Strain Name:
C57BL/6J-MtgxR3772Btlr/Mmmh
Stock Number:
040748-MU
Citation ID:
RRID:MMRRC_040748-MU
Other Names:
R3772 (G1), C57BL/6J-MtgxR3772Btlr
Major Collection:

Strain Information

Bmp7
Name: bone morphogenetic protein 7
Synonyms: OP1, osteogenic protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12162
HGNC: HGNC:1074
Homologene: 20410
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Frrs1
Name: ferric-chelate reductase 1
Synonyms: Sdfr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20321
Homologene: 40653
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: 0610010D24Rik, Daple
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LR3, LRP7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 16973
HGNC: HGNC:6697
Homologene: 1746
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: C130061D10Rik, Phr1, Pam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105689
Homologene: 9005
Aurka
Name: aurora kinase A
Synonyms: IAK, IAK1, AIRK1, Aurora-A, Ark1, aurora A, Stk6, Ayk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20878
Homologene: 2670
Arfgap2
Name: ADP-ribosylation factor GTPase activating protein 2
Synonyms: 2310032E02Rik, Zfp289
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77038
Homologene: 8735
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: nuc, bHLHd2, SREBP2gc, SREBP-2, SREBP2, lop13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430040A19Rik, Bruce, A430032G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12211
Homologene: 7248
Sf3b1
Name: splicing factor 3b, subunit 1
Synonyms: 2810001M05Rik, SF3b155, Prp10, Targ4, SAP155
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 81898
Homologene: 6696
Xrn2
Name: 5'-3' exoribonuclease 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 24128
Homologene: 6927
Dis3l2
Name: DIS3 like 3'-5' exoribonuclease 2
Synonyms: 4930429A22Rik, 8030493P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208718
Homologene: 62417
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230393
Homologene: 9842
Zwilch
Name: zwilch kinetochore protein
Synonyms: 2310031L18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68014
Homologene: 32381
Pid1
Name: phosphotyrosine interaction domain containing 1
Synonyms: 5033414K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98496
Homologene: 9924
Ap1g1
Name: adaptor protein complex AP-1, gamma 1 subunit
Synonyms: D8Ertd374e, Adtg, gamma-adaptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11765
HGNC: HGNC:555
Homologene: 47995
Ttk
Name: Ttk protein kinase
Synonyms: Esk1, Mps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22137
Homologene: 2489
Strada
Name: STE20-related kinase adaptor alpha
Synonyms: 2610019A05Rik, 6030402H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72149
Homologene: 12448
Adgrl1
Name: adhesion G protein-coupled receptor L1
Synonyms: lectomedin-2, 2900070I05Rik, Lec2, Lphn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 330814
Homologene: 8951
Sez6l2
Name: seizure related 6 homolog like 2
Synonyms: Psk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233878
Homologene: 8237
Lrig1
Name: leucine-rich repeats and immunoglobulin-like domains 1
Synonyms: Img, LIG-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16206
Homologene: 7380
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: LOC381562, D930005K06Rik, Zubr1, p600, A930005E13Rik, 1810009A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Ten-m4, ELM2, l(7)-3Rn, Odz4, Doc4, l7Rn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23966
Homologene: 8034
Shisal1
Name: shisa like 1
Synonyms: 1810041L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72301
Homologene: 28255
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: Ptpt9, PTP-NU3, PTPsigma, RPTPsigma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Septin10
Name: septin 10
Synonyms: Sept10, 4921515A04Rik, 9430099J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103080
VEGA: 10
Homologene: 27035
Pgam5
Name: phosphoglycerate mutase family member 5
Synonyms: 2610528A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72542
Homologene: 14597
Rnf214
Name: ring finger protein 214
Synonyms: D130054N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235315
Homologene: 109357
Ska3
Name: spindle and kinetochore associated complex subunit 3
Synonyms: F630043A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219114
VEGA: 14
Homologene: 124284
Ccl2
Name: chemokine (C-C motif) ligand 2
Synonyms: HC11, monocyte chemoattractant protein-1, MCP-1, MCAF, MCP1, Scya2, Sigje, monocyte chemotactic protein, SMC-CF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20296
Homologene: 2241
Krt74
Name: keratin 74
Synonyms: Kb37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 406222
VEGA: 15
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71355
Homologene: 65061
Aldh1a2
Name: aldehyde dehydrogenase family 1, subfamily A2
Synonyms: Raldh2, Aldh1a7, retinaldehyde dehydrogenase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19378
Homologene: 68368
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Stradb
Name: STE20-related kinase adaptor beta
Synonyms: Als2cr2, PRO1038, D1Ucla2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227154
Homologene: 10237
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 21683
Homologene: 3955
Gm5422
Name: predicted pseudogene 5422
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432448
VEGA: 10
Zfp251
Name: zinc finger protein 251
Synonyms: 9130001M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 71591
VEGA: 15
Homologene: 87789
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Ptpro
Name: protein tyrosine phosphatase receptor type O
Synonyms: PTP-U2, PTPROt, PTP-phi, GLEPP1, PTP-BK, D28, PTP-oc, Ptpn15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70417
Homologene: 23771
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 2010003K16Rik, 4632403N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74030
Homologene: 32430
Abcb11
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: ABC16, PFIC2, Bsep, Lith1, sister of P-glycoprotein, PGY4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20274
Homologene: 2237
Cd109
Name: CD109 antigen
Synonyms: 9930012E15Rik, Gov platelet alloantigens
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235505
Homologene: 25183
Trim43a
Name: tripartite motif-containing 43A
Synonyms: Gm6021
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 547109
Homologene: 105432
Frmd4a
Name: FERM domain containing 4A
Synonyms: C230040M21Rik, 2700017I06Rik, Gm13190
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 209630
Homologene: 9971
F13a1
Name: coagulation factor XIII, A1 subunit
Synonyms: Factor XIIIA, 1200014I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74145
VEGA: 13
HGNC: HGNC:3531
Homologene: 20077
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94229
Homologene: 23340
St18
Name: suppression of tumorigenicity 18
Synonyms: Myt3, Nzf3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240690
Homologene: 8792
Pld2
Name: phospholipase D2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18806
HGNC: HGNC:9068
Homologene: 55672
Nnt
Name: nicotinamide nucleotide transhydrogenase
Synonyms: 4930423F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18115
HGNC: HGNC:7863
Cts8
Name: cathepsin 8
Synonyms: Epcs70, Epcs68, CTS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56094
VEGA: 13
HGNC: HGNC:2537
Homologene: 129897
Sun1
Name: Sad1 and UNC84 domain containing 1
Synonyms: 5730434D03Rik, Unc84a, 4632417G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77053
Homologene: 11544
Pkp3
Name: plakophilin 3
Synonyms: 2310056L12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56460
HGNC: HGNC:9025
Homologene: 5200
Zfp426
Name: zinc finger protein 426
Synonyms: Zfp68-rs1, Zfo61, KRAB1, 2900057C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235028
Homologene: 23435
Iglon5
Name: IgLON family member 5
Synonyms: A230106M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210094
Homologene: 46295
Ddx31
Name: DEAD/H box helicase 31
Synonyms: DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31, 5830444G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227674
Homologene: 6389
Lamc2
Name: laminin, gamma 2
Synonyms: nicein, 100kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16782
HGNC: HGNC:6493
Homologene: 4062
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: EG637898, Gprc2a-rs3, Casr-rs3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 637898
Homologene: 129683
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: activated p21cdc42Hs kinase, ACK1, P21cdc42Hs kinase, Ack, Pyk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 51789
Homologene: 4224
Nid1
Name: nidogen 1
Synonyms: entactin, nidogen-1, entactin 1, entactin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Pag1
Name: phosphoprotein associated with glycosphingolipid microdomains 1
Synonyms: Cbp, F730007C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 94212
Homologene: 10198
Fmn1
Name: formin 1
Synonyms: Fmn, formin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Rwdd2a
Name: RWD domain containing 2A
Synonyms: 1700030C20Rik, Rwdd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 69519
Homologene: 12315
Ctnna2
Name: catenin (cadherin associated protein), alpha 2
Synonyms: Catna2, Catna, alpha N-catenin, alpha(N)-catenin, chp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Aldh3a1
Name: aldehyde dehydrogenase family 3, subfamily A1
Synonyms: Aldh3, Ahd-4, Ahd4, Aldh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11670
HGNC: HGNC:405
Homologene: 20175
Or1o4
Name: olfactory receptor family 1 subfamily O member 4
Synonyms: Olfr99, MOR156-1, GA_x6K02T2PSCP-1720261-1719344
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258508
Homologene: 74030
Col4a6
Name: collagen, type IV, alpha 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 94216
HGNC: HGNC:2208
Homologene: 48050
Clstn2
Name: calsyntenin 2
Synonyms: 2900042C18Rik, CS2, CSTN2, Cst-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 64085
Homologene: 49698
Carns1
Name: carnosine synthase 1
Synonyms: Atpgd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107239
VEGA: 19
Homologene: 26439
Zbed4
Name: zinc finger, BED type containing 4
Synonyms: 1700009F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223773
Homologene: 138455
Defb18
Name: defensin beta 18
Synonyms: EG654460
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 654460
Homologene: 86861
AC120128.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Rab9b
Name: RAB9B, member RAS oncogene family
Synonyms: 9330195C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 319642
Homologene: 3136
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 6,844,329 bp
  • T to C, chromosome 1 at 18,236,621 bp
  • C to A, chromosome 1 at 54,999,991 bp
  • A to T, chromosome 1 at 58,985,385 bp
  • T to C, chromosome 1 at 84,038,197 bp
  • T to C, chromosome 1 at 86,854,408 bp
  • T to A, chromosome 1 at 153,124,251 bp
  • A to T, chromosome 2 at 4,590,622 bp
  • A to T, chromosome 2 at 28,840,869 bp
  • C to T, chromosome 2 at 31,360,896 bp
  • T to C, chromosome 2 at 62,263,943 bp
  • T to C, chromosome 2 at 66,483,648 bp
  • T to A, chromosome 2 at 69,329,376 bp
  • T to C, chromosome 2 at 76,771,367 bp
  • A to G, chromosome 2 at 91,265,366 bp
  • T to G, chromosome 2 at 113,582,118 bp
  • C to T, chromosome 2 at 145,860,446 bp
  • T to C, chromosome 2 at 147,061,287 bp
  • A to G, chromosome 2 at 172,366,960 bp
  • A to T, chromosome 2 at 172,870,222 bp
  • G to A, chromosome 3 at 9,699,628 bp
  • T to G, chromosome 3 at 116,878,387 bp
  • T to C, chromosome 3 at 145,545,286 bp
  • A to C, chromosome 4 at 88,336,161 bp
  • T to C, chromosome 4 at 139,452,700 bp
  • T to C, chromosome 5 at 52,582,746 bp
  • T to C, chromosome 5 at 110,265,593 bp
  • A to G, chromosome 5 at 139,238,820 bp
  • T to G, chromosome 6 at 76,973,769 bp
  • G to A, chromosome 6 at 84,152,351 bp
  • A to G, chromosome 6 at 94,605,817 bp
  • T to A, chromosome 6 at 137,443,594 bp
  • A to T, chromosome 7 at 42,116,556 bp
  • A to T, chromosome 7 at 43,480,613 bp
  • A to T, chromosome 7 at 96,694,880 bp
  • A to G, chromosome 7 at 126,959,203 bp
  • G to A, chromosome 7 at 141,082,346 bp
  • A to G, chromosome 8 at 83,923,004 bp
  • A to G, chromosome 8 at 109,837,786 bp
  • A to T, chromosome 9 at 20,473,117 bp
  • T to C, chromosome 9 at 42,330,996 bp
  • T to C, chromosome 9 at 45,866,634 bp
  • C to A, chromosome 9 at 57,140,377 bp
  • A to T, chromosome 9 at 64,156,034 bp
  • A to G, chromosome 9 at 71,252,920 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to T, chromosome 9 at 83,844,036 bp
  • A to C, chromosome 9 at 86,574,161 bp
  • A to T, chromosome 9 at 88,847,757 bp
  • A to G, chromosome 9 at 97,582,562 bp
  • T to A, chromosome 10 at 31,248,514 bp
  • A to T, chromosome 10 at 59,176,887 bp
  • A to G, chromosome 11 at 61,214,605 bp
  • C to T, chromosome 11 at 70,544,123 bp
  • C to T, chromosome 11 at 82,036,958 bp
  • C to T, chromosome 11 at 106,164,822 bp
  • G to A, chromosome 12 at 100,966,100 bp
  • A to G, chromosome 13 at 13,476,418 bp
  • T to C, chromosome 13 at 36,898,134 bp
  • G to A, chromosome 13 at 55,246,673 bp
  • G to A, chromosome 13 at 61,250,901 bp
  • A to G, chromosome 13 at 119,396,952 bp
  • C to T, chromosome 14 at 57,810,077 bp
  • T to C, chromosome 14 at 79,567,210 bp
  • T to C, chromosome 14 at 103,133,788 bp
  • A to G, chromosome 15 at 76,853,636 bp
  • A to G, chromosome 15 at 82,182,108 bp
  • A to T, chromosome 15 at 84,406,685 bp
  • C to T, chromosome 15 at 88,780,787 bp
  • T to C, chromosome 15 at 101,762,195 bp
  • A to G, chromosome 16 at 32,679,822 bp
  • T to C, chromosome 17 at 37,279,854 bp
  • T to C, chromosome 17 at 56,428,978 bp
  • T to A, chromosome 17 at 74,618,429 bp
  • G to A, chromosome 18 at 57,283,862 bp
  • G to A, chromosome 19 at 3,612,330 bp
  • A to G, chromosome 19 at 4,170,916 bp
  • T to A, chromosome X at 136,861,449 bp
  • C to A, chromosome X at 141,172,200 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3772 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040748-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.