Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4385Btlr/Mmmh
Stock Number:
041124-MU
Citation ID:
RRID:MMRRC_041124-MU
Other Names:
R4385 (G1), C57BL/6J-MtgxR4385Btlr
Major Collection:

Strain Information

Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Spag7
Name: sperm associated antigen 7
Synonyms: FSA-1, Fsa1l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216873
Homologene: 3595
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Csnk1g1
Name: casein kinase 1, gamma 1
Synonyms: 9130020E21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214897
HGNC: HGNC:2454
Homologene: 48692
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Metap1
Name: methionyl aminopeptidase 1
Synonyms: 1700029C17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75624
Homologene: 6488
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 58,254,379 bp
  • T to C, chromosome 1 at 63,566,628 bp
  • C to T, chromosome 1 at 85,109,336 bp
  • T to C, chromosome 1 at 194,959,182 bp
  • A to C, chromosome 2 at 28,024,779 bp
  • A to G, chromosome 2 at 32,615,024 bp
  • T to A, chromosome 2 at 45,023,062 bp
  • A to T, chromosome 2 at 66,484,556 bp
  • C to A, chromosome 3 at 93,293,009 bp
  • T to C, chromosome 3 at 138,475,063 bp
  • A to T, chromosome 4 at 46,541,961 bp
  • A to T, chromosome 4 at 108,071,350 bp
  • C to T, chromosome 4 at 143,698,014 bp
  • G to A, chromosome 5 at 3,590,300 bp
  • T to C, chromosome 5 at 31,286,967 bp
  • T to C, chromosome 5 at 67,315,767 bp
  • T to C, chromosome 5 at 103,533,407 bp
  • A to G, chromosome 5 at 108,427,642 bp
  • A to G, chromosome 5 at 120,694,511 bp
  • G to A, chromosome 5 at 137,436,520 bp
  • C to A, chromosome 6 at 3,516,694 bp
  • T to A, chromosome 6 at 66,637,139 bp
  • T to C, chromosome 6 at 149,326,208 bp
  • A to G, chromosome 7 at 5,110,670 bp
  • C to T, chromosome 7 at 16,459,185 bp
  • T to C, chromosome 7 at 28,377,691 bp
  • G to A, chromosome 7 at 30,162,422 bp
  • T to C, chromosome 7 at 43,794,275 bp
  • A to T, chromosome 7 at 44,228,569 bp
  • C to T, chromosome 7 at 45,995,328 bp
  • A to G, chromosome 7 at 105,567,276 bp
  • T to A, chromosome 8 at 14,930,157 bp
  • A to G, chromosome 8 at 105,978,186 bp
  • T to C, chromosome 9 at 66,019,908 bp
  • T to A, chromosome 9 at 114,631,881 bp
  • A to G, chromosome 10 at 74,550,490 bp
  • A to G, chromosome 10 at 116,346,867 bp
  • C to T, chromosome 11 at 46,242,403 bp
  • C to T, chromosome 11 at 70,669,203 bp
  • A to T, chromosome 11 at 94,368,239 bp
  • T to C, chromosome 11 at 104,534,814 bp
  • C to T, chromosome 13 at 14,316,164 bp
  • T to C, chromosome 13 at 119,712,626 bp
  • G to A, chromosome 14 at 20,690,773 bp
  • G to C, chromosome 14 at 33,955,296 bp
  • C to T, chromosome 15 at 9,306,479 bp
  • T to C, chromosome 15 at 89,160,623 bp
  • A to G, chromosome 16 at 17,386,265 bp
  • A to G, chromosome 16 at 34,815,452 bp
  • A to T, chromosome 16 at 44,491,182 bp
  • A to G, chromosome 16 at 58,463,066 bp
  • T to C, chromosome 17 at 15,566,211 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to G, chromosome 18 at 59,176,352 bp
  • A to T, chromosome 18 at 59,179,474 bp
  • A to G, chromosome 18 at 77,372,911 bp
  • T to C, chromosome 19 at 41,247,933 bp
  • T to C, chromosome 19 at 47,797,129 bp
  • A to G, chromosome 19 at 50,190,161 bp
  • G to A, chromosome Y at 1,304,756 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4385 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041124-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.