Strain Name:
C57BL/6J-MtgxR3713Btlr/Mmmh
Stock Number:
040706-MU
Citation ID:
RRID:MMRRC_040706-MU
Other Names:
R3713 (G1), C57BL/6J-MtgxR3713Btlr
Major Collection:

Gene Information

Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: X99384, paladin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 27355
VEGA: 10
Homologene: 8453
Tns3
Name: tensin 3
Synonyms: TEM6, Tens1, F830010I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 319939
Homologene: 49713
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230793
Homologene: 17144
Madcam1
Name: mucosal vascular addressin cell adhesion molecule 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 17123
VEGA: 10
HGNC: HGNC:6765
Homologene: 8413
Zfp101
Name: zinc finger protein 101
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 22643
Homologene: 137226
Akap13
Name: A kinase (PRKA) anchor protein 13
Synonyms: 1700026G02Rik, 5830460E08Rik, 5730522G15Rik, AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Estm14, Tle4l, Grg1, C230057C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 21885
Homologene: 21058
Stag1
Name: stromal antigen 1
Synonyms: SA-1, Scc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 20842
Homologene: 21191
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: mbo, Phxr3, Sp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99526
Homologene: 34521
Aqr
Name: aquarius
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 11834
Homologene: 7629
Bcam
Name: basal cell adhesion molecule
Synonyms: 1200005K12Rik, Lu, B-CAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57278
HGNC: HGNC:6722
Homologene: 21149
Rps7
Name: ribosomal protein S7
Synonyms: S7, Mtu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20115
VEGA: 12
Homologene: 107159
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: Tg(SMN2)89Ahmb, SMN2, 6330570A01Rik, mGlu7a receptor, E130018M02Rik, Gpr1g, mGluR7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 5630401D06Rik, 2810013C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: Gtl4, cat eye syndrome chromosome region, candidate 2, 2610101O16Rik, 2810409N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Rpl21
Name: ribosomal protein L21
Synonyms: 8430440E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 19933
Homologene: 128048
Enpp7
Name: ectonucleotide pyrophosphatase/phosphodiesterase 7
Synonyms: Alk-SMase, LOC238011
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 238011
Homologene: 110852
Aak1
Name: AP2 associated kinase 1
Synonyms: D6Ertd245e, 5530400K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 269774
Homologene: 128746
Azi2
Name: 5-azacytidine induced gene 2
Synonyms: AZ2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 27215
Homologene: 8443
Lmbrd1
Name: LMBR1 domain containing 1
Synonyms: 0910001K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 68421
Homologene: 10156
Tarsl2
Name: threonyl-tRNA synthetase-like 2
Synonyms: A530046H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 272396
Homologene: 65036
Myo15
Name: myosin XV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Reln
Name: reelin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Dnahc12, HL-19, DLP12, HL19, DHC3, 4921531P07Rik, Hdhc3, Dnahc7l, LOC380889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 64580
Homologene: 11208
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Birc1b, Naip-rs6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Ptprh
Name: protein tyrosine phosphatase, receptor type, H
Synonyms: SAP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Astn1
Name: astrotactin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223825
VEGA: 15
Homologene: 128807
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Ysk2, Map4k6, MINK, Misshapen/NIKs-related kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 50932
Homologene: 56762
Cct6b
Name: chaperonin containing Tcp1, subunit 6b (zeta)
Synonyms: CCTzeta-2, Cctz-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 12467
HGNC: HGNC:1621
Homologene: 55978
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238455
Homologene: 18813
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Aox1
Name: aldehyde oxidase 1
Synonyms: Aox2, Aox-2, retinal oxidase, Aox-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11761
HGNC: HGNC:553
Homologene: 68165
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235505
Homologene: 25183
Vmn1r218
Name: vomeronasal 1 receptor 218
Synonyms: V1ri5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 171256
Homologene: 110880
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 76422
Nol4
Name: nucleolar protein 4
Synonyms: 1700013J13Rik, 4930568N03Rik, LOC383304
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 319211
HGNC: HGNC:7870
Homologene: 36142
Abcd4
Name: ATP-binding cassette, sub-family D (ALD), member 4
Synonyms: Pxmp1l, P69r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 19300
VEGA: 12
HGNC: HGNC:68
Homologene: 3703
Nprl3
Name: nitrogen permease regulator-like 3
Synonyms: m(alpha)RE, HS-40, Mare, HS-26, Phg, -14 gene, Prox1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17168
Homologene: 8091
Cwh43
Name: cell wall biogenesis 43 C-terminal homolog
Synonyms: C130090K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231293
Homologene: 5474
Zfp108
Name: zinc finger protein 108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 54678
Homologene: 117959
Smcp
Name: sperm mitochondria-associated cysteine-rich protein
Synonyms: Mcsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 17235
HGNC: HGNC:6962
Neil1
Name: nei endonuclease VIII-like 1 (E. coli)
Synonyms: 2810450N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 72774
Homologene: 11616
Foxred1
Name: FAD-dependent oxidoreductase domain containing 1
Synonyms: Tex23, TEG-23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235169
Homologene: 9712
Gm9843
Name: predicted gene 9843
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 100039316
VEGA: 16
Myo18b
Name: myosin XVIIIb
Synonyms: 4933411E19Rik, 4932408L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 74376
Homologene: 53435
Efcab5
Name: EF-hand calcium binding domain 5
Synonyms: 4930563A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 319634
Homologene: 63366
Olfr385
Name: olfactory receptor 385
Synonyms: MOR135-3, GA_x6K02T2P1NL-3760313-3759375
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 259025
Homologene: 133670
Wdr35
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 74682
Homologene: 10814
Rsph6a
Name: radial spoke head 6 homolog A (Chlamydomonas)
Synonyms: Rshl1, RSP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 83434
Homologene: 36476
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 70859
Homologene: 52823
Cers3
Name: ceramide synthase 3
Synonyms: T3L, Lass3, LOC233330, related to TRH3, CerS3, 4930550L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 545975
Homologene: 18719
Phactr2
Name: phosphatase and actin regulator 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 215789
Homologene: 8816
Napsa
Name: napsin A aspartic peptidase
Synonyms: napsin, pronapsin, Kdap, NAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 16541
Homologene: 68418
Ceacam5
Name: carcinoembryonic antigen-related cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 73250
Homologene: 115938
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: rd, rd10, r, Pdeb, rd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Adgrf2
Name: adhesion G protein-coupled receptor F2
Synonyms: Gpr111, PGR20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 435529
Homologene: 45213
Timm44
Name: translocase of inner mitochondrial membrane 44
Synonyms: Tim44, D8Ertd118e, 0710005E20Rik, Mimt44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 21856
Homologene: 4631
Dexi
Name: dexamethasone-induced transcript
Synonyms: D16Bwg0586e, 1810029J14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 58239
Homologene: 8517
Olfr361
Name: olfactory receptor 361
Synonyms: GA_x6K02T2NLDC-33777519-33776551, MOR159-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258365
Homologene: 27142
Zscan4b
Name: zinc finger and SCAN domain containing 4B
Synonyms: EG665780
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 665780
Homologene: 85986
Vmn1r79
Name: vomeronasal 1 receptor 79
Synonyms: Gm9807
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 100042437
Homologene: 128342
Prdx5
Name: peroxiredoxin 5
Synonyms: PMP20, PrxV, AOEB166, AOPP, PrxV, peroxiredoxin V, Prdx6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 54683
HGNC: HGNC:9355
Homologene: 8076
Fxyd1
Name: FXYD domain-containing ion transport regulator 1
Synonyms: 1110006M24Rik, 0610012C17Rik, PML, PLM, phospholemman
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 56188
HGNC: HGNC:4025
Homologene: 3691
Galp
Name: galanin-like peptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232836
Homologene: 11217
Olfr1184
Name: olfactory receptor 1184
Synonyms: GA_x6K02T2Q125-49974190-49975125, MOR225-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258820
Homologene: 73980
Gm1330
Name: predicted gene 1330
Synonyms: LOC383753
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
Fam221a
Name: family with sequence similarity 221, member A
Synonyms: D330028D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 231946
Homologene: 18214
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 24,692,995 bp
  • C to T, chromosome 1 at 58,056,215 bp
  • T to C, chromosome 1 at 136,185,976 bp
  • A to G, chromosome 1 at 158,667,532 bp
  • A to G, chromosome 2 at 37,085,505 bp
  • G to A, chromosome 2 at 76,731,019 bp
  • C to T, chromosome 2 at 76,741,266 bp
  • C to A, chromosome 2 at 88,487,443 bp
  • A to G, chromosome 2 at 114,118,669 bp
  • T to A, chromosome 2 at 148,990,474 bp
  • T to C, chromosome 3 at 92,584,124 bp
  • T to C, chromosome 3 at 122,949,319 bp
  • A to T, chromosome 3 at 125,561,505 bp
  • G to T, chromosome 4 at 72,126,422 bp
  • G to A, chromosome 4 at 133,065,986 bp
  • A to G, chromosome 5 at 21,904,734 bp
  • A to T, chromosome 5 at 73,438,492 bp
  • A to G, chromosome 5 at 108,423,062 bp
  • G to A, chromosome 5 at 112,798,954 bp
  • G to A, chromosome 5 at 146,835,037 bp
  • T to C, chromosome 6 at 49,372,614 bp
  • T to A, chromosome 6 at 86,955,190 bp
  • G to T, chromosome 6 at 110,646,348 bp
  • T to C, chromosome 6 at 120,758,260 bp
  • A to T, chromosome 7 at 4,571,970 bp
  • A to T, chromosome 7 at 6,213,837 bp
  • T to C, chromosome 7 at 10,901,891 bp
  • A to G, chromosome 7 at 12,176,212 bp
  • G to A, chromosome 7 at 17,759,338 bp
  • G to A, chromosome 7 at 19,057,550 bp
  • T to C, chromosome 7 at 19,764,193 bp
  • T to A, chromosome 7 at 24,261,845 bp
  • G to A, chromosome 7 at 31,053,878 bp
  • A to G, chromosome 7 at 44,581,428 bp
  • G to A, chromosome 7 at 65,688,952 bp
  • G to T, chromosome 7 at 66,786,075 bp
  • A to G, chromosome 7 at 73,471,790 bp
  • T to C, chromosome 7 at 75,586,181 bp
  • A to T, chromosome 8 at 4,260,500 bp
  • A to G, chromosome 9 at 35,210,890 bp
  • A to T, chromosome 9 at 57,146,970 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 100,889,618 bp
  • G to T, chromosome 9 at 108,964,440 bp
  • A to G, chromosome 9 at 118,047,440 bp
  • C to A, chromosome 10 at 13,388,732 bp
  • G to A, chromosome 10 at 61,342,365 bp
  • A to G, chromosome 10 at 79,668,360 bp
  • G to T, chromosome 11 at 8,532,388 bp
  • G to A, chromosome 11 at 32,255,464 bp
  • A to T, chromosome 11 at 60,479,231 bp
  • G to T, chromosome 11 at 70,608,950 bp
  • A to T, chromosome 11 at 73,588,905 bp
  • A to T, chromosome 11 at 77,116,182 bp
  • A to T, chromosome 11 at 82,760,357 bp
  • A to G, chromosome 11 at 118,990,518 bp
  • A to G, chromosome 12 at 9,027,648 bp
  • G to A, chromosome 12 at 28,633,757 bp
  • C to T, chromosome 12 at 84,611,759 bp
  • A to G, chromosome 12 at 119,446,841 bp
  • A to T, chromosome 13 at 23,136,911 bp
  • A to G, chromosome 13 at 100,161,902 bp
  • T to C, chromosome 14 at 26,812,790 bp
  • T to G, chromosome 14 at 75,107,336 bp
  • A to G, chromosome 15 at 4,943,649 bp
  • A to T, chromosome 16 at 10,542,689 bp
  • A to G, chromosome 16 at 76,403,531 bp
  • A to G, chromosome 17 at 33,381,906 bp
  • A to G, chromosome 17 at 42,713,088 bp
  • T to C, chromosome 18 at 23,039,937 bp
  • C to T, chromosome 18 at 37,443,733 bp
  • T to C, chromosome 19 at 6,908,109 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3713 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040706-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.