Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4271Btlr/Mmmh
Stock Number:
041076-MU
Citation ID:
RRID:MMRRC_041076-MU
Other Names:
R4271 (G1), C57BL/6J-MtgxR4271Btlr
Major Collection:

Strain Information

Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: Arip4, G630026H09Rik, Srisnf2l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81000
Homologene: 56698
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Lims1
Name: LIM and senescent cell antigen-like domains 1
Synonyms: 2310016J22Rik, 4921524A02Rik, Lims1l, PINCH1, C430041B13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110829
HGNC: HGNC:6616
Homologene: 68428
Tsnax
Name: translin-associated factor X
Synonyms: Trax
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 53424
Homologene: 4374
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: Nil2, [delta]EF1, MEB1, Tcf8, Zfx1a, Tcf18, AREB6, ZEB, Zfhep, 3110032K11Rik, Zfhx1a, Tw
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21417
Homologene: 31779
Polr1a
Name: polymerase (RNA) I polypeptide A
Synonyms: mRPA1, RPA194, 194kDa, 3010014K16Rik, Rpo1-4, 2900087K15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20019
Homologene: 7033
Scp2
Name: sterol carrier protein 2, liver
Synonyms: SCPx, nonspecific lipid transfer protein, NSL-TP, ns-LTP, SCP-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20280
Homologene: 37717
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Kif26a
Name: kinesin family member 26A
Synonyms: N-11 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668303
Homologene: 18970
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
Acp6
Name: acid phosphatase 6, lysophosphatidic
Synonyms: 5730559A09Rik, mPACPL1, ACPL1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66659
Homologene: 41128
C1qtnf6
Name: C1q and tumor necrosis factor related protein 6
Synonyms: 2810036M19Rik, CTRP6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72709
Homologene: 12481
Srpk2
Name: serine/arginine-rich protein specific kinase 2
Synonyms: mSRPK2, WBP6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20817
Homologene: 101663
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Cmtr1
Name: cap methyltransferase 1
Synonyms: 1300018I05Rik, Ftsjd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74157
Homologene: 9003
Cfap70
Name: cilia and flagella associated protein 70
Synonyms: 5330402L21Rik, Ttc18
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76670
Homologene: 17048
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Gsap
Name: gamma-secretase activating protein
Synonyms: A530088I07Rik, Pion
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212167
Homologene: 45504
V1rd19
Name: vomeronasal 1 receptor, D19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404287
Homologene: 104166
Klra13-ps
Name: killer cell lectin-like receptor subfamily A, member 13, pseudogene
Synonyms: Ly49M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16631
Duox1
Name: dual oxidase 1
Synonyms: NOXEF1, THOX1, LNOX1, 9930101G15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Or5p80
Name: olfactory receptor family 5 subfamily P member 80
Synonyms: GA_x6K02T2PBJ9-10959726-10960658, MOR204-6, Olfr508
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258769
Homologene: 72039
C1galt1
Name: core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Synonyms: core 1 beta3-Gal-T, 2210410E06Rik, T-synthase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 94192
Homologene: 10599
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
B430203G13Rik
Name: RIKEN cDNA B430203G13 gene
Type: Gene
Species: Mouse
Chromosome: 12
Actr6
Name: ARP6 actin-related protein 6
Synonyms: ArpX, Arp6, CDA12, 2010200J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67019
VEGA: 10
Homologene: 6451
Smarca2
Name: SWI/SNF related BAF chromatin remodeling complex subunit ATPase 2
Synonyms: brm, Snf2l2, 2610209L14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67155
Homologene: 2308
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Rimbp2
Name: RIMS binding protein 2
Synonyms: A930033C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231760
Homologene: 14672
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: Obph1, ORP5, 1110006M06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 79196
Homologene: 98024
Nfe2l3
Name: nuclear factor, erythroid derived 2, like 3
Synonyms: Nrf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18025
HGNC: HGNC:7783
Homologene: 3168
Chml
Name: choroideremia-like
Synonyms: Rep2, E030003F13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12663
HGNC: HGNC:1941
Homologene: 31055
Kif12
Name: kinesin family member 12
Synonyms: N-9 kinesin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16552
Homologene: 7796
Oacyl
Name: O-acyltransferase like
Synonyms: 5330437I02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319888
Homologene: 129774
Or4n4b
Name: olfactory receptor family 4 subfamily N member 4B
Synonyms: GA_x6K02T2PMLR-5992342-5991416, MOR241-2, Olfr733
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258657
Homologene: 128266
Aspg
Name: asparaginase
Synonyms: A530050D06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104816
VEGA: 12
Homologene: 113390
Chpt1
Name: choline phosphotransferase 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212862
Homologene: 69297
Spem2
Name: SPEM family member 2
Synonyms: 4933402P03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108803
Homologene: 52178
H2-T3
Name: histocompatibility 2, T region locus 3
Synonyms: H-2T3, TL, H2-Tw3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15043
Homologene: 74884
Slco4a1
Name: solute carrier organic anion transporter family, member 4a1
Synonyms: OATP-E, Slc21a12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108115
Homologene: 9482
Zfp239
Name: zinc finger protein 239
Synonyms: Mok-2, Mok2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22685
Homologene: 68480
Igkv13-87
Name: immunoglobulin kappa variable 13-87
Synonyms: Gm11145
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 692153
Gm17690
Name: predicted gene, 17690
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
Klhl15
Name: kelch-like 15
Synonyms: 6330500C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 236904
Homologene: 17703
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 175,687,794 bp
  • A to G, chromosome 2 at 76,901,635 bp
  • A to G, chromosome 2 at 104,026,204 bp
  • T to C, chromosome 2 at 122,324,375 bp
  • A to G, chromosome 2 at 180,474,210 bp
  • T to A, chromosome 3 at 88,982,040 bp
  • T to C, chromosome 3 at 96,167,891 bp
  • T to C, chromosome 3 at 97,166,618 bp
  • T to C, chromosome 4 at 63,170,746 bp
  • T to C, chromosome 4 at 108,085,211 bp
  • T to C, chromosome 5 at 21,226,350 bp
  • T to A, chromosome 5 at 23,548,515 bp
  • A to T, chromosome 5 at 64,349,946 bp
  • AGCGGCGGCGGCGGCGGCGGCGG to AGCGGCGGCGGCGGCGGCGG, chromosome 5 at 121,220,504 bp
  • T to G, chromosome 5 at 128,819,777 bp
  • T to C, chromosome 6 at 7,866,607 bp
  • A to G, chromosome 6 at 51,456,634 bp
  • A to G, chromosome 6 at 68,895,633 bp
  • G to A, chromosome 6 at 71,953,022 bp
  • G to A, chromosome 6 at 117,863,084 bp
  • C to T, chromosome 6 at 120,762,475 bp
  • A to G, chromosome 6 at 130,301,160 bp
  • A to G, chromosome 7 at 24,003,414 bp
  • A to T, chromosome 7 at 55,879,101 bp
  • T to A, chromosome 7 at 108,630,353 bp
  • T to C, chromosome 7 at 134,734,054 bp
  • G to T, chromosome 7 at 143,695,602 bp
  • T to C, chromosome 8 at 70,181,512 bp
  • T to A, chromosome 8 at 102,664,626 bp
  • T to C, chromosome 8 at 125,032,729 bp
  • A to T, chromosome 9 at 26,895,648 bp
  • G to A, chromosome 9 at 106,693,626 bp
  • T to C, chromosome 10 at 58,410,204 bp
  • C to T, chromosome 10 at 88,481,352 bp
  • T to A, chromosome 10 at 89,717,239 bp
  • T to C, chromosome 11 at 69,817,425 bp
  • T to C, chromosome 11 at 101,567,222 bp
  • CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT, chromosome 12 at 17,924,357 bp
  • A to T, chromosome 12 at 88,178,283 bp
  • G to T, chromosome 12 at 100,947,219 bp
  • T to C, chromosome 12 at 112,121,195 bp
  • C to T, chromosome 12 at 112,173,414 bp
  • T to C, chromosome 14 at 20,420,725 bp
  • A to T, chromosome 14 at 50,298,451 bp
  • G to A, chromosome 15 at 78,525,266 bp
  • T to C, chromosome 17 at 18,243,678 bp
  • T to C, chromosome 17 at 29,697,982 bp
  • T to C, chromosome 17 at 36,189,618 bp
  • C to A, chromosome 18 at 5,758,985 bp
  • T to A, chromosome 18 at 65,737,967 bp
  • T to A, chromosome 19 at 26,720,949 bp
  • AG to A, chromosome X at 94,253,112 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4271 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041076-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.