Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4369Btlr/Mmmh
Stock Number:
041116-MU
Citation ID:
RRID:MMRRC_041116-MU
Other Names:
R4369 (G1), C57BL/6J-MtgxR4369Btlr
Major Collection:

Strain Information

Ing4
Name: inhibitor of growth family, member 4
Synonyms: D6Xrf92, p29ING4, D6Wsu147e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28019
Homologene: 22952
Nmral1
Name: NmrA-like family domain containing 1
Synonyms: 1110025F24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67824
Homologene: 41388
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Ebag9
Name: estrogen receptor-binding fragment-associated gene 9
Synonyms: Rcas1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 55960
VEGA: 15
HGNC: HGNC:3123
Homologene: 3107
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 155,704,814 bp
  • C to T, chromosome 2 at 25,504,761 bp
  • C to T, chromosome 2 at 76,764,001 bp
  • A to T, chromosome 2 at 80,631,051 bp
  • T to C, chromosome 3 at 92,028,079 bp
  • C to T, chromosome 3 at 100,948,199 bp
  • T to C, chromosome 3 at 107,891,014 bp
  • ACAGGTTTCTTCAGGTTTCTT to ACAGGTTTCTT, chromosome 4 at 72,118,163 bp
  • A to T, chromosome 4 at 126,235,073 bp
  • A to G, chromosome 4 at 156,237,396 bp
  • C to G, chromosome 5 at 13,796,380 bp
  • C to T, chromosome 5 at 43,760,740 bp
  • C to T, chromosome 6 at 12,468,908 bp
  • T to C, chromosome 6 at 42,365,457 bp
  • T to A, chromosome 6 at 42,912,277 bp
  • A to T, chromosome 6 at 52,179,062 bp
  • T to C, chromosome 6 at 125,047,089 bp
  • A to T, chromosome 7 at 3,157,975 bp
  • A to G, chromosome 7 at 30,860,608 bp
  • T to C, chromosome 7 at 102,024,106 bp
  • C to T, chromosome 7 at 108,621,889 bp
  • C to T, chromosome 7 at 127,906,419 bp
  • T to C, chromosome 7 at 144,179,781 bp
  • T to A, chromosome 8 at 31,112,149 bp
  • T to C, chromosome 8 at 89,147,031 bp
  • T to A, chromosome 8 at 104,217,110 bp
  • T to G, chromosome 8 at 105,985,075 bp
  • C to T, chromosome 8 at 109,553,131 bp
  • A to T, chromosome 10 at 79,396,080 bp
  • T to C, chromosome 10 at 127,550,286 bp
  • C to T, chromosome 11 at 74,932,443 bp
  • T to C, chromosome 11 at 76,797,711 bp
  • T to C, chromosome 11 at 108,397,379 bp
  • T to C, chromosome 12 at 79,149,972 bp
  • T to C, chromosome 12 at 112,415,614 bp
  • A to T, chromosome 13 at 4,233,780 bp
  • T to A, chromosome 13 at 19,137,700 bp
  • T to C, chromosome 13 at 19,185,397 bp
  • A to G, chromosome 13 at 107,726,694 bp
  • C to T, chromosome 14 at 7,942,216 bp
  • T to C, chromosome 14 at 32,029,539 bp
  • A to G, chromosome 14 at 32,517,207 bp
  • G to T, chromosome 14 at 55,565,708 bp
  • C to T, chromosome 15 at 44,505,553 bp
  • T to C, chromosome 15 at 44,628,469 bp
  • T to C, chromosome 15 at 73,540,809 bp
  • T to C, chromosome 16 at 4,714,530 bp
  • T to G, chromosome 16 at 14,460,993 bp
  • T to C, chromosome 16 at 33,224,648 bp
  • A to G, chromosome 16 at 36,916,907 bp
  • A to G, chromosome 17 at 3,413,967 bp
  • T to C, chromosome 17 at 15,544,446 bp
  • C to T, chromosome 17 at 28,836,620 bp
  • G to A, chromosome 17 at 29,308,576 bp
  • T to C, chromosome 17 at 32,909,258 bp
  • C to T, chromosome 17 at 33,999,816 bp
  • T to C, chromosome 17 at 34,860,314 bp
  • T to C, chromosome 18 at 37,006,743 bp
  • G to A, chromosome 18 at 76,940,574 bp
  • A to G, chromosome 19 at 32,641,391 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4369 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041116-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.