Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3760Btlr/Mmmh
Stock Number:
040740-MU
Citation ID:
RRID:MMRRC_040740-MU
Other Names:
R3760 (G1), C57BL/6J-MtgxR3760Btlr
Major Collection:

Strain Information

Gpr83
Name: G protein-coupled receptor 83
Synonyms: RP105, RP82, RP39, glucocorticoid-induced receptor, GIR, Gpr72, Gir
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14608
HGNC: HGNC:4523
Homologene: 7732
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: 2310065A22Rik, Nirf, D130071B19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109113
Homologene: 17001
Taf13
Name: TATA-box binding protein associated factor 13
Synonyms: 2010309N11Rik, 1810004N01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99730
Homologene: 4126
Epha6
Name: Eph receptor A6
Synonyms: m-ehk2, Ehk2, Hek12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13840
Homologene: 56396
Gramd1c
Name: GRAM domain containing 1C
Synonyms: 4921521N14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207798
Homologene: 129735
Map2
Name: microtubule-associated protein 2
Synonyms: MAP-2, G1-397-34, Mtap2, repro4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Wdr36
Name: WD repeat domain 36
Synonyms: 5730444A13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225348
VEGA: 18
Homologene: 6536
Ell2
Name: elongation factor for RNA polymerase II 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 192657
VEGA: 13
Homologene: 8094
Pcnx4
Name: pecanex homolog 4
Synonyms: 1810048J11Rik, Pcnxl4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67708
VEGA: 12
Homologene: 23366
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239081
Homologene: 77905
Zfp521
Name: zinc finger protein 521
Synonyms: B930086A16Rik, Evi3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225207
VEGA: 18
Homologene: 9151
Slc6a20a
Name: solute carrier family 6 (neurotransmitter transporter), member 20A
Synonyms: A730081N20Rik, Xtrp3s1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102680
Homologene: 10625
Or8k38
Name: olfactory receptor family 8 subfamily K member 38
Synonyms: GA_x6K02T2Q125-48147264-48146323, MOR191-1, Olfr1085
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258583
Adam9
Name: ADAM metallopeptidase domain 9
Synonyms: MDC9, Mltng, MDC9, Mltng
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11502
HGNC: HGNC:216
Homologene: 20824
Kcnh1
Name: potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms: ether a go-go, Eag1, Kv10.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16510
HGNC: HGNC:6250
Homologene: 68242
Vps52
Name: VPS52 GARP complex subunit
Synonyms: ARE1, tcl-w5, D430041K17Rik, Sacm2l, tclw5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224705
Homologene: 5756
Vmn1r85
Name: vomeronasal 1 receptor 85
Synonyms: V1rj3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252909
Homologene: 74338
Serpinb3d
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 394252
Homologene: 130559
Or5b109
Name: olfactory receptor family 5 subfamily B member 109
Synonyms: GA_x6K02T2RE5P-3560863-3561795, MOR202-29P, Olfr1463
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258120
HGNC: HGNC:8324
Homologene: 133886
Vmn2r-ps158
Name: vomeronasal 2, receptor, pseudogene 158
Synonyms: Gm9268, Vmn2r126
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668612
Homologene: 104832
Csf1r
Name: colony stimulating factor 1 receptor
Synonyms: CSF-1R, M-CSFR, CD115, Fim-2, Fms, Csfmr, Fim2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12978
HGNC: HGNC:2433
Homologene: 3817
H3c7
Name: H3 clustered histone 7
Synonyms: H3.2-221, Hist1h3f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 260423
Homologene: 133885
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 66,438,918 bp
  • C to T, chromosome 1 at 107,081,574 bp
  • T to C, chromosome 1 at 162,692,851 bp
  • T to C, chromosome 1 at 192,506,024 bp
  • G to A, chromosome 2 at 86,657,888 bp
  • T to C, chromosome 3 at 108,578,108 bp
  • T to C, chromosome 3 at 148,817,235 bp
  • T to C, chromosome 4 at 112,937,458 bp
  • T to C, chromosome 4 at 141,909,813 bp
  • T to C, chromosome 5 at 108,670,112 bp
  • C to T, chromosome 5 at 110,789,357 bp
  • A to T, chromosome 7 at 13,085,005 bp
  • G to A, chromosome 7 at 43,024,078 bp
  • A to T, chromosome 8 at 24,993,124 bp
  • A to T, chromosome 9 at 14,860,738 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 123,662,989 bp
  • T to C, chromosome 10 at 20,276,281 bp
  • A to G, chromosome 10 at 108,264,734 bp
  • A to G, chromosome 11 at 59,028,580 bp
  • C to T, chromosome 12 at 72,567,006 bp
  • T to A, chromosome 12 at 103,092,705 bp
  • T to C, chromosome 13 at 23,544,815 bp
  • A to T, chromosome 13 at 75,762,162 bp
  • A to T, chromosome 14 at 50,362,243 bp
  • A to T, chromosome 16 at 43,997,791 bp
  • T to A, chromosome 16 at 60,220,984 bp
  • T to C, chromosome 17 at 33,960,188 bp
  • T to C, chromosome 18 at 13,844,629 bp
  • A to G, chromosome 18 at 32,847,329 bp
  • G to A, chromosome 18 at 61,114,737 bp
  • T to C, chromosome 19 at 13,234,886 bp
  • T to C, chromosome 19 at 30,073,931 bp
  • C to T, chromosome X at 56,545,208 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3760 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040740-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.