Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3764Btlr/Mmmh
Stock Number:
040741-MU
Citation ID:
RRID:MMRRC_040741-MU
Other Names:
R3764 (G1), C57BL/6J-MtgxR3764Btlr
Major Collection:

Strain Information

Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Pcm1
Name: pericentriolar material 1
Synonyms: 9430077F19Rik, 2600002H09Rik, C030044G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18536
HGNC: HGNC:8727
Homologene: 4518
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100763
Homologene: 8783
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Dhx15
Name: DEAH-box helicase 15
Synonyms: mDEAH9, DBP1, HRH2, Ddx15, DEAH (Asp-Glu-Ala-His) box polypeptide 15
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13204
HGNC: HGNC:2738
Homologene: 1040
Afdn
Name: afadin, adherens junction formation factor
Synonyms: AF6, Afadin, S-afadin, I-afadin, 5033403D15Rik, Mllt4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Eif4e3
Name: eukaryotic translation initiation factor 4E member 3
Synonyms: eIF4E-3, 1300018P11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66892
Homologene: 41652
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Cadm3
Name: cell adhesion molecule 3
Synonyms: Tsll1, BIgR, Necl1, Necl-1, SynCAM3, Igsf4b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94332
Homologene: 10919
Ddx41
Name: DEAD box helicase 41
Synonyms: 2900024F02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72935
VEGA: 13
Homologene: 9431
Cep152
Name: centrosomal protein 152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99100
Homologene: 37159
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Gckr
Name: glucokinase regulatory protein
Synonyms: GKRP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231103
HGNC: HGNC:4196
Homologene: 1139
Bbox1
Name: gamma-butyrobetaine hydroxylase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170442
HGNC: HGNC:964
Homologene: 2967
Ghrhr
Name: growth hormone releasing hormone receptor
Synonyms: Ghrfr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14602
HGNC: HGNC:4266
Homologene: 640
Fmo5
Name: flavin containing monooxygenase 5
Synonyms: 5033418D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14263
HGNC: HGNC:3773
Homologene: 68185
Gsdma
Name: gasdermin A
Synonyms: H312E, Gsdm, Gsdm1, Gsdma1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57911
Homologene: 10962
Nphp4
Name: nephronophthisis 4 (juvenile) homolog (human)
Synonyms: 4930564O18Rik, nmf192
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 260305
Homologene: 9024
Pate8
Name: prostate and testis expressed 8
Synonyms: Gm17689
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100312948
Tlcd3b
Name: TLC domain containing 3B
Synonyms: A330104J06Rik, 1500016O10Rik, Fam57b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68952
Homologene: 69491
Spsb2
Name: splA/ryanodine receptor domain and SOCS box containing 2
Synonyms: SSB2, Grcc9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14794
Homologene: 8404
Sostdc1
Name: sclerostin domain containing 1
Synonyms: Sostl, ectodin, USAG-1, Wise
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66042
VEGA: 12
Homologene: 9154
Ly9
Name: lymphocyte antigen 9
Synonyms: T100, Lgp100, CD229, SLAMF3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17085
HGNC: HGNC:6730
Homologene: 1759
Wdr81
Name: WD repeat domain 81
Synonyms: shakey 5, MGC32441, nur5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Zfp40
Name: zinc finger protein 40
Synonyms: NTfin12, Zfp-40
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22700
Homologene: 136312
Hadha
Name: hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha
Synonyms: Mtpa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 97212
HGNC: HGNC:4801
Homologene: 152
Sult2a1
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
Synonyms: mSTa1, Std, Sth1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20859
Homologene: 37741
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • GT to GTT, chromosome 1 at 88,266,524 bp
  • T to C, chromosome 1 at 171,594,144 bp
  • C to T, chromosome 1 at 173,346,497 bp
  • T to A, chromosome 2 at 13,331,585 bp
  • T to C, chromosome 2 at 69,496,336 bp
  • A to T, chromosome 2 at 110,275,674 bp
  • G to A, chromosome 2 at 125,586,318 bp
  • T to C, chromosome 3 at 97,645,717 bp
  • C to T, chromosome 4 at 152,538,017 bp
  • ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT, chromosome 5 at 29,637,586 bp
  • T to C, chromosome 5 at 30,144,209 bp
  • T to A, chromosome 5 at 31,326,498 bp
  • G to A, chromosome 5 at 52,166,732 bp
  • A to T, chromosome 6 at 3,588,063 bp
  • C to T, chromosome 6 at 41,356,524 bp
  • T to C, chromosome 6 at 55,380,771 bp
  • C to T, chromosome 6 at 99,640,625 bp
  • T to C, chromosome 6 at 124,809,555 bp
  • A to T, chromosome 7 at 13,804,015 bp
  • T to C, chromosome 7 at 126,827,513 bp
  • A to G, chromosome 8 at 41,330,882 bp
  • A to T, chromosome 9 at 36,581,818 bp
  • G to A, chromosome 11 at 75,452,803 bp
  • A to T, chromosome 11 at 98,670,767 bp
  • G to A, chromosome 12 at 36,317,021 bp
  • G to A, chromosome 13 at 55,534,480 bp
  • T to A, chromosome 13 at 59,800,380 bp
  • G to A, chromosome 17 at 13,846,589 bp
  • T to A, chromosome 17 at 23,177,127 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3764 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040741-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.