Strain Name:
C57BL/6J-MtgxR4151Btlr/Mmmh
Stock Number:
040861-MU
Citation ID:
RRID:MMRRC_040861-MU
Other Names:
R4151 (G1), C57BL/6J-MtgxR4151Btlr
Major Collection:

Strain Information

Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24069
Homologene: 9262
Tnpo1
Name: transportin 1
Synonyms: D13Ertd688e, Kpnb2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238799
HGNC: HGNC:6401
Homologene: 5358
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Myo1e
Name: myosin IE
Synonyms: 9130023P14Rik, 2310020N23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Msi2
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76626
Homologene: 62199
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: slip, DNAPDcs, DNA-PKcs, DNA-PK, DOXNPH, XRCC7, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Eif3g
Name: eukaryotic translation initiation factor 3, subunit G
Synonyms: Eif3s4, p44, D0Jmb4, TU-189B2, 44kDa
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53356
VEGA: 9
HGNC: HGNC:3274
Homologene: 2784
Nptn
Name: neuroplastin
Synonyms: NP65, Sdfr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20320
Homologene: 105617
Nsmce2
Name: NSE2/MMS21 homolog, SMC5-SMC6 complex SUMO ligase
Synonyms: 1110014D18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68501
VEGA: 15
Homologene: 12271
Armc9
Name: armadillo repeat containing 9
Synonyms: 4831423D23Rik, 5730415N24Rik, 3830422A13Rik, 4930438O05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78795
Homologene: 11847
Emc8
Name: ER membrane protein complex subunit 8
Synonyms: Noc4, Fam158b, Cox4nb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18117
HGNC: HGNC:7864
Homologene: 4424
Fbxo38
Name: F-box protein 38
Synonyms: SP329, 6030410I24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107035
VEGA: 18
Homologene: 34526
Ano10
Name: anoctamin 10
Synonyms: Tmem16k
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102566
VEGA: 9
Homologene: 14314
Mlh1
Name: mutL homolog 1
Synonyms: colon cancer, nonpolyposis type 2, 1110035C23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17350
HGNC: HGNC:7127
Homologene: 208
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: GPI-DAF, complement-glycosylphosphatidylinositol, Daf1, Cromer blood group, Daf-GPI
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Gata2
Name: GATA binding protein 2
Synonyms: Gata-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14461
HGNC: HGNC:4171
Homologene: 32030
Upf2
Name: UPF2 regulator of nonsense transcripts homolog (yeast)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 326622
Homologene: 6101
Rbm33
Name: RNA binding motif protein 33
Synonyms: 3200001K10Rik, 6430512A10Rik, Prr8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381626
Homologene: 137386
Cenpe
Name: centromere protein E
Synonyms: Kif10, 312kDa, CENP-E, N-7 kinesin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Gle1
Name: GLE1 RNA export mediator
Synonyms: 4933405K21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74412
HGNC: HGNC:4315
Homologene: 20379
Map4k3
Name: mitogen-activated protein kinase kinase kinase kinase 3
Synonyms: 9530052P13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225028
VEGA: 17
HGNC: HGNC:6865
Homologene: 2683
Dpy19l4
Name: dpy-19 like 4
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Tnfrsf25
Name: tumor necrosis factor receptor superfamily, member 25
Synonyms: WSL-1, APO-3, TR3, DDR3, Tnfrsf12, WSL-LR, LARD, TRAMP, DR3, Wsl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 85030
Homologene: 13202
Ostn
Name: osteocrin
Synonyms: Ostc, musclin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239790
Homologene: 45675
Klhl1
Name: kelch-like 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93688
HGNC: HGNC:6352
Homologene: 56903
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Ube2d2b
Name: ubiquitin-conjugating enzyme E2D 2B
Synonyms: 1700013N18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73318
Homologene: 134887
Astn2
Name: astrotactin 2
Synonyms: Astnl, 1d8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56079
Homologene: 77850
Stab2
Name: stabilin 2
Synonyms: FEEL-2, STAB-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Sync
Name: syncoilin
Synonyms: 1110057H03Rik, SNIP4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68828
Homologene: 11351
Plekhb2
Name: pleckstrin homology domain containing, family B (evectins) member 2
Synonyms: Phdc, 2310009M15Rik, evt-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226971
Homologene: 9938
Ulk3
Name: unc-51-like kinase 3
Synonyms: 1200015E14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71742
VEGA: 9
Homologene: 68482
Madd
Name: MAP-kinase activating death domain
Synonyms: Rab3 GEP, 9630059K23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228355
HGNC: HGNC:6766
Homologene: 14249
Slco3a1
Name: solute carrier organic anion transporter family, member 3a1
Synonyms: Anr1, OATP-D, 5830414C08Rik, Slc21a11, MJAM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108116
Homologene: 40862
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210274
Homologene: 105965
Vmn2r104
Name: vomeronasal 2, receptor 104
Synonyms: V2r7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22313
Homologene: 129751
Kdr
Name: kinase insert domain protein receptor
Synonyms: VEGF receptor-2, VEGFR-2, VEGFR2, orv, vascular endothelial growth factor receptor- 2, Flk-1, Flk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Cfap45
Name: cilia and flagella associated protein 45
Synonyms: Ccdc19, 1700028D05Rik, Nesg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71870
Homologene: 71837
Atxn7l1
Name: ataxin 7-like 1
Synonyms: Atxn7l4, 2810423G08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380753
Homologene: 53366
Map2k1
Name: mitogen-activated protein kinase kinase 1
Synonyms: Prkmk1, Mek1, MAP kinase kinase 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26395
HGNC: HGNC:6840
Homologene: 2063
Dync2li1
Name: dynein cytoplasmic 2 light intermediate chain 1
Synonyms: mD2LIC, D2lic, 4933404O11Rik, LIC3, CGI-60
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213575
VEGA: 17
Homologene: 9336
Rnf141
Name: ring finger protein 141
Synonyms: 2610110L04Rik, ZFP36, ZNF230
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67150
Homologene: 9503
Or5aq6
Name: olfactory receptor family 5 subfamily AQ member 6
Synonyms: GA_x6K02T2Q125-48586461-48585523, MOR172-5, Olfr1109
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258762
Homologene: 86672
Mrpl43
Name: mitochondrial ribosomal protein L43
Synonyms: 4930442D21Rik, bMRP36a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 94067
VEGA: 19
Homologene: 41847
Vegfc
Name: vascular endothelial growth factor C
Synonyms: VEGF-C
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22341
Homologene: 3962
H2-Q7
Name: histocompatibility 2, Q region locus 7
Synonyms: Qa-7, Ped, Qa7, H-2Q7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15018
Homologene: 128352
Cyp8b1
Name: cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms: sterol 12-alpha-hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13124
HGNC: HGNC:2653
Homologene: 3233
Gm4204
Name: predicted gene 4204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100043064
Rfk
Name: riboflavin kinase
Synonyms: ATP:riboflavin 5'-phosphotransferase, flavokinase, 0610038L10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54391
Homologene: 115690
Slc30a2
Name: solute carrier family 30 (zinc transporter), member 2
Synonyms: Znt2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230810
Homologene: 40855
Psmd6
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms: 2400006A19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66413
HGNC: HGNC:9564
Homologene: 7157
Gm5145
Name: predicted pseudogene 5145
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381065
VEGA: 17
Gm15549
Name: predicted gene 15549
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100416244
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 34,864,483 bp
  • C to T, chromosome 1 at 86,164,775 bp
  • A to G, chromosome 1 at 130,458,155 bp
  • A to T, chromosome 1 at 135,232,579 bp
  • T to A, chromosome 1 at 172,532,221 bp
  • C to A, chromosome 2 at 5,961,705 bp
  • T to C, chromosome 2 at 29,944,044 bp
  • C to T, chromosome 2 at 87,093,170 bp
  • C to A, chromosome 2 at 91,143,083 bp
  • T to C, chromosome 3 at 98,147,071 bp
  • A to G, chromosome 3 at 135,215,153 bp
  • A to G, chromosome 4 at 11,309,485 bp
  • C to T, chromosome 4 at 65,729,320 bp
  • C to T, chromosome 4 at 129,293,726 bp
  • A to T, chromosome 4 at 134,344,048 bp
  • G to T, chromosome 4 at 152,119,801 bp
  • T to C, chromosome 5 at 19,227,292 bp
  • C to T, chromosome 5 at 28,387,940 bp
  • G to T, chromosome 5 at 75,957,101 bp
  • A to T, chromosome 5 at 107,830,881 bp
  • T to A, chromosome 6 at 88,199,638 bp
  • G to T, chromosome 7 at 74,359,838 bp
  • A to T, chromosome 7 at 110,837,199 bp
  • A to T, chromosome 7 at 144,054,828 bp
  • T to A, chromosome 8 at 54,077,789 bp
  • T to A, chromosome 8 at 68,794,598 bp
  • C to T, chromosome 8 at 120,658,637 bp
  • T to C, chromosome 9 at 20,895,133 bp
  • C to T, chromosome 9 at 57,592,367 bp
  • G to T, chromosome 9 at 58,643,542 bp
  • T to C, chromosome 9 at 64,191,505 bp
  • G to T, chromosome 9 at 70,297,351 bp
  • T to C, chromosome 9 at 111,241,596 bp
  • A to T, chromosome 9 at 121,916,068 bp
  • C to T, chromosome 9 at 122,261,535 bp
  • T to A, chromosome 10 at 39,005,428 bp
  • G to A, chromosome 10 at 87,002,983 bp
  • G to C, chromosome 11 at 88,718,044 bp
  • G to A, chromosome 12 at 33,364,482 bp
  • A to T, chromosome 13 at 98,852,899 bp
  • G to C, chromosome 14 at 14,120,157 bp
  • A to C, chromosome 14 at 96,518,316 bp
  • A to G, chromosome 15 at 59,601,365 bp
  • A to G, chromosome 16 at 15,816,773 bp
  • T to A, chromosome 16 at 27,321,402 bp
  • A to T, chromosome 17 at 20,029,885 bp
  • A to G, chromosome 17 at 20,571,098 bp
  • G to A, chromosome 17 at 35,439,687 bp
  • T to C, chromosome 17 at 80,644,534 bp
  • A to G, chromosome 17 at 84,628,335 bp
  • GTGCTGCTGCTGCTGCTGCTGC to GTGCTGCTGCTGCTGCTGC, chromosome 18 at 62,515,328 bp
  • A to C, chromosome 19 at 17,395,308 bp
  • A to G, chromosome 19 at 45,005,736 bp
  • G to A, chromosome 19 at 46,449,972 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4151 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040861-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.