Strain Name:
C57BL/6J-MtgxR3735Btlr/Mmmh
Stock Number:
040722-MU
Citation ID:
RRID:MMRRC_040722-MU
Other Names:
R3735 (G1), C57BL/6J-MtgxR3735Btlr
Major Collection:

Strain Information

Kcnj10
Name: potassium inwardly-rectifying channel, subfamily J, member 10
Synonyms: Kir4.1, Kir4.1, BIR10, Kir1.2, BIRK-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16513
HGNC: HGNC:6256
Homologene: 1689
Utrn
Name: utrophin
Synonyms: DRP, G-utrophin, Dmdl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Acadl
Name: acyl-Coenzyme A dehydrogenase, long-chain
Synonyms: LCAD, C79855
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11363
HGNC: HGNC:88
Homologene: 37498
Olr1
Name: oxidized low density lipoprotein (lectin-like) receptor 1
Synonyms: LOX-1, Scare1, SR-EI
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108078
HGNC: HGNC:8133
Homologene: 1910
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Dnmt2, Rnmt2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Kcnc4
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kv3.4, Kcr2-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99738
HGNC: HGNC:6236
Homologene: 68427
Shroom3
Name: shroom family member 3
Synonyms: Shrm, Shrm3, D5Ertd287e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Suclg2
Name: succinate-Coenzyme A ligase, GDP-forming, beta subunit
Synonyms: D6Wsu120e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20917
Homologene: 2854
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz1, Riz, 4833427P12Rik, E330024L24Rik, KMT8, LOC381568
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Dido1
Name: death inducer-obliterator 1
Synonyms: DIO-1, Datf1, 6720461J16Rik, dido, C130092D22Rik, D130048F08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23856
HGNC: HGNC:2680
Homologene: 34139
Sptlc2
Name: serine palmitoyltransferase, long chain base subunit 2
Synonyms: LCB2, Spt2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20773
Homologene: 21610
Stam
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Synonyms: STAM1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20844
Homologene: 37788
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
R3hdm2
Name: R3H domain containing 2
Synonyms: 1300003K24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71750
Homologene: 8954
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: Loa, 9930018I23Rik, dynein heavy chain, retrograde transport, Dnec1, MAP1C, Swl, Dnchc1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Trps1
Name: transcriptional repressor GATA binding 1
Synonyms: trichorhinophalangeal syndrome I (human), D15Ertd586e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83925
Homologene: 8556
Pgr
Name: progesterone receptor
Synonyms: ENSMUSG00000074510, NR3C3, PR, 9930019P03Rik, PR-B, PR-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18667
HGNC: HGNC:8910
Homologene: 713
Helq
Name: helicase, POLQ-like
Synonyms: Hel308, D430018E21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 191578
Homologene: 14667
Med13
Name: mediator complex subunit 13
Synonyms: Trap240, Thrap1, 1110067M05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327987
Homologene: 21067
Nup88
Name: nucleoporin 88
Synonyms: Prei2, Nup84
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19069
HGNC: HGNC:8067
Homologene: 1901
Adam17
Name: a disintegrin and metallopeptidase domain 17
Synonyms: CD156b, Tace
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11491
HGNC: HGNC:195
Homologene: 2395
Ncapg
Name: non-SMC condensin I complex, subunit G
Synonyms: 5730507H05Rik, Hcapg, MFT.M05.13
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54392
Homologene: 44071
Cep170b
Name: centrosomal protein 170B
Synonyms: AW555464
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217882
VEGA: 12
Homologene: 46165
Zfp979
Name: zinc finger protein 979
Synonyms: 2610305D13Rik, Ssm1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 112422
Homologene: 133076
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Il12rb1
Name: interleukin 12 receptor, beta 1
Synonyms: IL-12R[b], CD212
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16161
HGNC: HGNC:5971
Homologene: 4042
Fat3
Name: FAT atypical cadherin 3
Synonyms: 9430076A06Rik, D430038H04Rik, LOC382129, LOC234973
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Npy4r
Name: neuropeptide Y receptor Y4
Synonyms: NYYR-D, Ppyr1, Y4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19065
VEGA: 14
Homologene: 38119
Zfp629
Name: zinc finger protein 629
Synonyms: 9330199A09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320683
Homologene: 65318
Vwf
Name: Von Willebrand factor
Synonyms: 6820430P06Rik, B130011O06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: mdig, Megf7, 6430526J12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
C8a
Name: complement component 8, alpha polypeptide
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230558
HGNC: HGNC:1352
Homologene: 472
Rmnd5a
Name: required for meiotic nuclear division 5 homolog A
Synonyms: Gid2, 1110007A06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68477
Homologene: 5668
Dcaf10
Name: DDB1 and CUL4 associated factor 10
Synonyms: Wdr32
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242418
Homologene: 32581
Slco3a1
Name: solute carrier organic anion transporter family, member 3a1
Synonyms: 5830414C08Rik, Slc21a11, OATP-D, MJAM, Anr1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108116
Homologene: 40862
Mfsd13a
Name: major facilitator superfamily domain containing 13a
Synonyms: Tmem180, 4930449A08Rik, 4930538D17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 75146
Homologene: 12592
Kansl1l
Name: KAT8 regulatory NSL complex subunit 1-like
Synonyms: 1110028C15Rik, C430010P07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68691
Homologene: 27376
Acot12
Name: acyl-CoA thioesterase 12
Synonyms: 1300004O04Rik, Cach, 4930449F15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74156
Homologene: 12540
Krt18
Name: keratin 18
Synonyms: K18, Endo B, CK18, Krt1-18
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16668
VEGA: 15
HGNC: HGNC:6430
Homologene: 55448
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Map3k6
Name: mitogen-activated protein kinase kinase kinase 6
Synonyms: MEKK6, MAPKKK6, Ask2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53608
HGNC: HGNC:6858
Homologene: 3435
Rims4
Name: regulating synaptic membrane exocytosis 4
Synonyms: Rim4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241770
Homologene: 18123
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Grk3
Name: G protein-coupled receptor kinase 3
Synonyms: 4833444A01Rik, Adrbk2, Adrbk-2, Bark-2, beta ARK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320129
HGNC: HGNC:290
Homologene: 21072
Hck
Name: hemopoietic cell kinase
Synonyms: Hck-1, Bmk
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15162
HGNC: HGNC:4840
Homologene: 20489
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
Ccdc158
Name: coiled-coil domain containing 158
Synonyms: 4932413O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320696
Homologene: 18560
Irag2
Name: inositol 1,4,5-triphosphate receptor associated 2
Synonyms: D6Int4, D6Int5, D6Int3, Lrmp, D6Int8, D6Int7, Jaw1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Sdr16c5
Name: short chain dehydrogenase/reductase family 16C, member 5
Synonyms: Rdhe2, Scdr9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242285
Homologene: 15039
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Ido2, Indol1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209176
Homologene: 48830
Slc36a4
Name: solute carrier family 36 (proton/amino acid symporter), member 4
Synonyms: 6330573I15Rik, PAT4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234967
Homologene: 56300
Or4k44
Name: olfactory receptor family 4 subfamily K member 44
Synonyms: MOR248-7, GA_x6K02T2Q125-72589785-72588847, Olfr1294
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258887
Homologene: 74216
Prpf18
Name: pre-mRNA processing factor 18
Synonyms: 2810441A10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67229
Homologene: 2726
Bivm
Name: basic, immunoglobulin-like variable motif containing
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 246229
Homologene: 9783
Cdca7
Name: cell division cycle associated 7
Synonyms: JPO1, 2310021G01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66953
Homologene: 49970
Aoc3
Name: amine oxidase, copper containing 3
Synonyms: VAP1, SSAO, semicarbazide-sensitive amine oxidase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11754
HGNC: HGNC:550
Homologene: 2770
Zfpm1
Name: zinc finger protein, multitype 1
Synonyms: Friend of GATA-1, Fog1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22761
Homologene: 7606
Cyp2j8
Name: cytochrome P450, family 2, subfamily j, polypeptide 8
Synonyms: Cyp2j8-ps, OTTMUSG00000007938
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665095
HGNC: HGNC:2634
Homologene: 133819
F8
Name: coagulation factor VIII
Synonyms: Cf-8, Cf8, Factor VIII, FVIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 14069
HGNC: HGNC:3546
Homologene: 49153
Champ1
Name: chromosome alignment maintaining phosphoprotein 1
Synonyms: D8Ertd457e, D8Ertd569e, Zfp828
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101994
Homologene: 18780
Tpp1
Name: tripeptidyl peptidase I
Synonyms: Cln2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12751
HGNC: HGNC:2073
Homologene: 335
Tacstd2
Name: tumor-associated calcium signal transducer 2
Synonyms: GA733-1, Ly97, TROP2, EGP-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56753
Homologene: 1763
Cimip2c
Name: ciliary microtubule inner protein 2C
Synonyms: Fam166c, 1700001C02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75434
Homologene: 49920
Mogs
Name: mannosyl-oligosaccharide glucosidase
Synonyms: Gcs1, 1810017N02Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57377
Homologene: 4593
Nkx1-1
Name: NK1 homeobox 1
Synonyms: Sax2, Nkx-1.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 672284
Homologene: 78303
Tti2
Name: TELO2 interacting protein 2
Synonyms: BC019943
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234138
Homologene: 11836
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 44,126,434 bp
  • C to T, chromosome 1 at 46,299,875 bp
  • A to G, chromosome 1 at 66,801,250 bp
  • G to A, chromosome 1 at 66,853,289 bp
  • TATACATACATACATACATACATACATACATAC to TATACATACATACATACATACATACATACATACATAC, chromosome 1 at 84,814,790 bp
  • A to G, chromosome 1 at 170,302,761 bp
  • A to G, chromosome 1 at 172,369,966 bp
  • A to G, chromosome 2 at 4,643,673 bp
  • A to T, chromosome 2 at 13,519,873 bp
  • A to T, chromosome 2 at 14,129,012 bp
  • T to A, chromosome 2 at 72,483,865 bp
  • A to T, chromosome 2 at 91,498,371 bp
  • T to A, chromosome 2 at 111,537,896 bp
  • T to C, chromosome 2 at 153,129,951 bp
  • T to C, chromosome 2 at 163,863,985 bp
  • A to G, chromosome 2 at 180,684,036 bp
  • T to A, chromosome 3 at 59,091,495 bp
  • C to T, chromosome 3 at 107,439,481 bp
  • G to A, chromosome 4 at 4,005,614 bp
  • G to T, chromosome 4 at 43,549,370 bp
  • C to T, chromosome 4 at 45,348,117 bp
  • T to A, chromosome 4 at 96,444,599 bp
  • C to G, chromosome 4 at 103,266,406 bp
  • T to C, chromosome 4 at 104,817,615 bp
  • T to C, chromosome 4 at 133,246,372 bp
  • T to C, chromosome 4 at 143,134,359 bp
  • A to G, chromosome 4 at 147,613,482 bp
  • A to T, chromosome 5 at 30,482,098 bp
  • C to T, chromosome 5 at 33,433,730 bp
  • T to A, chromosome 5 at 34,610,652 bp
  • A to T, chromosome 5 at 45,696,127 bp
  • A to C, chromosome 5 at 92,632,424 bp
  • T to C, chromosome 5 at 92,964,444 bp
  • T to G, chromosome 5 at 100,790,188 bp
  • T to C, chromosome 5 at 107,655,151 bp
  • T to A, chromosome 5 at 112,953,831 bp
  • A to G, chromosome 6 at 67,534,859 bp
  • T to C, chromosome 6 at 71,396,862 bp
  • C to A, chromosome 6 at 83,116,776 bp
  • T to A, chromosome 6 at 95,497,696 bp
  • G to T, chromosome 6 at 125,588,613 bp
  • T to A, chromosome 6 at 129,499,875 bp
  • G to A, chromosome 6 at 145,160,870 bp
  • A to G, chromosome 7 at 74,504,497 bp
  • A to G, chromosome 7 at 105,751,967 bp
  • T to A, chromosome 7 at 127,612,778 bp
  • T to C, chromosome 8 at 13,878,735 bp
  • A to T, chromosome 8 at 15,069,676 bp
  • C to T, chromosome 8 at 24,535,193 bp
  • T to C, chromosome 8 at 31,155,897 bp
  • T to C, chromosome 8 at 70,817,218 bp
  • T to C, chromosome 8 at 71,348,597 bp
  • G to A, chromosome 8 at 122,323,736 bp
  • C to T, chromosome 9 at 5,358,716 bp
  • G to A, chromosome 9 at 8,901,533 bp
  • T to A, chromosome 9 at 15,738,273 bp
  • T to A, chromosome 9 at 15,937,984 bp
  • A to G, chromosome 10 at 12,478,484 bp
  • A to T, chromosome 10 at 107,899,529 bp
  • T to A, chromosome 10 at 127,465,010 bp
  • A to G, chromosome 11 at 70,956,192 bp
  • A to C, chromosome 11 at 86,279,658 bp
  • A to T, chromosome 11 at 101,332,219 bp
  • T to C, chromosome 12 at 21,325,412 bp
  • G to A, chromosome 12 at 87,341,565 bp
  • G to A, chromosome 12 at 98,855,989 bp
  • G to A, chromosome 12 at 110,631,675 bp
  • A to T, chromosome 12 at 112,741,004 bp
  • T to A, chromosome 13 at 91,784,346 bp
  • T to A, chromosome 14 at 34,147,269 bp
  • A to T, chromosome 15 at 6,822,080 bp
  • A to G, chromosome 15 at 50,846,060 bp
  • A to G, chromosome 15 at 102,028,501 bp
  • A to G, chromosome 19 at 46,368,328 bp
  • G to A, chromosome X at 75,211,375 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3735 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040722-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.