Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4385Btlr/Mmmh
Stock Number:
041124-MU
Citation ID:
RRID:MMRRC_041124-MU
Other Names:
R4385 (G1), C57BL/6J-MtgxR4385Btlr
Major Collection:

Strain Information

Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Spag7
Name: sperm associated antigen 7
Synonyms: FSA-1, Fsa1l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216873
Homologene: 3595
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Csnk1g1
Name: casein kinase 1, gamma 1
Synonyms: 9130020E21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214897
HGNC: HGNC:2454
Homologene: 48692
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Metap1
Name: methionyl aminopeptidase 1
Synonyms: 1700029C17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75624
Homologene: 6488
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Cnot10
Name: CCR4-NOT transcription complex, subunit 10
Synonyms: 2600001P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78893
VEGA: 9
Homologene: 41040
Cyfip2
Name: cytoplasmic FMR1 interacting protein 2
Synonyms: Pir121, 6430511D02Rik, 1500004I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76884
Homologene: 7936
Scp2
Name: sterol carrier protein 2, liver
Synonyms: SCPx, nonspecific lipid transfer protein, NSL-TP, ns-LTP, SCP-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20280
Homologene: 37717
Cdc27
Name: cell division cycle 27
Synonyms: APC3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217232
HGNC: HGNC:1728
Homologene: 960
Zfp146
Name: zinc finger protein 146
Synonyms: OZF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26465
Homologene: 117615
Plxnb2
Name: plexin B2
Synonyms: Debt, 1110007H23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117606
Homologene: 32819
Tm9sf3
Name: transmembrane 9 superfamily member 3
Synonyms: 2810031D16Rik, 1810073M23Rik, Smbp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107358
VEGA: 19
Homologene: 10588
Rbm48
Name: RNA binding motif protein 48
Synonyms: C030048B08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269623
Homologene: 12944
Ift172
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67661
Homologene: 15202
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTP-BL, Ptpri, PTPL1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Sec24c
Name: SEC24 homolog C, COPII coat complex component
Synonyms: 2610204K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218811
VEGA: 14
Homologene: 3615
Klk1
Name: kallikrein 1
Synonyms: mGk-6, 0610007D04Rik, Klk6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16612
Homologene: 68141
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Flg
Name: filaggrin
Synonyms: profilaggrin, fillagrin, ft
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14246
VEGA: 3
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: DCC, Mrp6, Dyscalc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Apbb1
Name: amyloid beta precursor protein binding family B member 1
Synonyms: Fe65, Rir
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11785
HGNC: HGNC:581
Homologene: 898
Dtx1
Name: deltex 1, E3 ubiquitin ligase
Synonyms: Fxit1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14357
HGNC: HGNC:3060
Homologene: 74522
St6galnac6
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Synonyms: ST6GalNAcVI, Siat7f
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50935
Homologene: 8390
Gm15759
Name: predicted gene 15759
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 102636191
Ugt3a2
Name: UDP glycosyltransferases 3 family, polypeptide A2
Synonyms: Ugt3a, Ugt3a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105887
Homologene: 122787
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Col5a1
Name: collagen, type V, alpha 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12831
HGNC: HGNC:2209
Homologene: 55434
Dcbld2
Name: discoidin, CUB and LCCL domain containing 2
Synonyms: 1700055P21Rik, Esdn, CLCP1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73379
Homologene: 12499
Abcc3
Name: ATP-binding cassette, sub-family C member 3
Synonyms: 1700019L09Rik, MRP3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Zfp36
Name: zinc finger protein 36
Synonyms: Nup475, Zfp-36, Tristetraprolin, Tis11, Ttp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22695
Homologene: 2558
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: 4930428C11Rik, 4632415N18Rik, 4930463G05Rik, D19Ertd652e, Wdr96
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Rfpl4
Name: ret finger protein-like 4
Synonyms: D7Ertd486e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 192658
Homologene: 90101
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Dpep3
Name: dipeptidase 3
Synonyms: 1700018F16Rik, MBD-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71854
Homologene: 23357
Klk9
Name: kallikrein related-peptidase 9
Synonyms: 1200016C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101533
HGNC: HGNC:6370
Homologene: 40832
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: rd, r, Pdeb, rd10, rd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Vmn1r34
Name: vomeronasal 1 receptor 34
Synonyms: Gm5991
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546901
Homologene: 110800
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: SIP1, Zfx1b, 9130203F04Rik, D130016B08Rik, Zfhx1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Slc30a9
Name: solute carrier family 30 (zinc transporter), member 9
Synonyms: 2310024J23Rik, GAC63
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109108
HGNC: HGNC:1329
Homologene: 4627
Hecw1
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms: NEDL1, E130207I19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94253
VEGA: 13
Homologene: 9004
Coro2a
Name: coronin, actin binding protein 2A
Synonyms: coronin 4, IR10, 9030208C03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107684
HGNC: HGNC:2255
Homologene: 2546
A530040E14Rik
Name: RIKEN cDNA A530040E14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 621875
Gm16897
Name: predicted gene, 16897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320400
Tmem160
Name: transmembrane protein 160
Synonyms: 1810008O21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69094
Homologene: 9881
Nim1k
Name: NIM1 serine/threonine protein kinase
Synonyms: E130304F04Rik, Nim1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 245269
VEGA: 13
Homologene: 25286
Gm6686
Name: predicted pseudogene 6686
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 102639811
Homologene: 139816
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 58,254,379 bp
  • T to C, chromosome 1 at 63,566,628 bp
  • C to T, chromosome 1 at 85,109,336 bp
  • T to C, chromosome 1 at 194,959,182 bp
  • A to C, chromosome 2 at 28,024,779 bp
  • A to G, chromosome 2 at 32,615,024 bp
  • T to A, chromosome 2 at 45,023,062 bp
  • A to T, chromosome 2 at 66,484,556 bp
  • C to A, chromosome 3 at 93,293,009 bp
  • T to C, chromosome 3 at 138,475,063 bp
  • A to T, chromosome 4 at 46,541,961 bp
  • A to T, chromosome 4 at 108,071,350 bp
  • C to T, chromosome 4 at 143,698,014 bp
  • G to A, chromosome 5 at 3,590,300 bp
  • T to C, chromosome 5 at 31,286,967 bp
  • T to C, chromosome 5 at 67,315,767 bp
  • T to C, chromosome 5 at 103,533,407 bp
  • A to G, chromosome 5 at 108,427,642 bp
  • A to G, chromosome 5 at 120,694,511 bp
  • G to A, chromosome 5 at 137,436,520 bp
  • C to A, chromosome 6 at 3,516,694 bp
  • T to A, chromosome 6 at 66,637,139 bp
  • T to C, chromosome 6 at 149,326,208 bp
  • A to G, chromosome 7 at 5,110,670 bp
  • C to T, chromosome 7 at 16,459,185 bp
  • T to C, chromosome 7 at 28,377,691 bp
  • G to A, chromosome 7 at 30,162,422 bp
  • T to C, chromosome 7 at 43,794,275 bp
  • A to T, chromosome 7 at 44,228,569 bp
  • C to T, chromosome 7 at 45,995,328 bp
  • A to G, chromosome 7 at 105,567,276 bp
  • T to A, chromosome 8 at 14,930,157 bp
  • A to G, chromosome 8 at 105,978,186 bp
  • T to C, chromosome 9 at 66,019,908 bp
  • T to A, chromosome 9 at 114,631,881 bp
  • A to G, chromosome 10 at 74,550,490 bp
  • A to G, chromosome 10 at 116,346,867 bp
  • C to T, chromosome 11 at 46,242,403 bp
  • C to T, chromosome 11 at 70,669,203 bp
  • A to T, chromosome 11 at 94,368,239 bp
  • T to C, chromosome 11 at 104,534,814 bp
  • C to T, chromosome 13 at 14,316,164 bp
  • T to C, chromosome 13 at 119,712,626 bp
  • G to A, chromosome 14 at 20,690,773 bp
  • G to C, chromosome 14 at 33,955,296 bp
  • C to T, chromosome 15 at 9,306,479 bp
  • T to C, chromosome 15 at 89,160,623 bp
  • A to G, chromosome 16 at 17,386,265 bp
  • A to G, chromosome 16 at 34,815,452 bp
  • A to T, chromosome 16 at 44,491,182 bp
  • A to G, chromosome 16 at 58,463,066 bp
  • T to C, chromosome 17 at 15,566,211 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to G, chromosome 18 at 59,176,352 bp
  • A to T, chromosome 18 at 59,179,474 bp
  • A to G, chromosome 18 at 77,372,911 bp
  • T to C, chromosome 19 at 41,247,933 bp
  • T to C, chromosome 19 at 47,797,129 bp
  • A to G, chromosome 19 at 50,190,161 bp
  • G to A, chromosome Y at 1,304,756 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4385 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041124-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.