homologene: 137238
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to C, chromosome 1 at 88,277,215 bp
  • C to T, chromosome 1 at 140,533,968 bp
  • G to A, chromosome 1 at 180,963,114 bp
  • T to A, chromosome 2 at 13,350,943 bp
  • A to T, chromosome 2 at 76,831,780 bp
  • T to C, chromosome 3 at 122,779,019 bp
  • A to T, chromosome 4 at 113,136,472 bp
  • TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGAGGAGGA, chromosome 4 at 136,241,241 bp
  • A to T, chromosome 5 at 87,242,987 bp
  • A to T, chromosome 5 at 90,243,969 bp
  • G to T, chromosome 6 at 34,394,754 bp
  • A to G, chromosome 6 at 34,394,755 bp
  • C to T, chromosome 6 at 125,233,398 bp
  • A to G, chromosome 7 at 18,263,053 bp
  • T to C, chromosome 7 at 75,666,550 bp
  • A to G, chromosome 7 at 120,730,605 bp
  • A to G, chromosome 8 at 23,797,414 bp
  • G to A, chromosome 8 at 95,104,028 bp
  • T to A, chromosome 9 at 38,109,003 bp
  • T to C, chromosome 9 at 119,076,209 bp
  • T to A, chromosome 9 at 120,016,907 bp
  • T to G, chromosome 10 at 18,107,680 bp
  • A to G, chromosome 10 at 22,180,845 bp
  • A to G, chromosome 10 at 61,867,829 bp
  • T to C, chromosome 10 at 62,497,830 bp
  • T to G, chromosome 10 at 81,246,079 bp
  • T to C, chromosome 11 at 48,947,976 bp
  • A to C, chromosome 11 at 55,309,650 bp
  • C to T, chromosome 11 at 70,347,308 bp
  • G to A, chromosome 11 at 101,448,604 bp
  • T to C, chromosome 12 at 31,617,152 bp
  • C to A, chromosome 12 at 69,331,130 bp
  • C to T, chromosome 13 at 13,002,225 bp
  • A to G, chromosome 13 at 34,993,233 bp
  • A to G, chromosome 13 at 44,902,355 bp
  • A to G, chromosome 14 at 31,176,745 bp
  • C to A, chromosome 15 at 21,583,826 bp
  • C to A, chromosome 15 at 26,543,755 bp
  • A to G, chromosome 15 at 66,021,739 bp
  • T to C, chromosome 15 at 71,970,307 bp
  • A to G, chromosome 17 at 40,235,957 bp
  • A to G, chromosome 18 at 35,610,921 bp
  • T to C, chromosome 19 at 6,007,371 bp
  • A to G, chromosome X at 108,760,415 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3704 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040697-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.