Strain Name:
Stock Number:
Citation ID:
Other Names:
R3704 (G1), C57BL/6J-MtgxR3704Btlr
Major Collection:

Gene Information

Name: kinesin family member C3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16582
Homologene: 124421
Name: B cell receptor associated protein 29
Synonyms: Bap29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 12033
VEGA: 12
Homologene: 22411
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
Homologene: 31279
Name: nischarin
Synonyms: 3202002H23Rik, 1200007D05Rik, edsn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 64652
Homologene: 136161
Name: ankyrin repeat domain 17
Synonyms: 4933425K22Rik, Gtar, A130069E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 81702
Homologene: 82403
Name: RalBP1 associated Eps domain containing protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19707
Homologene: 7515
Name: A kinase (PRKA) anchor protein 13
Synonyms: 1700026G02Rik, AKAP-Lbc, PROTO-LBC, 5730522G15Rik, 5830460E08Rik, PROTO-LB, Ht31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
Homologene: 4903
Name: bromodomain and WD repeat domain containing 3
Synonyms: D030064D06Rik, Brodl, LOC236955
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 382236
Homologene: 18736
Name: nuclear export mediator factor
Synonyms: 1500011I12Rik, Sdccag1, 4933405E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 66244
VEGA: 12
Homologene: 3458
Name: Holliday junction recognition protein
Synonyms: 6430706D22Rik, A730008H23Rik, C330011F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381280
Homologene: 10184
Name: polyadenylate-binding protein-interacting protein 2
Synonyms: 2310050K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67869
Homologene: 22978
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: Ddefl1, UPLC1, 9430088F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230837
Homologene: 41190
Name: cubilin (intrinsic factor-cobalamin receptor)
Synonyms: D2Wsu88e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 65969
Homologene: 37434
Name: collagen, type XIII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12817
Homologene: 22421
Name: titin
Synonyms: 2310057K23Rik, connectin, D830007G01Rik, D330041I19Rik, L56, shru, 1100001C23Rik, 2310036G12Rik, mdm, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: FAT atypical cadherin 2
Synonyms: Fath2, LOC245827, mKIAA0811, EMI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245827
Homologene: 1110
Name: olfactory receptor 888
Synonyms: MOR162-4, GA_x6K02T2PVTD-31787920-31788864
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258416
Homologene: 84577
Name: phosphodiesterase 5A, cGMP-specific
Synonyms: Pde5, PDE5A1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242202
Homologene: 842
Name: arachidonate 15-lipoxygenase
Synonyms: L-12LO, 12-LO, Alox12l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11687
Homologene: 44935
Name: transmembrane protein 63a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208795
Homologene: 101673
Name: cadherin 12
Synonyms: Br-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 215654
Homologene: 37873
Name: calpain 1
Synonyms: Capa1, Capa-1, mu-calpin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12333
VEGA: 19
Homologene: 3800
Name: retinoic acid early transcript gamma
Synonyms: Rae1c, RAE-1gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230622
Homologene: 135888
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 112417
Homologene: 137225
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69700
Homologene: 43567
Name: zinc finger, matrin type 4
Synonyms: 9630048M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 320158
Homologene: 81899
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103406
Homologene: 88124
Name: xin actin-binding repeat containing 1
Synonyms: Xin, mXin alpha, Cmya1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22437
Homologene: 7998
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110862
Homologene: 20949
Name: interferon-induced protein 35
Synonyms: IFP35, 2010008K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70110
Homologene: 4040
Name: phospholipase C, delta 1
Synonyms: PLC-delta 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18799
Homologene: 21252
Name: F-box and leucine-rich repeat protein 7
Synonyms: Fbl6, FBL7, D230018M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 448987
VEGA: 15
Homologene: 69121
Name: RIKEN cDNA 9930111J21 gene 1
Synonyms: 9930111J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 667214
Homologene: 83188
Name: MHC I like leukocyte 1
Synonyms: 5530400I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 266815
Homologene: 105329
Name: aldo-keto reductase family 1, member B10 (aldose reductase)
Synonyms: 2310005E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67861
Homologene: 128412
Name: prolactin family 2, subfamily c, member 2
Synonyms: Plf, Plf1, PLF-1, MRP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18811
VEGA: 13
Homologene: 40763
Name: modulator of smoothened
Synonyms: BC030336
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233812
Homologene: 16600
Name: enoyl-Coenzyme A delta isomerase 2
Synonyms: ACBD2, DRS1, HCA88, Peci
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 23986
Homologene: 38145
Name: CD27 antigen
Synonyms: Tp55, Cd27, S152, Tnfrsf7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21940
Homologene: 74386
Name: cysteine-rich secretory protein 3
Synonyms: CRISP-3, SGP28, CRS3, Aeg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 11572
Homologene: 135665
Name: serglycin
Synonyms: Sgc, Prg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19073
Homologene: 137238
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to C, chromosome 1 at 88,277,215 bp
  • C to T, chromosome 1 at 140,533,968 bp
  • G to A, chromosome 1 at 180,963,114 bp
  • T to A, chromosome 2 at 13,350,943 bp
  • A to T, chromosome 2 at 76,831,780 bp
  • T to C, chromosome 3 at 122,779,019 bp
  • A to T, chromosome 4 at 113,136,472 bp
  • TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGAGGAGGA, chromosome 4 at 136,241,241 bp
  • A to T, chromosome 5 at 87,242,987 bp
  • A to T, chromosome 5 at 90,243,969 bp
  • G to T, chromosome 6 at 34,394,754 bp
  • A to G, chromosome 6 at 34,394,755 bp
  • C to T, chromosome 6 at 125,233,398 bp
  • A to G, chromosome 7 at 18,263,053 bp
  • T to C, chromosome 7 at 75,666,550 bp
  • A to G, chromosome 7 at 120,730,605 bp
  • A to G, chromosome 8 at 23,797,414 bp
  • G to A, chromosome 8 at 95,104,028 bp
  • T to A, chromosome 9 at 38,109,003 bp
  • T to C, chromosome 9 at 119,076,209 bp
  • T to A, chromosome 9 at 120,016,907 bp
  • T to G, chromosome 10 at 18,107,680 bp
  • A to G, chromosome 10 at 22,180,845 bp
  • A to G, chromosome 10 at 61,867,829 bp
  • T to C, chromosome 10 at 62,497,830 bp
  • T to G, chromosome 10 at 81,246,079 bp
  • T to C, chromosome 11 at 48,947,976 bp
  • A to C, chromosome 11 at 55,309,650 bp
  • C to T, chromosome 11 at 70,347,308 bp
  • G to A, chromosome 11 at 101,448,604 bp
  • T to C, chromosome 12 at 31,617,152 bp
  • C to A, chromosome 12 at 69,331,130 bp
  • C to T, chromosome 13 at 13,002,225 bp
  • A to G, chromosome 13 at 34,993,233 bp
  • A to G, chromosome 13 at 44,902,355 bp
  • A to G, chromosome 14 at 31,176,745 bp
  • C to A, chromosome 15 at 21,583,826 bp
  • C to A, chromosome 15 at 26,543,755 bp
  • A to G, chromosome 15 at 66,021,739 bp
  • T to C, chromosome 15 at 71,970,307 bp
  • A to G, chromosome 17 at 40,235,957 bp
  • A to G, chromosome 18 at 35,610,921 bp
  • T to C, chromosome 19 at 6,007,371 bp
  • A to G, chromosome X at 108,760,415 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3704 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040697-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.