Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3713Btlr/Mmmh
Stock Number:
040706-MU
Citation ID:
RRID:MMRRC_040706-MU
Other Names:
R3713 (G1), C57BL/6J-MtgxR3713Btlr
Major Collection:

Strain Information

Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Madcam1
Name: mucosal vascular addressin cell adhesion molecule 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17123
VEGA: 10
HGNC: HGNC:6765
Homologene: 8413
Zfp101
Name: zinc finger protein 101
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22643
Homologene: 137226
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Stag1
Name: STAG1 cohesin complex component
Synonyms: SA-1, Scc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20842
Homologene: 21191
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: Sp6, Phxr3, mbo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99526
Homologene: 34521
Bcam
Name: basal cell adhesion molecule
Synonyms: B-CAM, 1200005K12Rik, Lu
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57278
HGNC: HGNC:6722
Homologene: 21149
Rps7
Name: ribosomal protein S7
Synonyms: S7, Mtu
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20115
VEGA: 12
Homologene: 107159
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Rpl21
Name: ribosomal protein L21
Synonyms: 8430440E03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19933
Homologene: 128048
Enpp7
Name: ectonucleotide pyrophosphatase/phosphodiesterase 7
Synonyms: Alk-SMase, LOC238011
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 238011
Homologene: 110852
Aak1
Name: AP2 associated kinase 1
Synonyms: 5530400K14Rik, D6Ertd245e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269774
Homologene: 128746
Azi2
Name: 5-azacytidine induced gene 2
Synonyms: AZ2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27215
Homologene: 8443
Lmbrd1
Name: LMBR1 domain containing 1
Synonyms: 0910001K20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68421
Homologene: 10156
Tars3
Name: threonyl-tRNA synthetase 3
Synonyms: A530046H20Rik, Tarsl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272396
Homologene: 65036
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64580
Homologene: 11208
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Naip-rs6, Birc1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Cct6b
Name: chaperonin containing TCP1 subunit 6B
Synonyms: CCTzeta-2, Cctz-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12467
HGNC: HGNC:1621
Homologene: 55978
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Aox1
Name: aldehyde oxidase 1
Synonyms: retinal oxidase, Aox-1, Aox-2, Aox2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11761
HGNC: HGNC:553
Homologene: 68165
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Vmn1r218
Name: vomeronasal 1 receptor 218
Synonyms: V1ri5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171256
Homologene: 110880
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76422
Nol4
Name: nucleolar protein 4
Synonyms: 4930568N03Rik, LOC383304, 1700013J13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319211
HGNC: HGNC:7870
Homologene: 36142
Abcd4
Name: ATP-binding cassette, sub-family D member 4
Synonyms: P69r, Pxmp1l
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19300
VEGA: 12
HGNC: HGNC:68
Homologene: 3703
Nprl3
Name: nitrogen permease regulator-like 3
Synonyms: -14 gene, m(alpha)RE, Prox1, HS-26, HS-40, Phg, Mare
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17168
Homologene: 8091
Cwh43
Name: cell wall biogenesis 43 C-terminal homolog
Synonyms: C130090K23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231293
Homologene: 5474
Zfp108
Name: zinc finger protein 108
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54678
Homologene: 117959
Smcp
Name: sperm mitochondria-associated cysteine-rich protein
Synonyms: Mcsp
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17235
HGNC: HGNC:6962
Neil1
Name: nei endonuclease VIII-like 1 (E. coli)
Synonyms: 2810450N13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72774
Homologene: 11616
Foxred1
Name: FAD-dependent oxidoreductase domain containing 1
Synonyms: TEG-23, Tex23
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235169
Homologene: 9712
Gm9843
Name: predicted gene 9843
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 100039316
VEGA: 16
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Efcab5
Name: EF-hand calcium binding domain 5
Synonyms: 4930563A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319634
Homologene: 63366
Or1e26
Name: olfactory receptor family 1 subfamily E member 26
Synonyms: GA_x6K02T2P1NL-3760313-3759375, MOR135-3, Olfr385
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259025
Homologene: 133670
Wdr35
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74682
Homologene: 10814
Rsph6a
Name: radial spoke head 6 homolog A (Chlamydomonas)
Synonyms: RSP4, Rshl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83434
Homologene: 36476
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Cers3
Name: ceramide synthase 3
Synonyms: T3L, related to TRH3, LOC233330, CerS3, 4930550L11Rik, Lass3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545975
Homologene: 18719
Napsa
Name: napsin A aspartic peptidase
Synonyms: napsin, pronapsin, NAP1, Kdap
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16541
Homologene: 68418
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
HGNC: HGNC:1819
Homologene: 115938
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: rd, r, Pdeb, rd10, rd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Adgrf2
Name: adhesion G protein-coupled receptor F2
Synonyms: PGR20, Gpr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435529
Homologene: 45213
Timm44
Name: translocase of inner mitochondrial membrane 44
Synonyms: Tim44, Mimt44, D8Ertd118e, 0710005E20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21856
Homologene: 4631
Dexi
Name: dexamethasone-induced transcript
Synonyms: 1810029J14Rik, D16Bwg0586e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 58239
Homologene: 8517
Or12k8
Name: olfactory receptor family 12 subfamily K member 8
Synonyms: GA_x6K02T2NLDC-33777519-33776551, MOR159-3, Olfr361
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258365
Homologene: 27142
Zscan4b
Name: zinc finger and SCAN domain containing 4B
Synonyms: EG665780
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665780
Homologene: 85986
Vmn1r79
Name: vomeronasal 1 receptor 79
Synonyms: Gm9807
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042437
Homologene: 128342
Prdx5
Name: peroxiredoxin 5
Synonyms: peroxiredoxin V, PrxV, PrxV, PMP20, Prdx6, AOPP, AOEB166
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54683
HGNC: HGNC:9355
Homologene: 8076
Fxyd1
Name: FXYD domain-containing ion transport regulator 1
Synonyms: phospholemman, PML, 0610012C17Rik, PLM, 1110006M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56188
HGNC: HGNC:4025
Homologene: 3691
Galp
Name: galanin-like peptide
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232836
Homologene: 11217
Or4p22
Name: olfactory receptor family 4 subfamily P member 22
Synonyms: GA_x6K02T2Q125-49974190-49975125, MOR225-3, Olfr1184
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258820
Homologene: 73980
Gm1330
Name: predicted gene 1330
Synonyms: LOC383753
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 115489557
Fam221a
Name: family with sequence similarity 221, member A
Synonyms: D330028D13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231946
Homologene: 18214
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 24,692,995 bp
  • C to T, chromosome 1 at 58,056,215 bp
  • T to C, chromosome 1 at 136,185,976 bp
  • A to G, chromosome 1 at 158,667,532 bp
  • A to G, chromosome 2 at 37,085,505 bp
  • G to A, chromosome 2 at 76,731,019 bp
  • C to T, chromosome 2 at 76,741,266 bp
  • C to A, chromosome 2 at 88,487,443 bp
  • A to G, chromosome 2 at 114,118,669 bp
  • T to A, chromosome 2 at 148,990,474 bp
  • T to C, chromosome 3 at 92,584,124 bp
  • T to C, chromosome 3 at 122,949,319 bp
  • A to T, chromosome 3 at 125,561,505 bp
  • G to T, chromosome 4 at 72,126,422 bp
  • G to A, chromosome 4 at 133,065,986 bp
  • A to G, chromosome 5 at 21,904,734 bp
  • A to T, chromosome 5 at 73,438,492 bp
  • A to G, chromosome 5 at 108,423,062 bp
  • G to A, chromosome 5 at 112,798,954 bp
  • G to A, chromosome 5 at 146,835,037 bp
  • T to C, chromosome 6 at 49,372,614 bp
  • T to A, chromosome 6 at 86,955,190 bp
  • G to T, chromosome 6 at 110,646,348 bp
  • T to C, chromosome 6 at 120,758,260 bp
  • A to T, chromosome 7 at 4,571,970 bp
  • A to T, chromosome 7 at 6,213,837 bp
  • T to C, chromosome 7 at 10,901,891 bp
  • A to G, chromosome 7 at 12,176,212 bp
  • G to A, chromosome 7 at 17,759,338 bp
  • G to A, chromosome 7 at 19,057,550 bp
  • T to C, chromosome 7 at 19,764,193 bp
  • T to A, chromosome 7 at 24,261,845 bp
  • G to A, chromosome 7 at 31,053,878 bp
  • A to G, chromosome 7 at 44,581,428 bp
  • G to A, chromosome 7 at 65,688,952 bp
  • G to T, chromosome 7 at 66,786,075 bp
  • A to G, chromosome 7 at 73,471,790 bp
  • T to C, chromosome 7 at 75,586,181 bp
  • A to T, chromosome 8 at 4,260,500 bp
  • A to G, chromosome 9 at 35,210,890 bp
  • A to T, chromosome 9 at 57,146,970 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 100,889,618 bp
  • G to T, chromosome 9 at 108,964,440 bp
  • A to G, chromosome 9 at 118,047,440 bp
  • C to A, chromosome 10 at 13,388,732 bp
  • G to A, chromosome 10 at 61,342,365 bp
  • A to G, chromosome 10 at 79,668,360 bp
  • G to T, chromosome 11 at 8,532,388 bp
  • G to A, chromosome 11 at 32,255,464 bp
  • A to T, chromosome 11 at 60,479,231 bp
  • G to T, chromosome 11 at 70,608,950 bp
  • A to T, chromosome 11 at 73,588,905 bp
  • A to T, chromosome 11 at 77,116,182 bp
  • A to T, chromosome 11 at 82,760,357 bp
  • A to G, chromosome 11 at 118,990,518 bp
  • A to G, chromosome 12 at 9,027,648 bp
  • G to A, chromosome 12 at 28,633,757 bp
  • C to T, chromosome 12 at 84,611,759 bp
  • A to G, chromosome 12 at 119,446,841 bp
  • A to T, chromosome 13 at 23,136,911 bp
  • A to G, chromosome 13 at 100,161,902 bp
  • T to C, chromosome 14 at 26,812,790 bp
  • T to G, chromosome 14 at 75,107,336 bp
  • A to G, chromosome 15 at 4,943,649 bp
  • A to T, chromosome 16 at 10,542,689 bp
  • A to G, chromosome 16 at 76,403,531 bp
  • A to G, chromosome 17 at 33,381,906 bp
  • A to G, chromosome 17 at 42,713,088 bp
  • T to C, chromosome 18 at 23,039,937 bp
  • C to T, chromosome 18 at 37,443,733 bp
  • T to C, chromosome 19 at 6,908,109 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3713 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040706-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.