Strain Name:
C57BL/6J-MtgxR4421Btlr/Mmmh
Stock Number:
041142-MU
Citation ID:
RRID:MMRRC_041142-MU
Other Names:
R4421 (G1), C57BL/6J-MtgxR4421Btlr
Major Collection:

Strain Information

Map2k5
Name: mitogen-activated protein kinase kinase 5
Synonyms: MEK5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23938
VEGA: 9
HGNC: HGNC:6845
Homologene: 115933
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Tfpi
Name: tissue factor pathway inhibitor
Synonyms: A630013F22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21788
Homologene: 4579
Gtf2i
Name: general transcription factor II I
Synonyms: BAP-135, TFII-I, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Ranbp17
Name: RAN binding protein 17
Synonyms: 4932704E15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66011
Homologene: 36409
Dhx35
Name: DEAH-box helicase 35
Synonyms: 1200009D07Rik, Ddx35
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71715
Homologene: 6406
Ddx42
Name: DEAD box helicase 42
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 42, B430002H05Rik, 1810047H21Rik, SF3b125
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72047
Homologene: 49137
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 1810043M20Rik, Bat2d, Bat2l2, 9630039I18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Rbm28
Name: RNA binding motif protein 28
Synonyms: 2810480G15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68272
Homologene: 135952
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Acy1
Name: aminoacylase 1
Synonyms: Acy-1, 1110014J22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109652
HGNC: HGNC:177
Homologene: 110440
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: Zubr1, 1810009A16Rik, D930005K06Rik, LOC381562, p600, A930005E13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Ms4a4c
Name: membrane-spanning 4-domains, subfamily A, member 4C
Synonyms: 5830413L19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 64380
Homologene: 113790
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Plc, Pcn, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
Cpped1
Name: calcineurin-like phosphoesterase domain containing 1
Synonyms: C530044N13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 223978
Homologene: 10142
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 667772
VEGA: 16
Homologene: 18929
Cntn3
Name: contactin 3
Synonyms: Pang
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18488
HGNC: HGNC:2173
Homologene: 7461
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Gpr98, Mgr1, Mass1, VLGR1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: D16Ertd642e, 6330444M21Rik, Wdr52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212517
Homologene: 75085
Gbp6
Name: guanylate binding protein 6
Synonyms: Mpa2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100702
Homologene: 128731
Tma16
Name: translation machinery associated 16
Synonyms: 1810029B16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66282
Homologene: 10146
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Gm7455, Col6a5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Vmn2r72
Name: vomeronasal 2, receptor 72
Synonyms: EG244114, Vmn2r72-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244114
Homologene: 115466
Krt13
Name: keratin 13
Synonyms: K13, Krt-1.13, Krt1-13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16663
HGNC: HGNC:6415
Homologene: 40740
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: Whsc1l1, WHISTLE
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
Hip1r
Name: huntingtin interacting protein 1 related
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 29816
Homologene: 78348
Cyp3a59
Name: cytochrome P450, family 3, subfamily a, polypeptide 59
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100041449
Homologene: 135775
Vmn2r68
Name: vomeronasal 2, receptor 68
Synonyms: EG620697, Vmn2r68-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620697
Homologene: 115466
Asz1
Name: ankyrin repeat, SAM and basic leucine zipper domain containing 1
Synonyms: ORF3, 4933400N19Rik, Gasz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74068
HGNC: HGNC:1350
Homologene: 11374
Or2ag2
Name: olfactory receptor family 2 subfamily AG member 2
Synonyms: MOR283-11, GA_x6K02T2PBJ9-9271198-9270248, Olfr706
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258350
Homologene: 133646
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
C1s2
Name: complement component 1, s subcomponent 2
Synonyms: Gm5077
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 317677
HGNC: HGNC:1247
Homologene: 1314
Spopl
Name: speckle-type BTB/POZ protein-like
Synonyms: 4921517N04Rik, E430033K04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76857
Homologene: 78016
Neurod2
Name: neurogenic differentiation 2
Synonyms: Ndrf, bHLHa1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18013
HGNC: HGNC:7763
Homologene: 4489
Sbpl
Name: spermine binding protein-like
Synonyms: 2310068J22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638345
VEGA: 17
Homologene: 117464
Aga
Name: aspartylglucosaminidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11593
HGNC: HGNC:318
Homologene: 13
Capza3
Name: capping actin protein of muscle Z-line subunit alpha 3
Synonyms: Tex8, repro32, Gsg3, 510-4, Cappa3, cp alpha3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12344
Homologene: 7253
Or4p22
Name: olfactory receptor family 4 subfamily P member 22
Synonyms: Olfr1184, GA_x6K02T2Q125-49974190-49975125, MOR225-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258820
Homologene: 73980
Gm5705
Name: predicted gene 5705
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 435651
VEGA: 1
Abhd1
Name: abhydrolase domain containing 1
Synonyms: alpha/beta hydrolase-1, LABH-1, LABH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 57742
Prrg3
Name: proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)
Synonyms: LOC208748
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 208748
Homologene: 11452
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 152,485,012 bp
  • G to T, chromosome 1 at 162,628,887 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • C to T, chromosome 2 at 23,517,945 bp
  • AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA to AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA, chromosome 2 at 84,434,424 bp
  • GATA to GATATATA, chromosome 2 at 84,434,452 bp
  • A to T, chromosome 2 at 88,487,241 bp
  • A to T, chromosome 2 at 158,806,401 bp
  • G to A, chromosome 4 at 137,548,122 bp
  • A to G, chromosome 4 at 139,461,856 bp
  • T to C, chromosome 5 at 30,953,469 bp
  • T to C, chromosome 5 at 105,224,651 bp
  • G to C, chromosome 5 at 123,997,862 bp
  • T to C, chromosome 5 at 134,255,037 bp
  • A to G, chromosome 5 at 146,104,903 bp
  • A to G, chromosome 6 at 18,054,582 bp
  • T to C, chromosome 6 at 29,154,837 bp
  • T to C, chromosome 6 at 31,428,232 bp
  • A to G, chromosome 6 at 102,464,547 bp
  • T to C, chromosome 6 at 124,625,215 bp
  • G to A, chromosome 6 at 140,042,042 bp
  • TCC to TC, chromosome 7 at 85,221,550 bp
  • T to C, chromosome 7 at 85,738,500 bp
  • G to T, chromosome 7 at 106,886,453 bp
  • T to A, chromosome 8 at 25,641,272 bp
  • T to C, chromosome 8 at 53,511,826 bp
  • C to T, chromosome 8 at 66,484,171 bp
  • A to G, chromosome 9 at 63,164,130 bp
  • A to T, chromosome 9 at 105,928,473 bp
  • G to C, chromosome 9 at 106,435,713 bp
  • A to T, chromosome 11 at 33,475,056 bp
  • G to T, chromosome 11 at 98,328,200 bp
  • T to G, chromosome 11 at 100,118,935 bp
  • T to A, chromosome 11 at 106,231,138 bp
  • T to C, chromosome 13 at 81,566,302 bp
  • A to G, chromosome 14 at 87,486,283 bp
  • T to C, chromosome 15 at 65,995,511 bp
  • T to C, chromosome 16 at 11,805,357 bp
  • T to C, chromosome 16 at 44,422,437 bp
  • T to A, chromosome 16 at 49,109,344 bp
  • A to G, chromosome 17 at 23,954,886 bp
  • T to A, chromosome 19 at 11,416,375 bp
  • A to T, chromosome X at 71,967,309 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4421 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041142-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.