Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3917Btlr/Mmmh
Stock Number:
040914-MU
Citation ID:
RRID:MMRRC_040914-MU
Other Names:
R3917 (G1), C57BL/6J-MtgxR3917Btlr
Major Collection:

Strain Information

Itprip
Name: inositol 1,4,5-triphosphate receptor interacting protein
Synonyms: DANGER
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 414801
VEGA: 19
Homologene: 62157
Zic4
Name: zinc finger protein of the cerebellum 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22774
Homologene: 32075
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Cdk11b
Name: cyclin dependent kinase 11B
Synonyms: CDK11-p110, PITSLRE proteins, CDK11-p46, CDK11-p58, Cdc2l2, Cdc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12537
Homologene: 22416
Ndufv1
Name: NADH:ubiquinone oxidoreductase core subunit V1
Synonyms: 24 kDa (FP)
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17995
HGNC: HGNC:7716
Homologene: 5151
Slc29a1
Name: solute carrier family 29 (nucleoside transporters), member 1
Synonyms: ENT1, NBMPR-sensitive equilibrative nucleoside transporter, 1200014D21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63959
Homologene: 37985
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
HGNC: HGNC:6697
Homologene: 1746
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: 4930554K12Rik, D130072O21Rik, tankyrase 1, TANK1, mTNKS1, Parp5a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21951
Homologene: 18405
Hnrnpul1
Name: heterogeneous nuclear ribonucleoprotein U-like 1
Synonyms: E1B-AP5, E1BAP5, E130317O14Rik, Hnrnpul, Hnrpul1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232989
Homologene: 31419
Smad2
Name: SMAD family member 2
Synonyms: Madr2, Smad 2, Madh2, 7120426M23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17126
HGNC: HGNC:6768
Homologene: 21197
Tdp1
Name: tyrosyl-DNA phosphodiesterase 1
Synonyms: 4921509N21Rik, SCAN1, 2810481F14Rik, E430034L06Rik, Gm40556
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104884
Homologene: 5424
Rbm28
Name: RNA binding motif protein 28
Synonyms: 2810480G15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68272
Homologene: 135952
Ccnt1
Name: cyclin T1
Synonyms: CycT1, 2810478G24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12455
HGNC: HGNC:1599
Homologene: 947
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Slu7
Name: SLU7 splicing factor homolog (S. cerevisiae)
Synonyms: D3Bwg0878e, D11Ertd730e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193116
Homologene: 4690
Myo1d
Name: myosin ID
Synonyms: 9930104H07Rik, D11Ertd9e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338367
HGNC: HGNC:7598
Homologene: 45576
Bcam
Name: basal cell adhesion molecule
Synonyms: B-CAM, 1200005K12Rik, Lu
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57278
HGNC: HGNC:6722
Homologene: 21149
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Fzd3
Name: frizzled class receptor 3
Synonyms: Fz3, D930050A07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14365
HGNC: HGNC:4041
Homologene: 23004
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Jaml
Name: junction adhesion molecule like
Synonyms: LOC270152, Amica1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270152
Homologene: 17708
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Adam19
Name: ADAM metallopeptidase domain 19
Synonyms: Mltnb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11492
HGNC: HGNC:197
Homologene: 74925
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 7330406P05Rik, 2900057D21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72993
Homologene: 32143
Gabarapl2
Name: GABA type A receptor associated protein like 2
Synonyms: 0610012F20Rik, Gef2, GATE-16, 2900019O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93739
Homologene: 68550
Zbed5
Name: zinc finger BED-type containing 5
Synonyms: 2410018M08Rik, Zbed5, Chchd2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71970
Homologene: 84838
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: DMPK-like, A930014J19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Ugcg
Name: UDP-glucose ceramide glucosyltransferase
Synonyms: GlcT-1, Epcs21, Ugcgl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22234
Homologene: 37763
Or8b37
Name: olfactory receptor family 8 subfamily B member 37
Synonyms: GA_x6K02T2PVTD-31726544-31727473, MOR162-11P, MOR162-9P, MOR162-13, MOR162-11P, Olfr1550-ps1, Olfr884
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257996
Homologene: 79400
Nwd1
Name: NACHT and WD repeat domain containing 1
Synonyms: A230063L24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319555
Homologene: 72261
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Or10al2
Name: olfactory receptor family 10 subfamily AL member 2
Synonyms: GA_x6K02T2PSCP-2131124-2132089, MOR263-13, Olfr118
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 404308
Homologene: 110622
Arhgef15
Name: Rho guanine nucleotide exchange factor 15
Synonyms: D530030K12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 442801
Homologene: 18345
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Trip6
Name: thyroid hormone receptor interactor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22051
Homologene: 37757
Acad12
Name: acyl-Coenzyme A dehydrogenase family, member 12
Synonyms: 9330129D05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 338350
Pld5
Name: phospholipase D family member 5
Synonyms: B230365F16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319455
Homologene: 16081
Trpv3
Name: transient receptor potential cation channel, subfamily V, member 3
Synonyms: 1110036I10Rik, VRL3, Nh
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246788
Homologene: 17040
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Gm1043
Name: predicted gene 1043
Synonyms: LOC381634
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381634
Homologene: 52625
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Atp1b2
Name: ATPase, Na+/K+ transporting, beta 2 polypeptide
Synonyms: Atpb-2, Amog
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11932
HGNC: HGNC:805
Homologene: 36075
Gtf3a
Name: general transcription factor III A
Synonyms: 2610111I01Rik, 5330403M05Rik, 2010015D03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66596
HGNC: HGNC:4662
Homologene: 55630
Tgm1
Name: transglutaminase 1, K polypeptide
Synonyms: protein-glutamine-gamma-glutamyltransferase, K polypeptide, TG K, TGase 1, 2310004J08Rik, TGase1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
Shank3
Name: SH3 and multiple ankyrin repeat domains 3
Synonyms: ProSAP2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 58234
Homologene: 75163
Ccdc89
Name: coiled-coil domain containing 89
Synonyms: 1700019B01Rik, BOIP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70054
Homologene: 17653
Mst1
Name: macrophage stimulating 1 (hepatocyte growth factor-like)
Synonyms: DNF15S2h, D9H3F15S2, D3F15S2h, Hgfl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15235
Homologene: 7360
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Gm12185
Name: predicted gene 12185
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 620913
Homologene: 83188
Pnpo
Name: pyridoxine 5'-phosphate oxidase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103711
Homologene: 5364
Habp2
Name: hyaluronic acid binding protein 2
Synonyms: FSAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226243
HGNC: HGNC:4798
Homologene: 3050
Tekt1
Name: tektin 1
Synonyms: MT14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21689
Homologene: 7973
Haao
Name: 3-hydroxyanthranilate 3,4-dioxygenase
Synonyms: 0610007K21Rik, 0610012J07Rik, 3HAO, 3-HAOxase, 3-HAO
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 107766
VEGA: 17
HGNC: HGNC:4796
Homologene: 8148
Spx
Name: spexin hormone
Synonyms: B230216G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319552
Homologene: 79576
Heatr3
Name: HEAT repeat containing 3
Synonyms: C030036P15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234549
Homologene: 45429
C030005K15Rik
Name: RIKEN cDNA C030005K15 gene
Type: Gene
Species: Mouse
Chromosome: 10
Jund
Name: jun D proto-oncogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16478
HGNC: HGNC:6206
Homologene: 3910
Cox6b2
Name: cytochrome c oxidase subunit 6B2
Synonyms: COXVIB2, 1700067P11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 333182
Homologene: 16948
Vmn1r57
Name: vomeronasal 1 receptor 57
Synonyms: Gm7519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665150
Homologene: 41799
Apol11b
Name: apolipoprotein L 11b
Synonyms: A330102K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328563
Homologene: 129975
Tti2
Name: TELO2 interacting protein 2
Synonyms: BC019943
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234138
Homologene: 11836
Lyzl4
Name: lysozyme-like 4
Synonyms: LYC4, 1810009N24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69032
Homologene: 23604
Ppp1r27
Name: protein phosphatase 1, regulatory subunit 27
Synonyms: toonin, 1110033I14Rik, Dysfip1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68701
Homologene: 45933
Klra14-ps
Name: killer cell lectin-like receptor subfamily A, member 14, pseudogene
Synonyms: Ly49N, EG654449, Gm15858, Klra14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 654449
Ppdpf
Name: pancreatic progenitor cell differentiation and proliferation factor
Synonyms: 3110053G12Rik, 2610317A05Rik, 0610012G23Rik, 2700038C09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66496
Homologene: 11511
Krt88
Name: keratin 88
Synonyms: 1700011A15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66322
VEGA: 15
Homologene: 11945
Zfp88
Name: withdrawn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: UN
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CGCTGCTGCTGCTGCTGCTGCTGCTGC to CGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 84,585,549 bp
  • T to A, chromosome 1 at 152,508,611 bp
  • A to G, chromosome 1 at 175,963,938 bp
  • T to C, chromosome 1 at 180,106,154 bp
  • A to T, chromosome 2 at 76,850,390 bp
  • T to A, chromosome 2 at 150,266,119 bp
  • A to G, chromosome 2 at 181,187,728 bp
  • C to T, chromosome 4 at 59,207,798 bp
  • A to T, chromosome 4 at 98,592,008 bp
  • T to C, chromosome 4 at 99,016,685 bp
  • T to C, chromosome 4 at 120,099,427 bp
  • A to G, chromosome 4 at 137,559,314 bp
  • T to C, chromosome 4 at 155,626,801 bp
  • G to A, chromosome 5 at 37,192,941 bp
  • A to G, chromosome 5 at 121,599,214 bp
  • T to C, chromosome 5 at 129,902,277 bp
  • A to G, chromosome 5 at 137,313,679 bp
  • T to A, chromosome 5 at 142,051,244 bp
  • A to G, chromosome 5 at 146,955,434 bp
  • A to G, chromosome 5 at 150,540,827 bp
  • T to C, chromosome 6 at 29,154,789 bp
  • T to C, chromosome 6 at 130,157,632 bp
  • A to C, chromosome 6 at 142,414,031 bp
  • T to G, chromosome 7 at 4,752,048 bp
  • A to T, chromosome 7 at 5,220,631 bp
  • T to C, chromosome 7 at 19,765,450 bp
  • C to T, chromosome 7 at 25,726,875 bp
  • T to C, chromosome 7 at 49,911,869 bp
  • A to G, chromosome 7 at 90,426,825 bp
  • A to G, chromosome 8 at 31,153,519 bp
  • A to G, chromosome 8 at 34,853,361 bp
  • C to T, chromosome 8 at 70,699,023 bp
  • T to A, chromosome 8 at 72,667,811 bp
  • T to G, chromosome 8 at 88,150,371 bp
  • T to A, chromosome 8 at 111,952,396 bp
  • C to G, chromosome 8 at 112,875,533 bp
  • A to T, chromosome 9 at 38,047,545 bp
  • T to C, chromosome 9 at 45,101,151 bp
  • T to G, chromosome 9 at 66,434,466 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • C to A, chromosome 9 at 91,384,341 bp
  • A to G, chromosome 9 at 108,084,295 bp
  • T to A, chromosome 9 at 121,583,035 bp
  • A to C, chromosome 10 at 97,725,591 bp
  • A to T, chromosome 11 at 36,049,078 bp
  • G to T, chromosome 11 at 43,440,684 bp
  • A to G, chromosome 11 at 46,060,935 bp
  • A to G, chromosome 11 at 48,915,933 bp
  • A to G, chromosome 11 at 68,954,176 bp
  • A to G, chromosome 11 at 69,603,075 bp
  • A to G, chromosome 11 at 72,345,748 bp
  • A to G, chromosome 11 at 73,283,734 bp
  • A to C, chromosome 11 at 80,103,294 bp
  • A to T, chromosome 11 at 80,666,578 bp
  • A to T, chromosome 11 at 83,016,993 bp
  • A to G, chromosome 11 at 96,939,757 bp
  • A to G, chromosome 11 at 120,550,959 bp
  • A to G, chromosome 12 at 99,894,717 bp
  • A to G, chromosome 12 at 100,941,107 bp
  • C to T, chromosome 14 at 12,457,702 bp
  • A to T, chromosome 14 at 26,928,604 bp
  • G to A, chromosome 14 at 55,712,757 bp
  • A to T, chromosome 14 at 65,235,930 bp
  • A to T, chromosome 15 at 65,014,884 bp
  • A to G, chromosome 15 at 77,635,304 bp
  • A to G, chromosome 15 at 89,503,384 bp
  • A to G, chromosome 15 at 98,544,059 bp
  • G to A, chromosome 15 at 101,452,928 bp
  • A to G, chromosome 17 at 18,244,358 bp
  • T to A, chromosome 17 at 37,672,793 bp
  • A to T, chromosome 17 at 45,588,973 bp
  • A to G, chromosome 17 at 83,838,799 bp
  • T to A, chromosome 18 at 76,287,937 bp
  • G to A, chromosome 19 at 3,612,330 bp
  • A to G, chromosome 19 at 4,010,002 bp
  • T to C, chromosome 19 at 47,897,750 bp
  • G to A, chromosome 19 at 55,283,399 bp
  • T to A, chromosome 19 at 56,311,179 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3917 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040914-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.